Anti-CD93 antibody, antigen binding fragment and application thereof

Abstract

The invention provides an anti-CD93 antibody or an antigen binding fragment thereof, and a preparation method and application thereof. The anti-CD93 antibody or the antigen binding fragment thereof can be specifically bound with a CD93 molecule, has strong immunoreactivity on the CD93 molecule, and can effectively block the molecular function of the CD93 molecule by binding with the CD93 molecule, thereby effectively inhibiting tumor growth. Particularly, the invention also provides a humanized anti-CD93 antibody which not only has relatively strong binding capacity to tumor cells expressing CD93 and a good concentration-dependent effect, but also can effectively block the binding of CD93 and a ligand thereof, and can inhibit HUVEC tube formation and tumor growth, so that the humanized anti-CD93 antibody can be used for treating CD93 related diseases (such as angiogenesis diseases and cancers).

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to anti-CD93 antibodies, antigen-binding fragments thereof and application thereof. BACKGROUND

[0002] CD93, also known as C1q R1, C1q R, C1q RP, is a type I transmembrane glycoprotein, CD93 is a member of the C-type lectin (CTLD) family, and members of the C-type lectin family also include CLEC14A, THBD and CD248. The typical extracellular region of the C-type lectin protein contains a C-type lectin domain, a susi domain, an EGF-like domain, and a mucin-like region. CD93 is essential for efficient endothelial cell migration and proper cell polarization in vitro, and is also conducive to tumor angiogenesis. Therefore, blocking the function of CD93 molecules has the potential to treat tumors to some extent and prevent further deterioration of tumors.

[0003] Tumor refers to a new growth formed by local tissue cell proliferation under the action of various tumorigenic factors, which can be divided into two categories: benign tumor and malignant tumor. Among them, malignant tumor (i.e. commonly known as cancer) has the characteristics of rapid growth, high invasiveness, easy metastasis, etc., and is extremely harmful to the human body, which is one of the major diseases that seriously endanger human life. Tumors can be divided into blood tumors and solid tumors according to the morphology of the tumor. At present, the biological drug treatment methods for blood tumors include antibody drugs, CAR-T, etc., but there is still a lack of effective drugs for most solid tumors. The use of immune checkpoint inhibitors (ICIs), such as targeting PD-1 / PD-L1 or CTLA4, has significantly changed the field of cancer treatment. However, a large proportion of patients still show very low response to ICIs, which may be related to the following two reasons in solid tumors: (1) the heterogeneity of tumor cells themselves, (2) the difficulty of drug exposure to tumor tissue. The great difference between the latter patients can be largely explained by the complex tumor microenvironment (TME). It has been reported that TME has a significant impact on clinical outcomes and response to treatment (Bagaev et al., 2021).

[0004] Tumor angiogenesis is characterized by uncontrolled and immaturity due to the imbalance of angiogenic factors and angiogenic inhibitors, and blood vessels are in a state of continuous growth and remodeling, forming a distorted blood vessel system. When the balance is broken, abnormal angiogenesis leads to the transformation of tumors from a benign state to a malignant state, and blood vessels are generated at the metastatic site of cancer cells to maintain growth in the new location. Angiogenesis is not only necessary for cancer development and invasion into surrounding tissues, but also necessary for the metastasis process. Without vascular support, tumors can necrose or even undergo apoptosis, and continuous angiogenesis is the most prominent marker of cancer.

[0005] At present, there is still no effective antibody drug targeting CD93 molecules in clinic to block its molecular function, thereby treating tumors and vascular proliferative diseases. SUMMARY

[0006] Object of the invention

[0007] In order to solve the problems or needs in the prior art, the purpose of the present application is to provide an anti-CD93 antibody or antigen-binding fragment thereof which can specifically bind to CD93 receptor and has strong immunoreactivity, and can effectively block the molecular function of CD93 molecules by specifically binding to CD93 molecules, a preparation method and application thereof.

[0008] Solution

[0009] In order to achieve the above-mentioned purpose, the present application has obtained a monoclonal antibody specifically targeting CD93 receptor molecules through a large number of screening, which can specifically bind to CD93 molecules with high affinity and can block its molecular function, and has tumor treatment effect.

[0010] Specifically, the present application provides the following technical solutions:

[0011] In a first aspect, the present application provides an anti-CD93 antibody or antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region, the heavy chain variable region and the light chain variable region respectively having 3 HCDRs and 3 LCDRs selected from any one of the following heavy chain variable region and light chain variable region combinations:

[0012] (1) a heavy chain variable region as shown in SEQ ID NO: 11, and a light chain variable region as shown in SEQ ID NO: 12;

[0013] (2) a heavy chain variable region as shown in SEQ ID NO: 13, and a light chain variable region as shown in SEQ ID NO: 14.

[0014] In some embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively, and the light chain variable region comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having amino acid sequences shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0015] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0016] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0017] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0018] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0019] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0020] In other embodiments, the heavy chain variable region of the antibody comprises heavy chain complementarity determining regions HCDR1, HCDR2 and HCDR3 having the amino acid sequences set forth in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively, and the light chain variable region of the antibody comprises light chain complementarity determining regions LCDR1, LCDR2 and LCDR3 having the amino acid sequences set forth in SEQ ID NO: 9, LAS and SEQ ID NO: 10, respectively.

[0021] As is known to those skilled in the art, in general, a single amino acid substitution in a non-essential region of a polypeptide does not substantially alter the biological activity (see, e.g., Watson et al. (1987) Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th ed.)). Thus, conservative modifications (in particular, conservative substitutions or replacements) of one or a few amino acids in the framework regions of the heavy chain variable region and the light chain variable region can substantially retain the biological activity of the original sequence, and therefore, the derived sequences defined using the percentage of sequence identity with the specified sequence are also within the protection scope of the present application.

[0022] When the antibody is a murine antibody, the murine antibody further comprises a murine heavy chain constant region and a murine light chain constant region, the murine heavy chain constant region is selected from one of the constant regions of the IgG1 type, the IgG2a type, the IgG2b type or the IgG3 type of mice, preferably the constant region of the IgG1 type of mice; the murine light chain constant region is the constant region of the Ck type of mice;

[0023] When the antibody is a chimeric antibody, the chimeric antibody further comprises a humanized antibody constant region.

[0024] In a second aspect, the present application provides a humanized anti-CD93 antibody or an antigen binding fragment thereof, which is a humanized anti-CD93 antibody or an antigen binding fragment thereof designed and constructed by CDR grafting technology and / or CDR region mutation based on the anti-CD93 antibody or the antigen binding fragment thereof of the first aspect as described above.

[0025] In a preferred specific embodiment, the humanized anti-CD93 antibody or the antigen binding fragment thereof has a heavy chain variable region and a light chain variable region selected from any one of the following:

[0026] (1) a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 15, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 19;

[0027] (2) a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 16, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 19;

[0028] (3) a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 17, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 19;

[0029] (4) a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 18, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 19;

[0030] (5) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 15, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 20;

[0031] (6) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 16, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 20;

[0032] (7) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 17, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 20;

[0033] (8) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 18, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 20;

[0034] (9) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 23;

[0035] (10) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 22, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 23;

[0036] (11) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 24;

[0037] (12) a heavy chain variable region of an amino acid sequence as set forth in SEQ ID NO: 22, and a light chain variable region of an amino acid sequence as set forth in SEQ ID NO: 24.

[0038] Further, the heavy chain of the humanized anti-CD93 antibody or antigen binding fragment thereof comprises a heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4, preferably human IgG1.

[0039] In a third aspect, the present application provides an ADC molecule comprising the antibody or antigen binding fragment thereof of the first or second aspect described above.

[0040] In a fourth aspect, the present application provides a bispecific or multispecific antibody molecule comprising the antibody or antigen binding fragment thereof of the first or second aspect described above.

[0041] In a fifth aspect, the present application provides a fusion protein comprising the antibody or antigen binding fragment thereof of the first or second aspect described above.

[0042] In a sixth aspect, the present application provides a polynucleotide comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof according to the first or second aspect described above. The polynucleotide is not limited by the method of its production, and can be obtained using genetic engineering recombination techniques or chemical synthesis methods.

[0043] In an embodiment, the polynucleotide is a set of polynucleotides.

[0044] In some preferred embodiments, the set of polynucleotides comprises:

[0045] a nucleotide sequence encoding a heavy chain variable region as shown in SEQ ID NO: 11 and a nucleotide sequence encoding a light chain variable region as shown in SEQ ID NO: 12;

[0046] or a nucleotide sequence encoding a heavy chain variable region as shown in SEQ ID NO: 13 and a nucleotide sequence encoding a light chain variable region as shown in SEQ ID NO: 14.

[0047] Preferably, the nucleotide sequence encoding a heavy chain variable region as shown in SEQ ID NO: 11 comprises a DNA sequence as shown in SEQ ID NO: 25 or a corresponding RNA sequence thereof, and the nucleotide sequence encoding a light chain variable region as shown in SEQ ID NO: 12 comprises a DNA sequence as shown in SEQ ID NO: 26 or a corresponding RNA sequence thereof;

[0048] Preferably, the nucleotide sequence encoding a heavy chain variable region as shown in SEQ ID NO: 13 comprises a DNA sequence as shown in SEQ ID NO: 27 or a corresponding RNA sequence thereof, and the nucleotide sequence encoding a light chain variable region as shown in SEQ ID NO: 14 comprises a DNA sequence as shown in SEQ ID NO: 28 or a corresponding RNA sequence thereof.

[0049] In a seventh aspect, the present application provides a nucleic acid construct comprising a polynucleotide according to the sixth aspect described above, and, optionally, at least one expression control element operably linked to the polynucleotide.

[0050] In an eighth aspect, the present application provides a recombinant vector comprising a polynucleotide according to the sixth aspect described above, or a nucleic acid construct according to the seventh aspect described above.

[0051] The recombinant vector of the present application can be a cloning vector or an expression vector, for example, can be, for example, a plasmid, a cosmid, a bacteriophage, etc.

[0052] In some preferred embodiments, the recombinant vector is an expression vector, preferably a eukaryotic expression vector.

[0053] In a ninth aspect, the present application provides a transformed host cell, wherein the polynucleotide of the sixth aspect above, the nucleic acid construct of the seventh aspect above or the recombinant vector of the eighth aspect above is transformed into the host cell.

[0054] The host cell can be, but is not limited to, a prokaryotic cell such as an E. coli cell, a eukaryotic cell such as a yeast cell, an insect cell, a plant cell and an animal cell (e.g. a mammalian cell such as a mouse cell, a human cell, etc.). The host cell can also be a cell line such as a 293T cell line.

