Preparation and evaluation method of scolospora toxin gene engineering antibody

Abstract

The preparation and evaluation method comprises the following steps: 1, extracting a heavy-chain DNA fragment and a light-chain DNA fragment, carrying out recombinant transformation by using an overlapping PCR method to construct an scFv gene, 2, constructing an expression vector, culturing the expression vector, carrying out sequencing identification to obtain an scFv bacterial solution, recombining the scFv bacterial solution with a mouse Fc fragment, and identifying a sequence to obtain an MN8 bacterial solution, the method comprises the following steps: 1, preparing an MN8 bacterial liquid, 2, extracting the MN8 bacterial liquid, 3, carrying out inoculated culture on the MN8 bacterial liquid to obtain an MN8 genetically engineered antibody bacterial liquid, 4, extracting MN8 genetically engineered antibody bacterial liquid plasmids and carrying out transfection expression purification, and 5, carrying out antibody titer and thermal stability determination on the MN8 genetically engineered antibody. The scFv single-chain antibody obtained by recombination according to the method has the advantages of small molecular weight, high penetrability and the like, the stability and the sensitivity of an immunoassay method of the scolosporins can be improved, and a certain basis is provided for rapid determination of the scolosporins.

Description

Technical Field

[0001] The present invention relates to the field of biological research technology, and in particular to a method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin. Background Art

[0002] Cylindrospermopsin (CYN) is a cyanobacterial toxin that has attracted widespread attention after microcystins. It is potentially harmful to humans, animals, and plants. Antibody-based immunoassays are one of the commonly used techniques for cyanobacterial toxin risk assessment.

[0003] The foundation of immunoassays is the successful preparation of monoclonal or polyclonal antibodies. Antibody preparation for microcystins began in the 1980s. To date, a large number of studies have been conducted on the preparation of antibodies for different isomers and epitopes of microcystins, as well as the development of various immunoassay methods. In comparison, reports on the preparation of antibodies for CYN are extremely rare.

[0004] The research and application of genetically engineered antibodies in the determination of cyanobacterial toxins mainly focuses on the modification of antibodies for microcystins. Compared with the monitoring methods for microcystins, the monitoring methods for cylindrocystis toxin are still extremely limited. Therefore, the present invention proposes a method for preparing and evaluating genetically engineered antibodies for cylindrocystis toxin to overcome the problems existing in the existing technology. Summary of the Invention

[0005] In response to the above problems, the present invention aims to provide a method for preparing and evaluating genetically engineered antibodies to cylindrospora toxin. The method aims to improve the detection sensitivity of the direct competitive ELISA method and provide a certain basis for the rapid and accurate determination of cylindrospora toxin.

[0006] To achieve the purpose of the present invention, the present invention is implemented by the following technical solution: a method for preparing and evaluating a genetically engineered antibody to cylindrosporine toxin, comprising the following steps:

[0007] Step 1: cDNA of the N8 hybridoma cell line was obtained by RT-PCR, and degenerate primers were used to extract the variable region gene heavy chain DNA fragment and light chain DNA fragment, which were then recombined and transformed by overlapping PCR to construct the scFv gene;

[0008] Step 2: The scFv gene and the mouse Fc gene were ligated and recombined into the linearized peaSKY203 vector using overlapping PCR to obtain an expression vector. The expression vector was transformed into competent E. coli and plated. Single clones were picked for sequencing and identification to obtain the correctly sequenced MN8 bacterial solution.

[0009] Step 3: The MN8 bacterial solution with correct sequencing was inoculated and cultured to obtain the MN8 genetically engineered antibody bacterial solution, and the concentration was measured after plasmid extraction and identification was performed using the ELISA method;

[0010] Step 4: Inoculate and culture the MN8 genetically engineered antibody solution and extract the plasmid for transfection and expression, purify it using a protein G purification column, and finally identify it using a direct competitive ELISA method;

[0011] Step 5: Determine the antibody titer and thermal stability of the MN8 genetically engineered antibody.