[0055] In some possible embodiments, the host cell is a bacterial cell, a yeast cell or a mammalian cell.

[0056] Optionally, the bacterial cell is an E. coli cell.

[0057] Optionally, the yeast cell is a Pichia cell.

[0058] Optionally, the mammalian cell is a Chinese hamster ovary cell or a human embryonic kidney 293 cell.

[0059] In a tenth aspect, the present application provides a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of the first or second aspect above, the ADC molecule of the third aspect above, the bispecific or multispecific antibody molecule of the fourth aspect above, the fusion protein of the fifth aspect above, the polynucleotide of the sixth aspect above, the nucleic acid construct of the seventh aspect above, the recombinant vector of the eighth aspect above and / or the transformed host cell of the ninth aspect above, and a pharmaceutically acceptable excipient, diluent or carrier.

[0060] In an eleventh aspect, the present application provides a reagent or kit for detecting the presence or absence of a CD93 molecule or its expression level, comprising the antibody or antigen-binding fragment thereof of the first or second aspect above and / or the transformed host cell of the ninth aspect above.

[0061] In certain preferred embodiments, the kit is a detection or diagnostic kit, wherein the antibody or antigen-binding fragment thereof according to the present application comprised therein further comprises a detectable label; in certain preferred embodiments, the kit further comprises a second antibody which specifically recognizes the antibody or antigen-binding fragment thereof according to the present application or an anti-idiotypic antibody; preferably, the second antibody further comprises a detectable label; such detectable labels are well known to those skilled in the art and include, but are not limited to, radioisotopes, fluorescent substances, luminescent substances, colored substances and enzymes (e.g. horseradish peroxidase) and the like.

[0062] In a twelfth aspect, the present application provides a method of producing an antibody or antigen-binding fragment thereof according to the first or second aspect described above, the method comprising: expressing the antibody or antigen-binding fragment thereof according to the ninth aspect described above from the transformed host cell under conditions suitable for expression of the antibody or antigen-binding fragment thereof, and recovering the expressed antibody or antigen-binding fragment thereof from the culture of the host cell.

[0063] In a thirteenth aspect, the present application provides use of an antibody or antigen-binding fragment thereof according to the first or second aspect described above, an ADC molecule according to the third aspect described above, a bispecific or multispecific antibody molecule according to the fourth aspect described above, a fusion protein according to the fifth aspect described above, a polynucleotide according to the sixth aspect described above, a nucleic acid construct according to the seventh aspect described above, a recombinant vector according to the eighth aspect described above, a transformed host cell according to the ninth aspect described above and / or a pharmaceutical composition according to the tenth aspect described above in the manufacture of a medicament for preventing and / or treating a CD93-mediated disease, disorder or condition.

[0064] Possibly, the disease is a tumor and / or a vascular proliferative disease, preferably the disease expresses CD93; and the treatment is to alleviate, relieve, ameliorate or inhibit the symptoms or progression of the disease, disorder or condition.

[0065] Preferably, the tumor is breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, renal cancer, lung cancer, liver cancer, gastric cancer, colon cancer, bladder cancer, esophageal cancer, cervical cancer, gallbladder cancer, hematoma, lymphoma, glioblastoma and / or melanoma.

[0066] Preferably, the vascular proliferative disease is selected from the group consisting of: neovascular eye disease, psoriasis, rheumatoid arthritis or obesity characterized by abnormal neovascular proliferation.

[0067] In a fourteenth aspect, the present application provides a method of detecting the presence or expression level of CD93 molecule, the method comprising using an antibody or antigen-binding fragment thereof according to the first or second aspect described above and / or a transformed host cell according to the ninth aspect described above.

[0068] In some preferred embodiments of the method, the antibody or antigen-binding fragment thereof further comprises a detectable label.

[0069] In other preferred embodiments of the method, the method further comprises detecting the antibody or antigen-binding fragment thereof of the application using a second antibody carrying a detectable label.

[0070] The method can be used for diagnostic purposes (e.g., the sample is a sample from a patient) or non-diagnostic purposes (e.g., the sample is a cell sample, not a sample from a patient).

[0071] In certain preferred embodiments, the detection method can use enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay, chemiluminescent immunoassay, radioimmunoassay, fluorescent immunoassay, immunochromatography, competition method, and the like.

[0072] In a fifteenth aspect, the present application provides a method for preventing and / or treating a CD93-mediated disease, disorder or condition, the method comprising: administering to a subject in need thereof a prophylactically and / or therapeutically effective amount of the antibody or antigen-binding fragment thereof of the first or second aspect, the ADC molecule of the third aspect, the bispecific or multispecific antibody molecule of the fourth aspect, the fusion protein of the fifth aspect, the polynucleotide of the sixth aspect, the nucleic acid construct of the seventh aspect, the recombinant vector of the eighth aspect, the transformed host cell of the ninth aspect, and / or the pharmaceutical composition of the tenth aspect.

[0073] Beneficial effects

[0074] The anti-CD93 antibody or antigen-binding fragment thereof provided by the present application can specifically bind to the CD93 molecule and has strong immunoreactivity thereto. By binding to the CD93 molecule, the function of the molecule can be effectively blocked, for example, the binding of the molecule to the ligand IGFBP7 and MMRN2 can be blocked, and the growth of tumors can be effectively inhibited. Further, the anti-CD93 humanized antibody provided by the present application not only has strong binding ability to tumor cells expressing CD93 and good concentration-dependent effect, but also can effectively block the binding of the ligand such as IGFBP7, inhibit HUVEC tube formation, and inhibit tumor growth, and thus can be used for the treatment of CD93-related diseases (e.g., tumors and vascular proliferative diseases). BRIEF DESCRIPTION OF DRAWINGS

[0075] One or more embodiments are illustrated by way of example in the figures of the accompanying drawings that form a part of this patent specification. These example illustrations do not limit the embodiments, and there can be many alterations to the example illustrations. Herein the word "exemplary" is used to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0076] Figure 1 The binding ability of the anti-CD93 antibodies of the present application to their antigens was determined by ELISA, as described in Example 4; wherein, panel A is the binding curve of the anti-CD93 antibodies of the present application to human CD93-his protein antigen at gradient dilution; panel B is the binding curve of the anti-CD93 antibodies of the present application to monkey CD93-his protein antigen at gradient dilution; panel C is the binding ability of the anti-CD93 antibodies of the present application to CD93-EGF-his protein antigen at two concentrations; panel D is the binding ability of the anti-CD93 antibodies of the present application to CD93-unrelated antigen DDR1-his, with positive antibody as control.

[0077] Figure 2 The concentration-dependent blocking of the binding of CD93 molecules to ligands by the anti-CD93 antibodies C132 and C164 of the present application was determined by ELISA, as described in Examples 5 and 6; wherein, panel A shows the blocking of the binding of CD93 molecules to ligand IGFBP-7 by the anti-CD93 antibodies C132 and C164, and panel B shows the blocking of the binding of CD93 molecules to ligand MMRN2 by the anti-CD93 antibodies C132 and C164.

[0078] Figure 3 The binding ability of the B16F10-CD93 stable cell line overexpressing CD93 and the SNU-1 cell line to IGFBP7 was determined by flow cytometry, as described in Example 7; wherein, panel A shows the positive rate of the binding of IGFBP7 by the B16F10-CD93 cell line, panel B shows the MFI value of the binding of IGFBP7 by the B16F10-CD93 cell line, panel C shows the positive rate of the binding of IGFBP7 by the SNU-1 cell line, and panel D shows the MFI value of the binding of IGFBP7 by the SNU-1 cell line.

[0079] Figure 4 The binding ability of the SNU-1 cell line to the anti-CD93 antibody C132 was determined by flow cytometry, as described in Example 8; wherein, panel A shows the positive rate of the binding of the antibody C132 by the SNU-1 cell line, and panel B shows the MFI value of the binding of the antibody C132 by the SNU-1 cell line.

[0080] Figure 5The results of blocking HUVEC tube formation by anti-CD93 antibodies C132 and C164 at different co-incubation times are shown, as described in Example 10.

[0081] Figure 6 The inhibitory effect of the humanized antibodies of the present application on HUVEC tube formation is shown, as described in Example 10; wherein, panel A shows the blocking results of the humanized antibodies of the present application on HUVEC tube formation when co-incubated with cells for 4h, panel B shows the blocking results of the humanized antibodies of the present application on HUVEC tube formation when co-incubated with cells for 8h, panel C shows the blocking results of the humanized antibodies of the present application on HUVEC tube formation when co-incubated with cells for 20h, and panel D shows the concentration-dependent blocking results of the humanized antibodies of the present application on HUVEC tube formation when co-incubated with cells for 4h.

[0082] Figure 7 The effect of the humanized antibodies of the present application on the gene transcription of HUVEC cells under different culture conditions is shown, as described in Example 11; wherein, panel A shows the HUVEC cells under passage state, and panel B shows the HUVEC cells under tube formation condition.

[0083] Figure 8 The concentration-dependent effect curves of the humanized antibodies of the present application huC164 binding to SNU-1 in terms of cell positive rate (A) and mean fluorescence intensity (B) by flow cytometry are shown, as described in Example 12.

[0084] Figure 9 The concentration-dependent effect curves of the humanized antibody huC132 of the present application blocking the binding of CD93-mFc to MMRN2 are shown.

[0085] Figure 10 The dissociation curves of the binding of the humanized antibodies of the present application to antigens detected by bio-layer interference technology (BLI) are shown, as described in Example 12; wherein, panel A is the result of humanized antibody HuC132-3, and panel B is the result of humanized antibody HuC164-2.

[0086] Figure 11 The detection results of Tm value and Tagg value of the humanized antibodies of the present application are shown, as described in Example 12; wherein, panel A shows the particle size distribution of the tested substances, and panel B shows the determination of BCM and SLS266 of the tested antibodies at 25-95 degrees Celsius, and the Tm and Tagg values calculated according to the formula embedded in the software.

[0087] Figure 12The inhibitory effect of the full mouse anti-CD93 antibody of the application on B16F10-CD93 tumorigenesis in C57BL / 6J mice is shown, as described in Example 13; wherein, panel A shows the results of mouse tumor volume detection, panel B shows the mouse weight change curve, and panel C shows the mouse survival curve.

[0088] Figure 13 The tumor inhibitory effect of the humanized anti-CD93 antibody of the application on the tumor transplantation model of hPBMC immune-reconstructed NPG mice is shown, as described in Example 13; wherein, panel A shows the results of mouse tumor volume detection, panel B shows the tumor volume change curve of the antibody administration group and the control group, panel C shows the mouse survival curve, panels D-H show the marker positive proportion curve in the blood of the mice, and panel I shows the immunohistochemical and immunofluorescence analysis of the tumor tissue of the mice. DETAILED DESCRIPTION

[0089] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0090] The practice of the present application will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0091] To facilitate the understanding of this application, certain key terms are specifically defined below. Unless otherwise defined herein, the key terms used herein have the meanings that are commonly understood by a person of ordinary skill in the art to which this application belongs.

[0092] The term "CD93" is also known as C1q R1, C1qR, C1qRP, and the like, which are used interchangeably, and includes variants, isoforms, species homologs of human CD93, and analogs having at least one common epitope with CD93. The complete CD93 sequence can be found at GenBank under accession number Q9NPY3.

[0093] In the present disclosure, the three-letter and one-letter codes for amino acids are used as described in J. Biol. Chem, 243, p3558 (1968).

[0094] In the present disclosure, the "antibody" refers to an immunoglobulin, which is a four polypeptide chain structure connected by inter-chain disulfide bonds, consisting of two identical heavy chains and two identical light chains. The amino acid composition and arrangement order of the constant region of immunoglobulin heavy chain are different, so its antigenicity is also different. Accordingly, immunoglobulin can be divided into five types, or called isotypes of immunoglobulin, namely IgM, IgD, IgG, IgA and IgE, and the corresponding heavy chains are μ chain, δ chain, γ chain, α chain and ε chain, respectively. The same type of Ig can be further divided into different subtypes according to the difference in amino acid composition of the hinge region and the number and position of heavy chain disulfide bonds, such as IgG can be divided into IgG1, IgG2, IgG3 and IgG4. The light chain is divided into κ chain or λ chain by the constant region. Each of the five types of Ig can have κ chain or λ chain.

[0095] In the present disclosure, the antibody light chain can further comprise a light chain constant region comprising human or murine κ, λ chain or a variant thereof.

[0096] In the present disclosure, the antibody heavy chain can further comprise a heavy chain constant region comprising human or murine IgG1, IgG2, IgG3, IgG4 or a variant thereof.

[0097] The sequence of about 110 amino acids near the N-terminal of the antibody heavy chain and light chain varies greatly, which is the variable region (Fv region); the remaining amino acid sequence near the C-terminal is relatively stable, which is the constant region. The variable region includes three hypervariable regions (HVR) and four relatively conserved framework regions (FR). The three hypervariable regions determine the specificity of the antibody, also known as the complementarity determining region (CDR). Each light chain variable region (LCVR or VL) and heavy chain variable region (HCVR or VH) is composed of three CDR regions and four FR regions, arranged in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 from the amino terminal to the carboxyl terminal. The three CDR regions of the light chain are LCDR1, LCDR2 and LCDR3; the three CDR regions of the heavy chain are HCDR1, HCDR2 and HCDR3.

[0098] In the present disclosure, the antibody includes murine antibody, chimeric antibody, humanized antibody and fully human antibody, preferably humanized antibody.

[0099] The term "murine antibody" in the present disclosure refers to a monoclonal antibody against human CD93 prepared according to the knowledge and skills in the art. When preparing, the test subject is injected with CD93 antigen, and then the hybridoma expressing the antibody with the desired sequence or functional characteristics is isolated. In a preferred embodiment of the present disclosure, the murine CD93 antibody or antigen-binding fragment thereof can further comprise a light chain constant region of murine κ, λ chain or a variant thereof, or further comprise a heavy chain constant region of murine IgG1, IgG2, IgG3 or a variant thereof.

[0100] The term "chimeric antibody" is an antibody in which the variable region of a murine antibody is fused with the constant region of a human antibody, which can reduce the immune response induced by the murine antibody. To establish a chimeric antibody, a hybridoma secreting a murine-specific monoclonal antibody is first established, and then the variable region gene is cloned from the murine hybridoma cell, and the constant region gene of a human antibody is cloned as needed. The murine variable region gene is linked to the human constant region gene to form a chimeric gene, which is inserted into an expression vector, and finally the chimeric antibody molecule is expressed in a eukaryotic system or a prokaryotic system. In a preferred embodiment of the present disclosure, the antibody light chain of the CD93 chimeric antibody further comprises a light chain constant region of a human kappa, lambda chain or a variant thereof. The antibody heavy chain of the CD93 chimeric antibody further comprises a heavy chain constant region of a human IgG1, IgG2, IgG3, IgG4 or a variant thereof, preferably a human IgG1, IgG2 or IgG4 heavy chain constant region, or an IgG1, IgG2 or IgG4 variant using amino acid mutations (such as L234A and / or L235A mutations, and / or S228P mutations).

[0101] The term "humanized antibody" is also referred to as CDR-grafted antibody, which refers to an antibody in which the CDR sequences of a murine antibody are grafted into the variable region framework of a human antibody, i.e. an antibody generated by grafting different types of human germline antibody framework sequences. The heterogeneity reaction induced by the chimeric antibody due to carrying a large amount of murine protein components can be overcome. Such framework sequences can be obtained from public DNA databases or published references including germline antibody gene sequences. The germline DNA sequences of human heavy and light chain variable region genes can be found in the "VBase" human germline sequence database (available on the Internet at www.mrccpe.com.ac.uk / vbase), and in Kabat, E. A. et al., 1991 Sequences of Proteins of Immunological Interest, 5th edition. To avoid the decrease in immunogenicity while causing a decrease in activity, the human antibody variable region framework sequence can be subjected to minimal reverse mutations or back mutations to maintain activity.

[0102] Transplantation of CDRs can result in a CD93 antibody or antigen-binding fragment thereof that has reduced affinity for the antigen due to framework residues that contact the antigen. Such interactions can be the result of somatic hypermutation. Thus, it can still be desirable to graft such donor framework amino acids into the framework of the humanized antibody. Amino acid residues from the non-human CD93 antibody or antigen-binding fragment thereof that are involved in antigen binding can be identified by inspection of murine monoclonal antibody variable region sequences and structures. Each residue in the CDR donor framework that differs from the germline can be considered relevant. If the closest germline cannot be determined, then the sequence can be compared to the subtype consensus sequence or to a consensus sequence of murine sequences with a high percentage of similarity. Rare framework residues are considered likely to be the result of somatic hypermutation and thus important in binding.

[0103] "Human antibody" (HuMAb), "humanized antibody", "fully human antibody", "fully human antibody" can be used interchangeably and can be an antibody derived from a human or an antibody obtained from a transgenic organism that has been "engineered" to produce specific human antibodies in response to antigenic challenge and can be produced by any method known in the art. In certain technologies, elements of human heavy and light chain loci are introduced into a cell strain of an organism derived from an embryonic stem cell line, the endogenous heavy and light chain loci of the cell lines having been targeted to disrupt the targeted endogenous heavy and light chain loci contained in the cell lines. The transgenic organism can synthesize human antibodies specific to human antigens and the organism can be used to produce human antibody-secreting hybridomas. Human antibodies can also be an antibody in which the heavy and light chains are encoded by nucleotide sequences derived from one or more human DNA sources. Fully human antibodies can also be constructed by gene or chromosome transfection methods and phage display techniques, or from in vitro activated B cells, all of which are known in the art.

[0104] The term "antigen-binding fragment" or "functional fragment" of an antibody refers to one or more fragments of an antibody that retain its ability to specifically bind to an antigen (e.g., CD93). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding fragment" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VH and VL domains of a single arm of an antibody; (v) a single domain or dAb fragment (Ward et al., (1989) Nature 341 :544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR) or (vii) a combination of two or more isolated CDRs, which can optionally be joined by a synthetic linker. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci USA 85:5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. Such antibody fragments are obtained using conventional techniques known to those with skill in the art, and are screened for utility in the same fashion as are intact antibodies. Antigen binding moieties can be produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact immunoglobulin. The antibody can be an antibody of different isotype, e.g., an IgG (e.g., IgGl, IgG2, IgG3, or IgG4 subtypes), IgAl, IgA2, IgD, IgE, or IgM antibody. In some embodiments, the antigen binding fragment of the present disclosure is a Fab, F(ab')2, Fab', single chain antibody (scFv), dimerized V regions (diabodies), disulfide stabilized V regions (dsFv), or CDR-containing peptides, etc.

[0105] Fab is an antibody fragment having a molecular weight of about 50,000 and having antigen binding activity, which is obtained by treating an IgG antibody molecule with a protease, papain, which cleaves the 224th amino acid residue of the H chain, in which about half of the N-terminal side of the H chain and the entire L chain are bound together by a disulfide bond. In some embodiments, the Fab of the present disclosure can be produced by treating a monoclonal antibody that specifically recognizes human CD93 and binds to the amino acid sequence or three-dimensional structure of the extracellular region of the present disclosure with papain. In addition, the Fab can be produced by inserting DNA encoding the Fab of the antibody into a prokaryotic expression vector or a eukaryotic expression vector and introducing the vector into a prokaryote or a eukaryote to express the Fab.

[0106] F(ab')2 is an antibody fragment having a molecular weight of about 100,000 and having antigen binding activity and containing two Fab regions connected at the hinge position, which is obtained by digesting the lower part of two disulfide bonds in the IgG hinge region with the enzyme pepsin. In some embodiments, the F(ab')2 of the present disclosure can be produced by treating a monoclonal antibody that specifically recognizes human CD93 and binds to the amino acid sequence or three-dimensional structure of the extracellular region of the present disclosure with pepsin. In addition, the F(ab')2 can be produced by linking the Fab' described below with a thioether bond or a disulfide bond.

[0107] Fab' is an antibody fragment having a molecular weight of about 50,000 and having antigen binding activity, which is obtained by cleaving the disulfide bond of the hinge region of the above-described F(ab')2. In addition, the Fab' can be produced by inserting DNA encoding the Fab' fragment of the antibody into a prokaryotic expression vector or a eukaryotic expression vector and introducing the vector into a prokaryote or a eukaryote to express the Fab'.

[0108] The term "single-chain antibody," "single-chain Fv" or "scFv" means a molecule comprising an antibody heavy chain variable domain (or region; VH) and an antibody light chain variable domain (or region; VL) connected by a linker. Such scFv molecules can have the general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH. Suitable prior art linkers consist of repeated GGGGS amino acid sequences or variants thereof, for example using 1-4 repeats of the variant (Holliger et al. (1993), Proc. Natl. Acad. Sci. USA 90:6444-6448). Other linkers useful in the present disclosure are described by Alfthan et al. (1995), Protein Eng. 8:725-731, Choi et al. (2001), Eur. J. Immunol. 31:94-106, Hu et al. (1996), Cancer Res. 56:3055-3061, Kipriyanov et al. (1999), J. Mol. Biol. 293:41-56, and Roovers et al. (2001), Cancer Immunol.