[0012] A further improvement is that the step 1 specifically includes:

[0013] S1. Resuscitate the preserved cell lines using the trizol method, extract RNA, and store the RNA at -80°C.

[0014] S2. Using the RT-PCR method, the extracted RNA was processed using a kit to obtain the cDNA fragment of N8;

[0015] S3. PCR amplification was performed using degenerate primers and cDNA as a template. After amplification, the reaction products were identified by 1.5% agarose gel electrophoresis and recovered using a DNA gel recovery kit.

[0016] S4. Take 1 μl of each of the recovered heavy chain DNA fragments and light chain DNA fragments and recombinantly ligate them with the T vector. Transform 10 μl of the ligation products into E. coli DH5α competent cells, spread them on plates, and invert them in a 37°C incubator for overnight culture.

[0017] S5. Pick a single recombinant bacterial colony for sequencing. The results are analyzed using SnapGene software. The bacterial solution with the correct sequence is added with 50% glycerol at a ratio of 1:1 and stored at -80°C for later use.

[0018] S6. Use the bacterial solution with the correct sequence to extract the heavy chain DNA fragment and the light chain DNA fragment plasmid, then use the overlapping PCR method to synthesize the scFv fragment through the linker (GGGGS)n, and perform sequence identification and preservation as above to obtain the scFv gene.

[0019] A further improvement is that the competent cells transformed in S4 were placed in an ice bath for 15 min and then heat-shocked at 42°C for 60 s, placed on ice for 2 min, and then 500 μl of each was spread on Amp + 2YT plates for culture.

[0020] A further improvement is that the primers used in the overlapping PCR in step 2 are 203MN8SCLF, MN8SCHR, 2AFCF and 2AFCR, and the primer sequences are shown in SEQ ID No. 1 to SEQ ID No. 4 respectively.

[0021] A further improvement is that: Step 3 specifically uses 6 ml of sterile 2YT culture medium to be added to a sterile test tube and ampicillin is added at a concentration of 1:1000. Then, the correctly sequenced MN8 bacterial liquid is inoculated into a glass shake tube with an inoculum volume of 1 μl, and the culture is shaken overnight. Finally, the plasmid is extracted using a small amount of plasmid extraction kit and its concentration is measured.

[0022] A further improvement is that: in the step three, the ELISA method is used for identification, specifically, 293F cells are plated and cultured in a 12-well plate in advance and transfected the next day; 7 μl of plasmid is mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes, 4.5 μg of transfection reagent PEI is mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes, and finally the two are mixed and shaken, and then allowed to stand for 15-20 minutes, and then suspended and evenly added to the 12-well plate and cultured for 48 hours, and then the cell supernatant is collected and identified by ELISA.

[0023] A further improvement is that in step 4, the MN8 genetically engineered antibody bacterial culture was inoculated by adding 400 ml of sterile 2YT medium to a 1000 ml conical flask. 1:1000 ampicillin was added in a clean bench, and 10 μl of the preserved bacterial culture was inoculated. The culture was then shaken overnight at 37°C in a shaker. The next day, the precipitate was collected by centrifugation, and plasmids were extracted and endotoxin removed using a large-scale plasmid extraction kit. The resulting plasmid concentration was determined before transfection and expression.

[0024] A further improvement is that the transfection expression is specifically to culture 293F cells in advance after reviving and culturing them in a 250 ml cell culture flask until the density reaches 1.2-2.0×10 6 cells / ml for transfection. Add 300 μg of plasmid and mix it with serum-free cell culture medium in a test tube and let it stand for 3 minutes. Add 900 μg of transfection reagent PEI to another test tube and mix it with serum-free culture medium and let it stand for 3 minutes. Then mix the solutions in the two test tubes, let it stand for 15-20 minutes, and add it to the cell culture flask to complete the transfection.