[0109] The scFv of the present disclosure can be produced by the following steps: obtaining cDNAs encoding VH and VL of the monoclonal antibody of the present disclosure that specifically recognizes human CD93 and binds to the amino acid sequence or the three-dimensional structure of the extracellular region, constructing DNA encoding the scFv, inserting the DNA into a prokaryotic expression vector or a eukaryotic expression vector, and then introducing the expression vector into a prokaryote or a eukaryote to express the scFv.

[0110] A bispecific antibody is an antibody fragment in which scFv or Fab is dimerized, and is an antibody fragment having bivalent antigen binding activity. In the bivalent antigen binding activity, two antigens can be the same or different. Bispecific antibodies and multispecific antibodies refer to antibodies that can bind two or more antigens or antigenic determinants simultaneously, wherein scFv or Fab fragments are included.

[0111] A dsFv is obtained by linking polypeptides in which one amino acid residue in each of VH and VL is replaced with a cysteine residue via a disulfide bond between the cysteine residues. The amino acid residue to be replaced with a cysteine residue can be selected based on the three-dimensional structure prediction of the antibody according to a known method (Protein Engineering, 7, 697 (1994)).

[0112] A peptide comprising CDR is constituted by including one or more regions of CDR of VH or VL. A peptide comprising multiple CDRs can be directly linked or linked via a suitable peptide linker.

[0113] The CDR-containing peptide of the present disclosure can be produced by the steps of constructing DNA encoding the CDRs of the VH and VL of the monoclonal antibody of the present disclosure that specifically recognizes human CD93 and binds to the amino acid sequence or the three-dimensional structure of the extracellular region, inserting the DNA into a prokaryotic expression vector or a eukaryotic expression vector, and then introducing the expression vector into a prokaryote or a eukaryote to express the peptide. The CDR-containing peptide can also be produced by a chemical synthesis method such as the Fmoc method or the tBoc method.

[0114] The terms "CDR," "complementarity determining region," "hypervariable region" refer to one of the six hypervariable regions within the variable domain of an antibody that primarily contribute to antigen binding. Generally, there are three CDRs in each heavy chain variable region (HCDR1, HCDR2, HCDR3) and three CDRs in each light chain variable region (LCDR1, LCDR2, LCDR3). The boundaries of the amino acid sequences of the CDRs can be determined using any of a variety of well-known schemes, including the "Kabat" numbering convention (see Kabat et al. (1991) "Sequences of Proteins of Immunological Interest," 5th Ed., Public Health Service, National Institutes of Health, Bethesda, MD), the "Chothia" numbering convention (see Al-Lazikani et al. (1997) JMB 273:927-948), and the ImMunoGenTics (IMGT) numbering convention (Lefranc M.P., Immunologist, 7, 132-136 (1999); Lefranc, M.P. et al., Dev. Comp. Immunol., 27, 55-77 (2003), and the like. For example, for the canonical format, following the Kabat convention, the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3); and in the light chain variable domain (VL) are numbered 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3). Following the Chothia convention, the CDR amino acids in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3); and in the VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3). By combining the CDR definitions of both Kabat and Chothia, the CDRs consist of amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in human VH and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in human VL. Following the IMGT convention, the CDR amino acid residues in the VH are numbered approximately 26-35 (CDR1), 51-57 (CDR2), and 93-102 (CDR3), and in the VL are numbered approximately 27-32 (CDR1), 50-52 (CDR2), and 89-97 (CDR3).Following the IMGT rules, the CDR regions of an antibody can be determined using the program IMGT / DomainGap Align.

[0115] The term antibody "framework region", "skeleton region" or "FR", "FR region" as used herein refers to a portion of a variable domain VL or VH that serves as a scaffold for the antigen binding loop (CDR) of the variable domain. Essentially, it is a variable domain without CDRs.

[0116] The term "epitope" or "antigenic determinant" refers to the site on an antigen to which an immunoglobulin or antibody specifically binds. An epitope typically comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive or non-contiguous amino acids in a unique spatial conformation. See, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, G.E. Morris, Ed. (1996).

[0117] The terms "specific binding," "selective binding," "selectively binds," and "specifically binds" refer to the binding of an antibody to a predetermined epitope on an antigen. Typically, the antibody binds with an affinity (KD) of less than about 10-8 M, such as less than about 10-9 M, 10-10 M, 10-11 M, or less.

[0118] The term "KD" or "Kd" refers to the dissociation equilibrium constant for a particular antibody-antigen interaction. Typically, the antibodies of the present disclosure dissociate at a constant constant of less than about 10 -7 M, for example, less than about 10-8 M or 10-9 M The dissociation equilibrium constant (KD) of α-glucanase binds to CD93, e.g., as determined using surface plasmon resonance (SPR) technology in a BIACORE instrument.

[0119] When the term "compete" is used in the context of antigen binding proteins (e.g., neutralizing antigen binding proteins or neutralizing antibodies) that compete for the same epitope, it is meant that the antigen binding proteins compete with each other as determined by an assay in which the antigen binding protein (e.g., antibody or immunologically functional fragment thereof) to be tested prevents or inhibits (e.g., reduces) the specific binding of a reference antigen binding protein (e.g., ligand or reference antibody) to a common antigen (e.g., a CD93 antigen or fragment thereof). Numerous types of competitive binding assays can be used to determine whether one antigen binding protein competes with another, for example: solid phase direct or indirect radioimmunoassay (RIA), solid phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay (see, e.g., Stahli et al., 1983, Methods in Enzymology 9:242-253); solid phase direct biotin-avidin EIA (see, e.g., Kirkland et al., 1986, J. Immunol. 137:3614-3619), solid phase direct label assay, solid phase direct label sandwich assay (see, e.g., Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press); solid phase direct label RIA with 1-125 label (see, e.g., Morel et al., 1988, Molec. Immunol. 25:7-15); solid phase direct biotin-avidin EIA (see, e.g., Cheung, et al., 1990, Virology 176:546-552); and direct label RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82). Typically the assay involves the use of purified antigen bound to a solid surface or cells that bears either the unlabeled test antigen binding protein and the labeled reference antigen binding protein. Competitive inhibition is measured by measuring the amount of label bound to the solid surface or cells in the presence of the test antigen binding protein. Typically the test antigen binding protein is present in excess. Antigen binding proteins identified by competitive assays (competing antigen binding proteins) include: antigen binding proteins that bind to the same epitope as the reference antigen binding protein; and antigen binding proteins that bind to an adjacent epitope in sufficient proximity to the binding epitope of the reference antigen binding protein that the two epitopes sterically hinder each other from binding. Additional details regarding methods for determining competitive binding are provided in the Examples herein. Typically when competing antigen binding proteins are present in excess, they will inhibit (e.g., reduce) specific binding of the reference antigen binding protein to the common antigen by at least 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, or 75% or more.In some cases, binding is inhibited by at least 80-85%, 85-90%, 90-95%, 95-97%, or 97% or more.

[0120] The term "nucleic acid molecule" as used herein refers to DNA molecules and RNA molecules. A nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA. Nucleic acid molecules are "operably linked" when they are functionally connected to another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence.

[0121] Amino acid sequence "identity" means the percentage of amino acid residues in a first sequence that have an equivalent residue in a second sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment can be achieved by any means within the skill of the art, such as using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0122] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. In one embodiment, the vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. In another embodiment, the vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. The vectors disclosed herein can be capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors) or can be capable of integration into the genome of a host cell upon introduction into the host cell, and / or be capable of directing the expression of genes encoded therein.

[0123] Methods for producing and purifying antibodies and antigen-binding fragments are well known in the art, such as in Current Protocols in Immunology, John Wiley & Sons, Inc., NY, Sections 5-8 and 15. For example, a mouse can be immunized with human CD93 or a fragment thereof, the resulting antibodies can be renatured, purified, and can be subjected to amino acid sequencing using conventional methods. Antigen-binding fragments can likewise be prepared using conventional methods. The antibodies or antigen-binding fragments described herein are genetically engineered to have one or more human FR regions in the CDR regions of a non-human source. Human FR germline sequences can be obtained from the website of ImMunoGeneTics (IMGT) at https: / / www.imgt.org / by aligning the IMGT human antibody variable region germline genes database and MOE software.

[0124] The term "host cell" refers to a cell into which an expression vector has been introduced. Host cells can include bacterial, microbial, plant, or animal cells. Bacteria that are readily transformed include members of the enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus; and Haemophilus influenzae. Suitable microbial hosts include Saccharomyces cerevisiae and Pichia pastoris. Suitable animal host cell lines include CHO (Chinese hamster ovary cell line) and NSO cells.

[0125] The engineered antibodies or antigen binding fragments of the present disclosure can be produced and purified using conventional methods. For example, cDNA sequences encoding the heavy and light chains can be cloned and recombined into a GS expression vector. The recombinant immunoglobulin expression vector can be stably transfected into CHO cells. As a more preferred prior art, mammalian expression systems result in glycosylation of the antibody, particularly at the highly conserved N-terminal site in the Fc region. Stable clones are obtained by expression of antibodies that specifically bind to human CD93. Positive clones are expanded in serum-free media in a bioreactor to produce the antibody. The culture fluid in which the antibody is secreted can be purified using conventional techniques. For example, purification can be performed using an A or G Sepharose FF column with a modified buffer. Non-specifically bound components are washed away. The bound antibody is eluted using a pH gradient method, and the antibody fragments are detected using SDS-PAGE and collected. The antibody can be filter concentrated using conventional methods. Soluble aggregates and multimers can also be removed using conventional methods, such as molecular sieving, ion exchange. The resulting product is immediately frozen, such as at -70°C, or lyophilized.

[0126] "Administering," "administered," or "treatment" when applied to an animal, human, experimental subject, cell, tissue, organ or biological fluid means the contact of an exogenous drug, therapeutic agent, diagnostic agent or composition with the animal, human, subject, cell, tissue, organ or biological fluid. "Administering," "administered," or "treatment" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research and experimental methods. Treatment of a cell includes contact of the agent with the cell, as well as contact of the agent with a fluid that is in contact with the cell. "Administering," "administered," or "treatment" also means treatment by an agent, diagnostic, binding composition or by another cell in vitro and ex vivo, for example. "Treatment" when applied to a human, veterinary or research subject means therapeutic treatment, prophylactic or preventative measures, research and diagnostic applications.

[0127] "Treatment" means the administration of an internal or external therapeutic agent, such as a composition comprising any of the binding compounds of the disclosure, to a patient having one or more symptoms of a disease, where the therapeutic agent is known to have a therapeutic effect on those symptoms. Typically, the therapeutic agent is administered in an amount effective to alleviate one or more symptoms of the disease in the treated patient or population to induce regression of such symptoms or to inhibit the progression of such symptoms to any clinically measurable extent. The amount of therapeutic agent effective to alleviate any particular symptom of a disease (also referred to as a "therapeutically effective amount") can vary depending on factors such as the disease state, age, and weight of the patient, and the ability of the drug to elicit a desired effect in the patient. Whether a disease symptom has been alleviated can be assessed by any clinical test method used by a physician or other professional health care provider to assess the severity or progression of the symptom. While embodiments of the disclosure (e.g., a method of treatment or article of manufacture) can not be effective in alleviating each target disease symptom, it is determined that the target disease symptom should be alleviated in a statistically significant number of patients according to any statistical test method known in the art, such as the Student's t-test, the chi-square test, the U-test according to Mann and Whitney, the Kruskal-Wallis test (H-test), the Jonckheere-Terpstra test, and the Wilcoxon test.

[0128] "Conservatively modified" or "conservatively substituted" amino acid substitutions refer to those amino acid substitutions that do not significantly alter the properties of the protein, such as charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation and rigidity, etc., such that changes can be frequently made without altering the biological activity of the protein. As is known to those skilled in the art, in general, single amino acid substitutions in non-essential regions of a polypeptide do not alter biological activity (see, e.g., Watson et al. (1987) Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th ed.)). In addition, substitutions of amino acids with similar properties are less likely to disrupt biological activity. Exemplary conservative substitutions are set forth in the table "Exemplary Amino Acid Conservative Substitutions" below.

[0129] Table 1. Exemplary Amino Acid Conservative Substitutions

[0130] Original residue Conservative substitution Ala (A) Gly; Ser Arg (R) Lys; His Asn (N) Gln; His; Asp ASP (D) Glu; Asn Cys (C) Ser; Ala; Val Gln (Q) Asn; Glu Glu (E) Asp; Gln Gly (G) Ala His (H) Asn; Gln Ile (I) Leu; Val Leu (L) Ile; Val Lys (K) Arg; His Met (M) Leu; Ile; Tyr Phe (F) Try; Met; Leu Pro (P) Ala Ser (S) Thr Thr (T) Ser Trp (W) Tyr; Phe Tyr (Y) Trp; Phe Val (V) Ile; Leu

[0131] An "effective amount" includes an amount sufficient to effect an improvement in the condition or disorder being treated or prevented, or to allow or facilitate diagnosis. For prophylactic use, beneficial or desired results include eliminating or reducing the risk, lessening the severity, or delaying the onset of a disorder, including biochemical, histological and / or behavioral symptoms of the disorder, its complications and intermediate pathological phenotypes presenting during development of the disorder. For therapeutic applications, beneficial or desired results include clinical results, such as reducing the incidence of various disorders associated with the target antigens of the present disclosure, or ameliorating one or more symptoms of the disorder, reducing the dosage of other medications required to treat the disorder, enhancing the effect of another medication, and / or delaying the progression of the disorder in a patient. The effective amount for a given patient or veterinary subject can vary according to factors such as the disorder being treated, the overall health status of the patient, the method route and dosage of administration and the severity of side effects. An effective amount can be the maximum dose or administration regimen that avoids significant side effects or toxic effects.

[0132] "Exogenous" refers to a substance produced outside of a cell, organism or human body, as the case can be. "Endogenous" refers to a substance produced inside of a cell, organism or human body, as the case can be.

[0133] "Homology" refers to the sequence similarity between two polynucleotide sequences or between two polypeptides. When a position in both of the compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions in the comparison times 100. For example, if 6 of 10 positions in two sequences are matched or homologous, then the two sequences are 60% homologous. If 95 of 100 positions in two sequences are matched or homologous, then the two sequences are 95% homologous. Generally, when two sequences are compared, the comparison is performed over the length of the shorter sequence. For example, the comparison can be performed by the BLAST algorithm, where the parameters of the algorithm are selected to give the largest match between the two sequences over the entire length of the respective reference sequence. The following references are directed to the BLAST algorithm, which is frequently used for sequence analysis: BLAST ALGORITHMS: Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410; Gish, W. et al. (1993) Nature Genet. 3:266-272; Madden, T. L. et al. (1996) Meth. Enzymol. 266:131-141; Altschul, S. F. et al. (1997) Nucleic Acids Res. 25:3389-3402; Zhang, J. et al. (1997) Genome Res. 7:649-656. Other routine BLAST algorithms, such as those provided by NCBI BLAST, are also well known to those skilled in the art.

[0134] The terms "cell," "cell line," and "cell culture" are used interchangeably and all such designations include progeny. Thus, the words "transformant" and "transformed cell" include the primary subject cell and cultures derived from it, without regard for the number of transfers. It is also understood that all progeny can not necessarily be identical to the parental cell since there can be, as a result of mutation, some genetic alteration in the progeny. It is

[0135] The term "polymerase chain reaction" or "PCR" as used herein refers to a procedure or technique in which a minute quantity of a specific portion of nucleic acid, RNA and / or DNA is amplified as described in, for example, U.S. Patent No. 4,683,195. Generally, sequence information from the ends of the region of interest or beyond is required so that oligonucleotide primers can be designed; these primers are identical or similar in sequence to the corresponding strands of the template to be amplified. The 5' terminal nucleotides of the two primers can be identical to the ends of the material to be amplified. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, and the like. See generally Mullis et al. (1987) Cold Spring Harbor Symp. Quanl. Biol. 51 :263; Erlich, ed. (1989) PCR TECHNOLOGY (Stockton Press, N.Y.). PCR as used herein is considered an example of, but not the only example of, a nucleic acid polymerase reaction method for amplifying a nucleic acid test sample, which method includes the use of known nucleic acids as primers and a nucleic acid polymerase to amplify or generate a specific portion of a nucleic acid.

[0136] The term "optionally" means that the subsequently described event or circumstance can or can not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0137] The term "pharmaceutical composition" means a mixture of one or more of the compounds described herein or physiologically / pharmaceutically acceptable salts or prodrugs thereof with other chemical components, such as physiologically / pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of the active ingredient to a subject and to enhance the effectiveness of the active ingredient in elicit a biological activity.

[0138] The term "pharmaceutically acceptable carrier" refers to any inactive substance suitable for use in formulations for delivering an antibody or antigen-binding fragment. The carrier can be an anti-adherent, a binder, a coating, a disintegrant, a filler or diluent, a preservative (such as an antioxidant, an antibacterial or an antifungal agent), a sweetener, an absorption delaying agent, a wetting agent, an emulsifying agent, a buffer, and the like. Examples of suitable pharmaceutically acceptable carriers include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, and the like), dextrose, vegetable oils (e.g., olive oil), saline, buffers, buffered saline, and isotonic agents such as sugars, polyols, sorbitol, and sodium chloride.

[0139] Further, the present disclosure includes a medicament for treating a disease associated with CD93-positive cells, the medicament comprising the anti-CD93 antibody or antigen-binding fragment thereof of the present disclosure as an active ingredient.

[0140] There is no limitation on the disease associated with CD93, as long as it is a disease associated with CD93, for example, a therapeutic response induced using the molecules of the present disclosure can be by binding to human CD93, then blocking the binding of CD93 to its ligand MMRN2 or CD93, or killing tumor cells overexpressing CD93, or increasing drug or immune effector molecules, immune cell infiltration into tumor tissue. Thus, the molecules of the present disclosure are very useful for those who have tumors or cancers, preferably melanoma, colon cancer, breast cancer, lung cancer, gastric cancer, intestinal cancer, kidney cancer, non-small cell lung cancer, bladder cancer, etc., when in preparations and formulations suitable for therapeutic applications.

[0141] In addition, the present disclosure relates to a method for immunoassay or assay of CD93, a reagent for immunoassay or assay of CD93, a method for immunoassay or assay of cells expressing CD93, and a diagnostic agent for diagnosing a disease associated with CD93-positive cells, which comprises a monoclonal antibody or an antibody fragment of the present disclosure that specifically recognizes human CD93 and binds to the amino acid sequence or three-dimensional structure of the extracellular region as an active ingredient.

[0142] In the present disclosure, the method for detecting or assaying the amount of CD93 can be any known method. For example, it includes an immunoassay or assay method.

[0143] The immunoassay or assay method is a method for detecting or assaying the amount of an antibody or the amount of an antigen using a labeled antigen or antibody. Examples of the immunoassay or assay method include a radioisotope-labeled immunobead method (RIA), an enzyme immunoassay (EIA or ELISA), a fluorescent immunoassay (FIA), a luminescent immunoassay, a Western blotting method, a physical-chemical method, etc.

[0144] The above-mentioned disease associated with CD93-positive cells can be diagnosed by detecting or assaying cells expressing CD93 with the monoclonal antibody or antibody fragment of the present disclosure.

[0145] To detect cells expressing a polypeptide, a known immunoassay method can be used, and preferably an immunoprecipitation method, a fluorescent cell staining method, an immunohistological staining method, etc. can be used. In addition, a fluorescent antibody staining method using FMAT8100HTS system (Applied Biosystem) or the like can be used.

[0146] In the present disclosure, there is no particular limitation on the living sample for detecting or assaying CD93, as long as it has the potential to contain cells expressing CD93, such as tissue cells, blood, plasma, serum, pancreatic juice, urine, feces, tissue fluid, or culture fluid.

[0147] According to the desired diagnostic method, the diagnostic agent containing the monoclonal antibody or antibody fragment thereof of the present disclosure can further contain a reagent for performing an antigen-antibody reaction or a reagent for detecting a reaction. The reagent for performing an antigen-antibody reaction includes a buffer, a salt, and the like. The reagent for detection includes a reagent generally used in an immunoassay or assay method, such as a labeled second antibody recognizing the monoclonal antibody, the antibody fragment thereof, or a conjugate thereof, and a substrate corresponding to the label, and the like.

[0148] The preferred embodiments of the present application will be described in detail below with reference to Examples. It is to be understood that the following Examples are given by way of illustration only and nothing therein should be taken as a restriction on the overall scope of the application. Various modifications and adaptations to the embodiments of the present application will be apparent to those skilled in the art without departing from the spirit and scope of the application.