[0025] A further improvement is that before purification in step 4, the cultured cell fluid is centrifuged at 6000 rpm for 10 minutes, the precipitate is removed and the supernatant is retained, which is then filtered using a 0.22 μm filter membrane before purification; during purification, the entire solution bacteria is filtered through a 0.45 μm membrane before sampling.

[0026] The further improvement is that: the antibody titer determination in step 5 is specifically carried out by indirect competitive ELISA, wherein HRP-CYN is 1:5000, the dilution of MN8 genetic engineering antibody is diluted in 10-fold gradient, and the OD is measured by microplate reader. 450 The thermal stability test is specifically to heat the antibody at different temperatures for 5 minutes, then return to room temperature for direct competitive ELISA test, 50μl HRP-CYN plus 50μl of antibody treated at different temperatures, and measure the remaining antibody binding activity with the antigen. Three parallel groups are set for each group, and the binding value after treatment at 25℃ is taken as 100% binding control. The average absorbance value of each repeated measurement sample is calculated, and the relative residual binding activity of each antibody is calculated according to the following formula RT Binding

[0027]

[0028] OD 450 Heat represents the average absorbance value of the heat treatment group, OD 450 25℃ represents the average absorbance value of the room temperature treatment group.

[0029] The beneficial effects of the present invention are as follows: based on the anti-cylindrospora toxin monoclonal antibody N8, the present invention successfully obtains the VH and VL fragment sequences of the antibody variable region by using RT-PCR, degenerate primers, overlapping PCR, seamless cloning and other technologies and recombines them into scFv single-chain antibodies, and then connects the mouse Fc segment to it by overlapping PCR to obtain the MN8 (scFv-Fc) antibody, which can improve the stability and sensitivity of the cylindrospora toxin immunoassay method and provide a certain basis for the rapid and accurate determination of cylindrospora toxin. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The electrophoresis diagram of the variable region fragment of the antibody of the present invention.

[0031] Figure 2 This is the electrophoresis diagram of the mouse Fc segment of the present invention.

[0032] Figure 3 This is the electrophoresis diagram of the colony PCR of the antibody scFv-Fc fragment of the present invention.

[0033] Figure 4 This is a diagram for identifying the activity of MN8 of the present invention.

[0034] Figure 5 This is the SDS-PAGE identification diagram of the purified MN8 antibody of the present invention.

[0035] Figure 6 This is a graph showing the titer determination of the antibody of the present invention.

[0036] Figure 7 This is a comparison chart of the temperature stability of different antibodies of the present invention.

[0037] Figure 8 This is a standard curve diagram for detecting cylindrospermella toxin by direct competitive ELISA of the present invention. DETAILED DESCRIPTION

[0038] In order to deepen the understanding of the present invention, the present invention will be further described in detail below with reference to the examples. The examples are only used to explain the present invention and do not constitute a limitation on the scope of protection of the present invention.

[0039] The anti-CYN monoclonal antibody N8 hybridoma cell line in the present invention was preserved by this laboratory; the plasmid vector peaSKY203 (laboratory-built); Escherichia coli (DH5α) was purchased from Kangti Life Science Co., Ltd.; CYN standard was purchased from ALEXIS; horseradish peroxidase (HRP) was purchased from Sigma-Aldrich; DEME medium was purchased from Thermo Fisher Scientific; 293 serum-free medium was purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.; HEK293F cells (laboratory-preserved); cell transfection reagent (PEI) was purchased from Shanghai Liji Biotechnology Co., Ltd.; seamless cloning reagent was purchased from Wuhan Aibotek; fast PCR polymerase was purchased from Beijing Baori Medical Co., Ltd.; ampicillin was purchased from Beijing Solaibao Co., Ltd.; plasmid miniprep kit, DNA gel recovery kit, endotoxin-free plasmid extraction kit, and TA cloning kit were all purchased from Beijing Zhuangmeng International Biological Co., Ltd.; GLDNAmarker 1000 and GL DNAmarker 2000 was purchased from Acre Biotechnology Co., Ltd.; mouse secondary antibody plate, color development solution A, B and stop solution were provided by Guangzhou Darui Biological Co., Ltd.; other reagents were from Sinopharm Chemical Reagent Co., Ltd. unless otherwise specified.