[0149] The experimental methods not specified in the embodiments of the present disclosure are generally performed according to the conventional conditions, such as the Antibody Technology Laboratory Manual, Cold Spring Harbor, Molecular Cloning Manual, or the conditions recommended by the manufacturer of the raw materials or commercial products. The reagents not specified in the source are the conventional reagents purchased on the market.

[0150] In this paper, the antibody is named in the form of SF02-C+number, and sometimes it is abbreviated as C+number, which represents the same combination of light and heavy chain sequences. The antibody after humanization is named by adding huC or HC to the prefix and -number to the suffix to distinguish it. For the CD93 antibody used in the examples, unless otherwise stated, the form of VHand VLgrafted onto the HuIgG1 skeleton is used.

[0151] In this paper, the obtained quantitative data are plotted and statistically analyzed using the GraphPad Prism software after processing the obtained data in Microsoft Excel software. In the data graph obtained from in vivo experiments, the data used for plotting are the mean value plus the sample standard deviation, and the statistical method between groups at two or more consecutive time points is the two-way ANOVA. A p-value less than 0.05 is determined to be statistically different, a p-value less than 0.01 is determined to be significantly statistically different, a p-value less than 0.001 is determined to be extremely significantly statistically different, and a p-value greater than 0.05 is considered to be no difference. The comparison of survival curve data uses Log-rank (Mantel-cox) test.

[0152] Example 1: Sources of main proteins used and control antibodies

[0153] In the embodiments herein, the main proteins for animal immunization and detection were purchased from Sino Biological, and the main proteins and their catalog numbers are shown in Table 2. The amino acid positions of the human CD93 protein sequence refer to the sequence of the accession number mentioned above, the amino acid positions of human IGFBP7 and MMRN2 refer to the sequences of the protein database accession numbers Q16270 and Q9H8L6 respectively, the amino acid positions of the mouse CD93 protein sequence refer to the sequence of the protein database accession number NP_034870.1, the amino acid positions of the monkey CD93 protein sequence refer to the sequence of the protein database accession number F7C9U4, and the amino acid positions of the irrelevant protein DDR1 refer to the sequence of the protein database accession number Q08345.

[0154] Table 2. Commercially available and structural information of main proteins

[0155]

[0156] In addition to the commercial antibodies (for example, Isotype controls shown in Table 2), the VH and VL sequences of the 7F3 antibody (which is a fully human antibody) were derived from the patent PCT / US2021 / 052446, and the light and heavy chain sequences of bevacizumab (hereinafter also referred to as "Avastin") were obtained from Drugbank (shown as SEQ ID NO: 29 and 30, respectively). The antibody sequences were gene synthesized by codon reverse translation, constructed into the IgG1 form of the required antibody, and expressed and purified by protein A according to the conventional method. The protein concentration was determined by ultraviolet spectrophotometry (nanoDrop), and the protein size was detected by SDS-PAGE, and ELISA binding or flow detection was used to determine that the target protein met the requirements for further experiments.

[0157] The sequence of bevacizumab is as follows, and is named avastin in this study.

[0158] "Bevacizumab light chain"

[0159] DIQMTQSPSSLSASVGDRVTITCSASQDISNYLNWYQQKPGKAPKVLIYFTSSLHSGVPSRFSGSGSGTDFTLTISSLQPEDFATYYCQQYSTVPWTFGQGTKVEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC (SEQ ID NO: 29);

[0160] "Bevacizumab heavy chain"

[0161] EVQLVESGGGLVQPGGSLRLSCAASGYTFTNYGMNWVRQAPGKGLEWVGWINTYTGEPTYAADFKRRFTFSLDTSKSTAYLQMNSLRAEDTAVYYCAKYPHYYGSSHWYFDVWGQGTLVTVSSASTKGPSVFPLAPSSKSTSGGTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTQTYICNVNHKPSNTKVDKKVEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK (SEQ ID NO: 30).

[0162] Example 2: Mouse immunization, construction of immunized phage library, and panning, screening and sequence identification of antibodies

[0163] The recombinant CD93-hFc protein in Table 2 of Example 1 was mixed with Freund's adjuvant to form an oil emulsion, and 6-8 week old Balb / C mice (purchased from Vantian Li Hua) were immunized with the oil emulsion, the immunization scheme was as follows: 100 ug per mouse, multi-point immunization, every 2 weeks for immunization, a total of 4 times, when the serum titer was greater than 500,000, the mice were euthanized, the fresh mouse spleen was taken, the spleen RNA was extracted, the first strand of cDNA was synthesized by reverse transcription, the VH and VK fragments were amplified by specific primers of mouse VH and VK, respectively, and the VH and VK were spliced into ScFv form by a universal linker after gel recovery, and then inserted into the phage display plasmid pcomb3X after enzyme digestion, and the phage display mouse antibody scFv library was obtained by electroporation of TG1 engineering bacteria. After panning and screening with coated antigen, two monoclonal antibodies (i.e., SF02-132 and SF02-164, also referred to as C132 and C164) with the best binding capacity to the antigen were obtained, and the phages were purified and sequenced, and the DNA sequences of the VH and VL of the two monoclonal antibodies were obtained (as shown in Table 3).

[0164] Table 3. Obtained VH and VL nucleotide sequences

[0165]

[0166]

[0167] Further, the VH and VL amino acid sequences of the two monoclonal antibodies were obtained (see Table 4), and the CDR sequences thereof were identified (see Table 5).

[0168] Table 4. Antibody VH and VL sequences

[0169]

[0170] Table 5. Antibody CDR sequences

[0171]

[0172]

[0173] Example 3: Construction, expression and purification of complete antibodies

[0174] The VL and VH sequences in Table 2 above were respectively amplified from the phage vector, and the 5' end of the amplification primer had a 12 bp homologous arm, through which the amplified VL and VH were respectively constructed into the eukaryotic expression vectors pTT5-L (a recombinant expression plasmid containing a human kappa constant region) and pTT5-H1 (a recombinant expression plasmid containing a human IgG1 heavy chain constant region), or into pTT5-mL (a recombinant expression plasmid containing a murine kappa constant region) and pTT5-M1 (a recombinant expression plasmid containing a murine IgG1 heavy chain constant region). The plasmids were extracted, and the corresponding light and heavy chain plasmids were co-transfected into 293F cells. After the transfected cells were cultured at 37°C, 5% CO2, 120 rpm for 5 days, the culture solution was collected and purified by a Protein A column. The Protein A purification procedure was as follows: equilibrate the column with PBS (50 mM PB, 0.15 M NaCl) buffer, pH 7.2, at a flow rate of 150 cm / h, 6 times the column volume; adjust the 293F cell culture supernatant to pH 7.2, at a flow rate of 150 cm / h. Equilibrate again with the equilibration buffer: flow rate 150 cm / h, 6 times the column volume. Then elute with 50 mM citric acid-sodium citrate, pH 3.5, in one step, 8 times the column volume, and collect the elution peak. Through the above procedure, the purified, murine and human-murine chimeric forms of the two antibodies above were obtained.

[0175] Example 4: Determination of the antigen binding capacity of the antibodies by ELISA

[0176] CD93-EGF2-his or CD93-his antigens (as shown in Table 2 of Example 1) were coated in 96-well plates, specifically, the antigens were diluted to 1 ug / ml with PBS, 100 ul / well was added to the 96-well plates, and incubated overnight at 4 degrees. The plates were washed 3 times in a plate washer with TBST. 5% milk was blocked at 37 degrees for 1-2 hours, and the plates were washed 3 times in a plate washer with TBST. The antibody samples to be tested (including human-mouse chimeric antibodies C132 and C164 obtained in Example 3 and control antibodies, in which Isotype antibody was used as a negative control and 7F3 antibody was used as a positive control) were diluted to 10 ug / ml, 150 ul was added to the first row of wells, diluted by 3 times, incubated at 37 degrees for 1 hour, and washed 6 times with TBST in a plate washer. Then, according to the instructions for use of the antibody, the anti-human FC-AP secondary antibody (Southern biotech, 9040-04) was diluted by 1:2500, mixed and added to each well at 100 ul, incubated at 37 degrees for 1 hour, and washed 6 times with TBST in a plate washer. 50 ul / w of pNPP was added, incubated at 37 degrees for 10 minutes, and the reaction was terminated with 3M NaOH. The OD410 was read. The concentration-dependent binding curve of the antibodies of the present application to the antigen is shown in Figure 1 A. Since the homology of human and mouse CD93 molecules is low, the antibody has no cross-binding ability with mouse CD93; it has cross-binding ability with monkey rhesus-CD93-mFc (Table 2) Figure 1 B). At the same time, the ability of the antibody to bind to the truncated expressed CD93 was detected, and it was found that the antibody binds to CD93-EGF2-his (Table 2), indicating that our antibody binds to the EGF-like region of CD93 (see Figure 1 C). At the same time, in order to detect the specificity of the obtained antibody for CD93 binding, we coated the irrelevant antigen DDR1-his (Table 2) antigen, and incubated the antibody with the antigen at 30 ug / mL and 3 ug / mL, respectively, and used an anti-human secondary antibody to detect the signal of the bound antibody, and the results are shown in Figure 1 D (wherein the PC group is a DDR1 positive antibody group, and the antibody is purchased from Yiqiao Shenzhou, with the item number 10730-MM05T), Figure 1 D shows that the two human-mouse chimeric antibodies C132 and C164 of the present application have no binding ability to non-CD93 antigens.

[0177] The above results show that the human-mouse chimeric antibodies C132 and C164 of the present application both have the ability to specifically bind to CD93.

[0178] Example 5: ELISA method for detecting the ability of the antibody of the present application to block the binding of CD93 to IGFBP7

[0179] In this embodiment, whether the antibodies C132 and C164 of the application can block the binding of CD93 to IGFBP7 is detected by ELISA.

[0180] First, 100ul 1ug / mL IGFBP7-mFc (as shown in Table 2 of Example 1) is coated on an ELISA plate, 4°C overnight, and blocked. CD93-his-Biotin (Table 2) is mixed with different concentrations of the two human-murine chimeric antibodies constructed in Example 3 and added to the ELISA plate, with the 7F3 group set as a positive control and the Isotype group as a negative control. After incubation at 37°C for 1h, PBST is used for washing, SA-HRP (horseradish peroxidase-labeled streptavidin, Genscript, M00091) is added for detection, and after incubation at 37°C for 1h, PBST is used for washing, TMB is used for color development, 2M sulfuric acid is used to terminate the color development reaction, and the microplate reader is read at 450nm. The blocking rate is calculated according to the formula (1-OD 实验组 / OD 对照组 )*100%, and the higher the blocking rate, the better the blocking effect. The results are shown in Figure 2 A. Figure 2 A shows the concentration-dependent blocking effect of the C132 and C164 antibodies on the binding of CD93 to IGFBP7, which indicates that the human-murine chimeric antibodies C132 and C164 of the application can effectively block the binding of CD93 to its ligand IGFBP7.