[0040] Example

[0041] according to Figures 1-8 As shown, this embodiment provides a method for preparing and evaluating a genetically engineered antibody to cylindrosporine toxin, comprising the following steps:

[0042] Step 1: cDNA of the N8 hybridoma cell line was obtained by RT-PCR, and degenerate primers were used to extract the variable region gene heavy chain DNA fragment and light chain DNA fragment, which were then recombined and transformed by overlapping PCR to construct the scFv gene;

[0043] Specifically include:

[0044] S1. Use the Trizol method to recover the preserved cell lines and extract RNA. Maintain sterility and enzyme-free conditions throughout the process, and store the RNA at -80°C to prevent degradation and contamination.

[0045] S2. Using the RT-PCR method, the extracted RNA was processed using a kit to obtain the cDNA fragment of N8;

[0046] S3. PCR amplification was performed using degenerate primers and cDNA as a template. After amplification, the reaction products were identified by 1.5% agarose gel electrophoresis and recovered using a DNA gel recovery kit and stored at -20°C for later use.

[0047] S4. Take 1 μl of each of the recovered heavy chain DNA fragment and light chain DNA fragment and recombinantly connect them with the T vector. Transform 10 μl of the ligation products into E. coli DH5α competent cells, mix gently, place on ice for 15 minutes, then heat shock at 42°C for 60 seconds, place on ice for 2 minutes, and then take 500 μl of each and apply it to Amp + 2YT plates were cultured and placed upside down in a 37°C incubator overnight;

[0048] S5. Pick a single recombinant bacterial colony for sequencing. The results are analyzed using SnapGene software. The bacterial solution with the correct sequence is added with 50% glycerol at a ratio of 1:1 and stored at -80°C for later use.

[0049] S6. Use the bacterial solution with the correct sequence to extract the heavy chain DNA fragment and the light chain DNA fragment plasmid, then use the overlapping PCR method to synthesize the scFv fragment through the linker (GGGGS)n, and perform sequence identification and preservation as above to obtain the scFv gene.

[0050] Step 2: The scFv gene and the mouse Fc gene were ligated and recombined into the linearized peaSKY203 vector using overlapping PCR to obtain an expression vector. The expression vector was transformed into competent E. coli and plated. Single clones were picked for sequencing and identification to obtain the correctly sequenced MN8 bacterial solution.

[0051] The primers used in overlapping PCR are 203MN8SCLF, MN8SCHR, 2AFCF and 2AFCR, and the primer sequences are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively, as shown in Table 1 below.

[0052] Table 1 Primer sequence list

[0053] Primer name Primer (5′-3′) 203MN8SCLF gtgcctggctccagcgaggacgctcaagccgtggtgacccaagaga MN8SCHR gcctctaggagagctgctgcctccgccggcgctcacggtcaccagggt 2AFCF agcagctctcctagaggccccaccatcaagccct 2AFCR gtcgaggctgatcagcgggtttattagggggttctgctgaagctctt

[0054] Step 3: The MN8 bacterial solution with correct sequencing was inoculated and cultured to obtain the MN8 genetically engineered antibody bacterial solution, and the concentration was measured after plasmid extraction and identification was performed using the ELISA method;

[0055] Specifically, 6 ml of sterile 2YT culture medium was added to a sterile test tube and ampicillin was added at a 1:1000 ratio. The correctly sequenced MN8 culture was then inoculated into a glass shaker tube with an inoculum volume of 1 μl. The culture was shaken overnight. Finally, the plasmid was extracted using a small-scale plasmid extraction kit and its concentration was measured.

[0056] The ELISA method was used for identification. Specifically, 293F cells were plated and cultured in a 12-well plate in advance and transfected the next day. 7 μl of plasmid was mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes. 4.5 μg of transfection reagent PEI was mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes. Finally, the two were mixed and shaken, and then allowed to stand for 15-20 minutes. After that, the suspension was evenly added to the 12-well plate and cultured for 48 hours. The cell supernatant was then collected and identified by ELISA. The purchased mouse The secondary antibody plate was taken out from -20℃ in advance and placed at room temperature for about 30 minutes. 50μl of pre-connected HRP-CYN (1:1000) was added first, followed by 50μl of cell supernatant and incubated at 37℃ for 1 hour. The plate was washed 5 times and the washing solution was dried. 100μl of color development solution A and B (1:1 mixture) was added and reacted in the dark for 30 minutes to wait for color development. A positive reaction will show blue. Finally, 50μl of stop solution (2M sulfuric acid) was added and the color changed from blue to yellow.

[0057] Step 4: The MN8 genetically engineered antibody solution was inoculated and cultured, transfected and expressed, and purified using a protein G purification column. Before purification, the cultured cell solution was centrifuged at 6000 rpm for 10 minutes, the precipitate was removed, and the supernatant was retained. It was then filtered through a 0.22 μm filter membrane before purification. All solutions required for purification were filtered through a 0.45 μm membrane and then sampled. The purified antibody was added to the neutralization solution and the concentration was determined and stored at -20°C for later use. Finally, it was identified using a direct competitive ELISA method.

[0058] A certain amount of the purified protein sample was denatured at high temperature and subjected to SDS-PAGE electrophoresis. After electrophoresis, it was stained with Coomassie Brilliant Blue to observe whether the band size was correct.

[0059] ELISA was used to determine whether it bound to CYN and developed color, and the range of genetically engineered antibodies and enzyme-labeled antigen HRP-CYN was determined by checkerboard titration;

[0060] The MN8 genetically engineered antibody bacterial solution was added to 50% glycerol at a 1:1 ratio and stored at -80°C. The inoculation culture was performed by adding 400ml of sterilized 2YT medium to a 1000ml conical flask. In a clean bench, 1:1000 ampicillin (original concentration 50mg / ml) was added, and 10μl of the preserved bacterial solution was inoculated. The culture was shaken and cultured overnight at 37°C in a shaker. The next day, the precipitate was collected by centrifugation, and plasmids were extracted and endotoxins were removed using a large number of plasmid extraction kits. The resulting plasmid concentration was determined before transfection and expression.

[0061] The specific transfection expression was to recover and culture 293F cells in advance and then culture them in a 250 ml cell culture flask until the density reached 1.2-2.0×10 6 cells / ml for transfection. Add 300 μg of plasmid and mix it with serum-free cell culture medium in a test tube and let it stand for 3 minutes. Add 900 μg of transfection reagent PEI to another test tube and mix it with serum-free culture medium and let it stand for 3 minutes. Then mix the solutions in the two test tubes, let it stand for 15-20 minutes, and add it to the cell culture flask to complete the transfection.

[0062] Step 5: Determine the antibody titer and thermal stability of the MN8 genetically engineered antibody;

[0063] The antibody titer was determined by indirect competitive ELISA, where HRP-CYN was 1:5000, and the dilution of MN8 genetically engineered antibody was diluted in 10-fold gradients (1:10 to 1:10000). 450 nm absorbance determination;

[0064] The thermal stability assay was specifically performed by heating the antibodies at different temperatures for 5 minutes and then returning them to room temperature for direct competitive ELISA assay. 50 μl of HRP-CYN (1:5000) was added to 50 μl of the antibody treated at different temperatures (original concentration 0.3 mg / ml) (1:100), and the remaining antibody binding activity to the antigen was measured. Three parallel groups were set for each group, and the binding value after treatment at 25°C was taken as 100% binding control. The average absorbance value of each repeated sample was calculated, and the relative residual binding activity of each antibody was calculated according to the following formula: RT Binding

[0065]

[0066] OD 450 Heat represents the average absorbance value of the heat treatment group, OD 450 25℃ represents the average absorbance value of the room temperature treatment group.