[0181] Example 6: ELISA method for detecting the ability of the antibodies of the application to block the binding of CD93 to MMRN2

[0182] In this embodiment, whether the antibodies C132 and C164 of the application can block the binding of CD93 to MMRN2 is detected by ELISA.

[0183] First, 100ul 1ug / mL his-SUMO-MMRN2 (Table 2) is coated on an ELISA plate, 4°C overnight, and blocked. 1ug / mL CD93-his-Biotin (Table 2) is mixed with different concentrations of the two human-murine chimeric antibodies constructed in Example 3 and added to the ELISA plate, with the 7F3-hIgG1 group set as a positive control and the Isotype group as a negative control. After incubation at 37°C for 1h, PBST is used for washing, SA-HRP (horseradish peroxidase-labeled streptavidin) is added for detection, and after incubation at 37°C for 1h, PBST is used for washing, TMB is used for color development, 2M sulfuric acid is used to terminate the color development reaction, and the microplate reader is read at 450nm. The blocking rate is calculated according to the formula (1-OD 实验组 / OD 对照组 )*100%, and the higher the blocking rate, the better the blocking effect. The results are shown in Figure 2B. Figure 2 BResults show the concentration-dependent blocking effect of C132 and C164 antibodies on the binding of CD93 and MMRN2, which shows that the human-mouse chimeric antibodies C132 and C164 of the application can effectively block the binding of CD93 and its ligand MMRN2.

[0184] Example 7: Construction of CD93 overexpression cell line

[0185] In this embodiment, a transposon system is used to construct a stable cell line pool, and the construction work is commissioned to Beijing Renshengxinsheng Biological Technology Co., Ltd. Briefly, first, new enzyme cutting sites AsisI / claI are added to both ends of the human CD93 expression sequence by PCR, and then the sequence is connected into a pre-made CMV-PGK-Puro double expression plasmid framework, so that the CD93 sequence is under the regulation of the PGK promoter, and the donor plasmid is identified by Junction PCR. The Sleeping Beauty transposase plasmid and the successfully constructed CD93 transposition donor plasmid are introduced into B16F10 (mouse melanoma cells) cells by ECM830 cell electroporator. After the end of the electroporation, the cells are inoculated into 6-well culture dishes at a certain dilution ratio, and the complete culture medium containing 1.5 μg / mL puromycin is added in a 37°C incubator. After the control blank plasmid group cells die, the transfected plasmid group is continuously cultured, and after the formation of clustered clones, subcloning, subculture, and selection of 4-5 days after growth and 70% confluence, part of the cells are collected to extract DNA, and the gene integration of the mixed cell pool is identified by PCR. The constructed cells are subcultured, and the cell pool is analyzed by flow cytometry to analyze the ability of the cells to bind IGFBP7-hFc. Isotype antibody is used as a negative control, and untransfected B16F10 cell line is used as a negative control. FITC-488 labeled anti-human antibody (Southern biotech, 2045-02) is used as a secondary antibody, and BD Accuri C6 Plus flow cytometer is used for analysis.

[0186] Results show that the ability of the above constructed B16F10-CD93 cell line to bind IGFBP-7 increases with the increase of the concentration of the protein, and the positive rate of the cells is higher than 90% when the concentration of the protein is 10 μg / mL. Figure 3 A) and MFI value ( Figure 3B) aspect, while no binding was detected for B16F10 control cells, and no binding was detected for Isotype control antibody on both cell lines. The binding ability of CD93 high expressing cell line SNU-1 (human gastric cancer cell) to IGFBP-7-hFc (Table 2) was also tested, and the results showed that IGFBP-7 could also bind to SNU-1 cells, and showed a concentration dependent effect in terms of cell positivity rate and MFI value (see Figure 3 C and D), while no binding was detected for Isotype control antibody. The above results showed that we successfully constructed CD93 overexpressing cell lines, and the CD93 expressed on cell membrane could bind to ligand IGFBP7.

[0187] Example 8: Flow cytometry to test the binding ability of antibodies to cells

[0188] The cell lines B16F10-CD93, B16F10 cells (without CD93 expression) or test cell lines (Table 5) stably transfected with full-length human CD93 expression vector were plated, and when the cells grew to 80% to 90% coverage, the cells were digested with citrate solution at 37°C for about 5 to 10 min. The cells were resuspended and counted with PBS, centrifuged at 900g at 4°C for 5 min, resuspended with a solution containing BSA, and the concentration was 5*10^6 cells / ml. 200 ng of human-mouse chimeric antibody C164 or C132 obtained in Example 3 was added to 100 ul of 5*10 5 The cells were incubated at room temperature for 30 min, and Isotype antibody group was set as negative control. The cells were washed 3 times with 1% BSA 10 mM PBS, resuspended with 100 ul of FITC secondary antibody diluted 200 times with 1% BSA 10 mM PBS, and incubated at 4°C for 30 min. The cells were washed 3 times with 1% BSA 10 mM PBS, resuspended, and detected on the machine.

[0189] Human-mouse chimeric antibodies C164 and C132 bind to CD93 overexpressing cell line B16F10-CD93 or CD93 + Tumor cell lines, such as U937 (human histiocytic lymphoma cells), SNU-1, showed certain binding ability, showing a high cell positivity rate, while B16F10 or CD93 - Cell lines such as RPMI-8826 and Hela showed a very low positivity rate. The cell positivity rate results of each antibody are shown in Table 6.

[0190] Table 6. Antibody positivity rate (%)

[0191]

[0192] Further, the antibody C132 was diluted in gradient concentration to test its binding ability to the tumor cell line SNU-1, and the flow detection results are shown in Figure 4 It can be seen that the cell positive rate Figure 4 The cell positive rate Figure 4 A) and the MFI value Figure 4 B) both showed a concentration-dependent effect of the antibody, while the isotype control antibody was negative.

[0193] The above results show that the two antibodies of the present application can maintain high binding ability to CD93 highly expressed cell lines of different tumors, and do not show binding ability to low expression cell lines. At the same time, these antibodies can specifically bind to CD93 highly expressed cell lines, and have the potential to be applied to the treatment of tumors.

[0194] Example 9: Obtaining humanized antibodies of the present application

[0195] When murine antibodies are used for the treatment of human diseases, the introduction of xenogenic immunogenicity will reduce the safety of the drug. In order to adapt the drug molecules to the development of human drugs, the murine antibodies C132 and C164 screened above were designed and expressed for humanization.

[0196] Specifically, the sequences of the heavy chain and light chain variable regions (VH and VL) were compared with the human antibody sequences in the protein database (PDB) to establish a homology model. The framework region of each of the four humanized VH sequences of C132 and C164 adopts the framework region of the IGHV1-69-2*01 genotype, the humanized VL sequence framework of huC132K1 adopts the IGKV1-9*03 framework, and the humanized VL sequence framework of huC132K2, HuC164-K1 and HuC164-K2 adopts the IGKV1-39*01 framework. According to the Kabat number scheme, the CDRs in the heavy and light chains of the mouse mAb were transplanted into the human framework region to obtain. At the same time, in order to maximize the binding activity of the antibody, individual hot spots in the human framework were subjected to back mutation, and the VH and VL sequences of the ScFv of the same source were mutated and recombined for re-naming, as shown in Table 7, and the humanized heavy chain and light chain variable region sequences are shown in Table 8.

[0197] Table 7. Humanized antibodies and their light and heavy chain compositions

[0198]

[0199]

[0200] The antibody light and heavy chain sequences after humanization are shown in Table 8 below.

[0201] Table 8. Humanized variable region sequences

[0202]

[0203]

[0204] The humanized VH and VL were fused with the constant region of human IgG1 heavy chain and k light chain respectively to construct antibody light and heavy chain expression vectors. After plasmid extraction, transient transfection was performed in 293F cells, and the activity of purified humanized antibodies was analyzed using ELISA and flow cytometry binding assay, as follows.

[0205] Example 10: Biological activity test of antibodies - HUVEC tube formation inhibition

[0206] HUVEC cells (GPC0114, source: China Typical Culture Collection Center) with no more than P11 passages were cultured in HUVEC cell special culture medium (CM-0122, Wuhan Punsense) added with FBS (164210-50) and 1% double streptomycin (PB180120). When the cell confluence reached 70-80%, the HUVEC cells were starved for 3-6 hours with Ham's F-12K (PM150910, Wuhan Punsense) culture medium without antibiotics, and the HUVEC cells were counted and inoculated into 96-well plates coated with Matrigel at 10 5 cells / well, while the appropriate concentration of the antibody to be tested or the control antibody was added as needed. Microscopic observation was performed at the indicated time, and photographs were taken.

[0207] In this example, the biological activities of two human-mouse chimeric antibody molecules (i.e., chimeric antibody molecules of mouse-derived VH-VL and human-derived Fc) C132 and C164 prepared in Example 3 and 12 humanized antibodies described in Example 9 were tested, and the results are shown in Tables 2 and 3, respectively. Figure 5 Figure 6

[0208] In the test of human-mouse chimeric antibody molecules, Isotype antibody was used as a negative control; in the test of humanized antibodies, we used the expression product of the same concentration of bevacizumab sequence as a positive control for inhibiting angiogenesis, and the human-mouse chimeric antibody form of C164 was used as a control of the parent antibody, and the group without adding antibody (adding the same volume of PBS) was set as Blank control.

[0209] The results showed that at a concentration of 20 ug / mL, the human-mouse chimeric antibodies C132 and C164 could observe the weakening of the tube formation ability of HUVEC cells within the indicated time Figure 5 ​​), which indicates that: human-mouse chimeric antibodies C132 and C164 have a more obvious inhibitory effect on the tube-forming ability of HUVEC at different co-incubation time points; and, Figure 6 As shown in the figure, humanized antibodies with different light and heavy chain combinations also showed significant inhibition of tube formation in vitro, among which HuC132-3, HuC132-1, etc. showed significant inhibition of tube formation in vitro after 3 h ( Figure 6 A) 8h( Figure 6 B) and 20h( Figure 6 Furthermore, after incubating HUVEC with HuC132-3 and HuC164-2 antibodies at different concentrations for 4 hours, a significant inhibitory effect on cell tube formation was observed ( Figure 6 D) The results of this example show that the antibody molecules of the present invention have a significant inhibitory effect on neovascularization.