[0067] result:

[0068] 1. Obtaining the monoclonal antibody N8 variable region gene

[0069] After PCR amplification, the variable region VH and VL fragments were obtained and the band sizes were identified by agarose gel electrophoresis, as shown in the attached manual. Figure 1 As shown, M in the figure is DNA marker DL1000;

[0070] Bands 1, 3, 5, and 6 are PCR products for amplifying heavy chain fragments; bands 2 and 4 are PCR products for amplifying light chain fragments. Bands 1, 2, and 6 were amplified successfully and their sizes were as expected, and they can be used for later recombination construction.

[0071] 2. Construction and expression of recombinant N8-scFv-mFc (MN8) fusion protein

[0072] The single-chain antibody was synthesized by overlapping PCR using Linker, and was connected to the Fc fragment to improve its stability. Figure 2 This is the electrophoresis diagram of the amplified fragment of mouse Fc segment, as shown in the attached instructions. Figure 3 This is the electrophoresis diagram of the antibody scFv-Fc (MN8) fragment amplified by colony PCR, and the correct size band was recovered by gel cutting.

[0073] 3. MN8 expression and identification

[0074] After antibody transfection and expression, it was verified by indirect competitive ELISA. The color development results are shown in the attached instructions. Figure 4 Compared with the positive control, the results showed that the antibody MN8 still had the ability to bind to CYN.

[0075] 4. Mass expression and identification of genetically engineered antibodies

[0076] The above-constructed genetically engineered antibody MN8 was extracted and plasmid was transfected into HEK293F cells and purified by protein G affinity chromatography. The protein was identified by SDS-PAGE electrophoresis as shown in the attached manual. Figure 5 As shown in the figure, M1 and M2 are 10-150kDa protein markers, band 1 is the original solution before MN8 elution, band 2 is the solution after MN8 elution, and bands 3-4 are purified MN8 antibody solutions; from band 1 in the figure, it can be seen that the concentration of the antibody in the cell supernatant before purification is low, and after enrichment and elution, the concentration of bands 3 and 4 increases, and after enrichment in the filler, there is basically no antibody in the eluted solution (shown in band 2). After purification, the concentration is increased and impurities such as cell debris are removed, which improves the specificity of the antibody in the later stage.

[0077] 5. Antibody titer determination

[0078] As the instruction manual Figure 6The figure shows a comparison of the titers of two antibodies. N8 is a monoclonal antibody previously retained in the laboratory. By indirect ELISA, the antibody was serially diluted and reacted with HRP-CYN at a fixed amount of HRP-CYN (1:5000). As can be seen from the figure, when the dilution gradient reached 1:10000 (the original concentration was 0.3 mg / ml), the color development dropped to the lowest and the OD value leveled off. This shows that the titer of the genetically engineered antibody MN8 is very similar to that of the monoclonal antibody N8.

[0079] 6. Antibody thermal stability determination

[0080] As the instruction manual Figure 7 The two antibodies shown were tested for thermal stability. RT Binding represents the relative residual binding activity (using the 25°C treatment group as the control). Higher values ​​indicate better thermal stability. The figure shows that the stability of both antibodies gradually decreases after temperatures exceed 60°C, indicating consistent performance. The typical ELISA incubation condition is 37°C. At this temperature, a highly significant difference (P < 0.01) was observed between the two antibodies, with MN8 exhibiting a higher relative residual activity.

[0081] 7. Determine the optimal reaction dilution of antibody and HRP-CYN

[0082] When the HRP-CYN dilution was fixed, the OD value decreased as the antibody amount decreased. When the antibody dilution was 1:400, the OD value dropped sharply. To ensure a higher absorbance value, the dilution gradient of MN8 for direct competitive ELISA was finally determined to be 1:200, and the dilution gradient of HRP-CYN was 1:8000.

[0083] 8. Direct competition ELISA standard curve

[0084] The standard curve of direct competitive ELISA is shown in the appendix of the instruction manual. Figure 8 Figure (a) shows the absorbance response curve for the MN8 antibody in the range of 0 to 400 ng / mL, and (b) shows the logit-log linear standard curve for the MN8 antibody. Within the range of 0 to 400 ng / mL, the standard curve exhibits a typical S-shaped curve. Using the logit-log method for linear fitting, the antibody exhibits good linearity from 0 to 4 ng / mL. Furthermore, the coefficient of variation for three replicates of the MN8 standard sample ranged from 0.09% to 2.45%, demonstrating the good reproducibility of the ELISA standard curve established in this study.

[0085] 9. Sensitivity and stability of the method

[0086] When the CYN concentration is 0 ng / mL, its OD 450The sensitivity of the direct competitive ELISA method is obtained by subtracting 2 times the standard deviation from the mean absorbance value at nm and inserting it into the standard curve. The calculated results for the MN8 antibody are 0.079 ng / ml, which is similar to the sensitivity of N8 (0.069 ng / mL) (Yang Dan et al., 2023). The mean IC80 at three different time periods is 3.43 ng / ml and the SD is less than 10%, indicating good stability.

[0087] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the foregoing embodiments. The foregoing embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing and evaluating a genetically engineered antibody against cylindrospermella toxin, characterized in that: The following steps are involved: Step 1: cDNA of the N8 hybridoma cell line was obtained by RT-PCR, and degenerate primers were used to extract the variable region gene heavy chain DNA fragment and light chain DNA fragment, which were then recombined and transformed by overlapping PCR to construct the scFv gene; Step 2: The scFv gene and the mouse Fc gene were ligated and recombined into the linearized peaSKY203 vector using overlapping PCR to obtain an expression vector. The expression vector was transformed into competent E. coli and plated. Single clones were picked for sequencing and identification to obtain the correctly sequenced MN8 bacterial solution. Step 3: The MN8 bacterial solution with correct sequencing was inoculated and cultured to obtain the MN8 genetically engineered antibody bacterial solution, and the concentration was measured after plasmid extraction and identification was performed using the ELISA method; Step 4: Inoculate and culture the MN8 genetically engineered antibody solution and extract the plasmid for transfection and expression, purify it using a protein G purification column, and finally identify it using a direct competitive ELISA method; Step 5: Determine the antibody titer and thermal stability of the MN8 genetically engineered antibody.

2. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: The step 1 specifically includes S1. Resuscitate the preserved cell lines using the trizol method, extract RNA, and store the RNA at -80°C. S2. Using the RT-PCR method, the extracted RNA was processed using a kit to obtain the cDNA fragment of N8; S3. PCR amplification was performed using degenerate primers and cDNA as a template. After amplification, the reaction products were identified by 1.5% agarose gel electrophoresis and recovered using a DNA gel recovery kit. S4. Take 1 μl of each of the recovered heavy chain DNA fragments and light chain DNA fragments and recombinantly ligate them with the T vector. Transform 10 μl of the ligation products into E. coli DH5α competent cells, spread them on plates, and invert them in a 37°C incubator for overnight culture. S5. Pick a single recombinant bacterial colony for sequencing. The results are analyzed using SnapGene software. The bacterial solution with the correct sequence is added with 50% glycerol at a ratio of 1:1 and stored at -80°C for later use. S6. Use the bacterial solution with the correct sequence to extract the heavy chain DNA fragment and the light chain DNA fragment plasmid, then use the overlapping PCR method to synthesize the scFv fragment through the linker (GGGGS)n, and perform sequence identification and preservation as above to obtain the scFv gene.

3. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 2, wherein: The competent cells transformed in S4 were placed in an ice bath for 15 min and then heat-shocked at 42°C for 60 s, placed on ice for 2 min, and then 500 μl of each was spread on Amp + 2YT plates for culture.

4. The method for preparing and evaluating a genetically engineered antibody against cylindrospermella toxin according to claim 1, wherein: The primers used in the overlapping PCR in step 2 are 203MN8SCLF, MN8SCHR, 2AFCF and 2AFCR, and the primer sequences are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively.

5. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: The step three specifically involves adding 6 ml of sterile 2YT culture medium to a sterile test tube and adding 1:1000 ampicillin. Then, the correctly sequenced MN8 bacterial solution is inoculated into a glass shake tube with an inoculum volume of 1 μl, and cultured on a shaker overnight. Finally, the plasmid is extracted using a small amount of plasmid extraction kit and its concentration is determined.

6. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: In step three, the ELISA method is used for identification. Specifically, 293F cells are plated and cultured in a 12-well plate in advance and transfected the next day; 7 μl of plasmid is mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes, 4.5 μg of transfection reagent PEI is mixed with 75 μl of cell culture medium and allowed to stand for 3 minutes, and finally the two are mixed and shaken, and then allowed to stand for 15-20 minutes, and then suspended and evenly added to the 12-well plate and cultured for 48 hours, and then the cell supernatant is collected and identified by ELISA.

7. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: In step 4, the MN8 genetically engineered antibody culture was inoculated by adding 400 ml of sterilized 2YT medium to a 1000 ml conical flask. Ampicillin was added at a 1:1000 dilution in a clean bench, and 10 μl of the preserved culture was inoculated. The culture was then shaken overnight at 37°C in a shaker. The next day, the precipitate was collected by centrifugation, and plasmids were extracted and endotoxin removed using a large-scale plasmid extraction kit. The resulting plasmid concentration was determined before transfection and expression.

8. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 7, characterized in that: The transfection expression is specifically to recover and culture 293F cells in advance and then culture them in a 250 ml cell culture flask until the density reaches 1.2-2.0×10 6 cells / ml for transfection. Add 300 μg of plasmid and mix it with serum-free cell culture medium in a test tube and let it stand for 3 minutes. Add 900 μg of transfection reagent PEI to another test tube and mix it with serum-free culture medium and let it stand for 3 minutes. Then mix the solutions in the two test tubes, let it stand for 15-20 minutes, and add it to the cell culture flask to complete the transfection.

9. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: Before purification in step 4, the cultured cell fluid was centrifuged at 6000 rpm for 10 minutes, the precipitate was removed and the supernatant was retained, which was then filtered using a 0.22 μm filter membrane and then purified; all solutions required for purification were filtered through a 0.45 μm membrane before injection.

10. The method for preparing and evaluating a genetically engineered antibody against cylindrospermum toxin according to claim 1, characterized in that: The antibody titer determination in step 5 is specifically carried out by indirect competitive ELISA, wherein HRP-CYN is 1:5000, the dilution of MN8 genetic engineering antibody is diluted in 10-fold gradient, and the OD 450 The thermal stability test is specifically to heat the antibody at different temperatures for 5 minutes, then return to room temperature for direct competitive ELISA test, 50μl HRP-CYN plus 50μl of antibody treated at different temperatures, and measure the remaining antibody binding activity with the antigen. Three parallel groups are set for each group, and the binding value after treatment at 25℃ is taken as 100% binding control. The average absorbance value of each repeated measurement sample is calculated, and the relative residual binding activity of each antibody is calculated according to the following formula RT Binding OD 450 Heat represents the average absorbance value of the heat treatment group, OD 450 25℃ represents the average absorbance value of the room temperature treatment group.

Images