[0210] Example 11: Analysis of the difference in gene expression between HUVEC cells cultured under subculture and tube formation conditions using CD93 antibodies

[0211] In this example, the effects of CD93 antibody on the expression levels of three cancer-related genes (ALDH1A3, BNIP3, MAFA) in HUVEC cells under subculture and tube formation conditions were detected.

[0212] Specifically, humanized anti-CD93 antibodies HuC132-3 and HuC164-2 were incubated with passaged HUVEC cells and HUVECs in the tube-forming conditions of Example 10 for 24 hours, and then mRNA was extracted and reverse transcribed into cDNA. The expression levels of three cancer-related genes, ALDH1A3, BNIP3, and MAFA, were detected by qPCR. The mRNA extraction protocol was based on the RNA-easyIsolation Reagen kit (R701-1, Norvegian). The concentration and purity of the extracted RNA were determined using a UV spectrophotometer (thermo Nano drop), and reverse transcription was performed according to the kit protocol ( IIQ RT SuperMix qPCR, +g DNA wiper, R233-01, Novozymes). Then, according to the standard protocol, qPCR reagents (ChamQ UniversalSYBR qPCR Master Mix, Q711-02, Novozymes) were used to prepare 20 μL of reaction solution in a 250 μL PCR tube (reaction system see Table 9). The corresponding primers (primer sequences see Table 10) were added, and three replicates were set for each group. Amplification was performed in a real-time fluorescence PCR instrument according to the reaction program shown in Table 11, and data analysis was performed according to standard procedures.

[0213] The results showed that in the passage state ( Figure 7 A) and tube forming conditions ( Figure 7 B), HuC132-3 and HuC164-2 had different effects on the three cancer-promoting genes. Under tube formation conditions, both antibody molecules showed the effect of reducing the expression of the three genes, indicating that the humanized antibody molecules of the present invention may affect the formation of new blood vessels by affecting the expression of cancer-related genes.

[0214] Table 9. Solutions added to the reaction mixture

[0215] Reagent Volume 2 x ChamQ Universal SYBR qPCR Master Mix 10.0 μl Primer 1 (10 μM) 0.4 μl Primer 2 (10 μM) 0.4 μl Template DNA / cDNA 1.0 μl ddH2O 7.2 μl Total volume 20.0ul

[0216] Table 10. Primer sequences

[0217] Primer name Primer sequence ALDH1A3-F AGAGTCTGGAACGGTCTGGA (SEQ ID NO: 31) ALDH1A3-R ATGTTTGAGGAAGGAGCCCC (SEQ ID NO: 32) BNIP3-F TCCTTCCATCTCTGCTGCTC (SEQ ID NO: 33) BNIP3-R AAACACAAGTGACGTGGCCA (SEQ ID NO: 34) MAFA-F ATGCTTCGTCGCTCTTTGGA (SEQ ID NO: 35) MAFA-R AAACTTTCAACGAGTCGGCG (SEQ ID NO: 36)

[0218] Table 11. qRT-PCR reaction program

[0219]

[0220]

[0221] Example 12: Expression and characterization of humanized antibodies in eukaryotic systems

[0222] In order to test the structural stability of humanized antibodies and whether they meet the properties that can be used in future drug production, we preliminarily measured the protein transient expression efficiency, antibody Tm and Tagg values ​​of a series of antibodies.

[0223] Briefly, the prepared plasmids containing the antibody's light and heavy chains were co-transfected into suspension 293 cells using a transfection reagent in a volume of no more than 10 mL. After 72 hours of incubation, the supernatant was harvested and purified using an AKTA Purifier 100 protein A affinity column. The resulting protein concentration was measured using a nano-drop assay, and its purity was analyzed using SDS-PAGE. The results demonstrated that the humanized antibody molecule of the present invention achieved an expression level of no less than 90 mg / L during transient expression, with a purity exceeding 98%, meeting the expression efficiency requirements for future drug development.

[0224] The binding ability of humanized antibodies HuC164-1, 2, 5, and 6 to tumor cell lines expressing CD93 was detected by flow cytometry. Figure 8 As shown; Figure 8 It was shown that the humanized antibody of the present invention retained the ability to bind to tumor cell lines expressing CD93, and its binding positive rate ( Figure 8 A) and MFI value ( Figure 8B) shows that this binding has a good concentration dependent effect.

[0225] The blocking ability of humanized antibodies HuC132-1, 2, 3, 4, 5, 6, 7, 8 to ligand IGFBP7 was also detected by flow cytometry, and the results are shown in Figure 9 Figure 9 It is shown that the humanized antibodies of the present application also retain the blocking ability to ligand IGFBP7.

[0226] In order to test the affinity of the antibodies to the antigen, the affinity constants of humanized antibodies HuC132-3, HC164-2 to the antigen were detected respectively using Octet instrument. According to the detection instrument Octet RED96e of Octet, CD93-his was fixed on the NI-NTA sensor, and the antibody was diluted by 2 times from a concentration of 50 ug / mL to a minimum concentration of 1.56 ug / mL, and the determination was carried out according to the standard procedure. The obtained data show that the affinity constants are all less than 10 -12 M. The antigen-antibody binding dissociation curves are shown in Figure 10 , wherein Figure A is the result graph of HuC132-3, and Figure B is the result graph of HuC164-2. Figure 10 It is shown that the humanized antibodies of the present application have excellent affinity to the antigen.

[0227] The characterization identification of the antibodies was carried out using the Uncle automatic analysis instrument of Unchained lab. According to the instrument instruction, 9 ul of antibody sample was added into the Uni tube, 2 repeats for each sample, the temperature was set to 0.5 degrees according to the standard procedure, starting from 25 degrees to 95 degrees, the Tm and Tagg values were tested, and the denaturation and aggregation process of the protein in the heating process was analyzed. The dynamic light scattering of the sample was tested at 25 degrees and 95 degrees respectively, so as to obtain the particle size and particle size distribution of the antibody molecules in the antibody sample. Table 12 shows the PDI and particle size of humanized antibodies HuC132-3, HC164-2, HC164-6 at 25 degrees. Figure 11 A shows the particle size distribution of the antibody sample at 25 degrees. Figure 11 B shows the denaturation curve of the antibody sample (2 repeats for each sample) and the fluorescence and SLS266 values.

[0228] Table 12. Characterization data of antibodies

[0229]

[0230] The above results show that the humanized antibody molecules of the present application have excellent stability.

[0231] ​Example 13: CD93 monoclonal antibodies effectively inhibit tumor growth in vivo in mice

[0232] (1) Inhibition of murine melanoma growth by fully murine antibodies

[0233] First, the tumorigenicity of the B16F10-CD93 overexpression cell line in C57BL / 6J mice was tested. Briefly, 1 x 10 6 B16F10-CD93 overexpression cells were implanted subcutaneously in the back of mice by subcutaneous injection, with 5-7 healthy 6-8 week old C57BL / 6J mice in each group. On the day of tumor inoculation, the mice were administered a dose of 15 mg / kg of the C132 and C164 drug molecules, which are fully murine antibodies (as constructed in Example 3), and 7F3-mIgG1, which is a murine-human chimeric antibody (i.e., the VH and LV of the humanized 7F3 molecule are grafted onto a mouse IgG1 skeleton), via the tail vein of the mice in a solution volume of no more than 100 ul. The model control group was the saline group. The administration frequency was twice a week, and the administration was continued for 6 times. Tumor growth was measured twice a week, and the tumor growth volume was calculated. To reduce the immune response of the mice to the human CD93 expressed by the tumor cell line, cyclosporine A was administered twice on the 7th and 10th day after tumor cell transplantation. The mice were euthanized according to the animal welfare management methods when the tumor growth volume exceeded 2500 mm 3 or the tumor diameter was greater than 20 mm.

[0234] Figure 12 Figures 13A and 13B show the results of mouse tumor volume detection and the change in mouse body weight, respectively, and the results show that the antibody molecules C164 and C132 of the present application inhibit the formation of mouse tumors to some extent. Compared with the model control group, the C132 administration group had a statistically significant difference (p < 0.001), and the C164 administration group had a significant difference (p = 0.0021). Although there was no statistically significant difference, the tumor inhibition effect of C132 was better than that of the positive control antibody 7F3 Figure 12 A); there was no significant difference in the body weight of the mice in each administration group compared with the vehicle control group Figure 12 B), indicating that the antibody molecules had little effect on the body weight of the mice. In addition, the standard for defining mouse death was that the mouse tumor volume was greater than 1500 mm 3 , and thus the survival curve of the mice was plotted, as shown in Figure 13C. It can be seen from the survival curve that the C132 antibody effectively prolonged the survival of the mice (p < 0.05). Figure 12

[0235] (2) Inhibition of human lymphoma growth by humanized monoclonal antibodies

[0236] ​Firstly, the NPG immunodeficient mice (Beijing Vantoda Biotechnology Co., Ltd.) were used for immune reconstruction. When the mice were inoculated with PBMC, they were 5-6 weeks old and weighed about 20 g.

[0237] The frozen hPBMC was thawed at 37°C water bath, and then 4 mL of complete medium (89% RPMI-1640 + 10% FBS + 1% penicillin-streptomycin) was added and mixed. After centrifugation (1000 rpm / min x 5 min), the supernatant was discarded, and the cells were resuspended in an appropriate amount of complete medium (89% RPMI-1640 + 10% FBS + 1% penicillin-streptomycin). After counting, the cell concentration was adjusted to 2.5 x 10 7 cells / mL for reinfusion. The animals were reinfused with PBMC through the tail vein, 5 x 10 6 cells per mouse, 0.2 mL per mouse. Anti-mouse CD45 antibody (BioLegend, 103114) and anti-human CD45 antibody (BioLegend, 304028) were used to regularly detect the proportion of mCD45 + and hCD45 + cells in the peripheral blood of mice. The results are shown in Figure 13 D&E, which showed that the proportion of mCD45 + T cells decreased over time, and the proportion of hCD45 + T cells increased over time. This result is consistent with the trend of changes in the composition of peripheral blood cells in immune-reconstructed animals, indicating that the test system is stable and reliable.

[0238] The frozen U937 cells were thawed at 37°C water bath, centrifuged at 1000 rpm / min for 5 min, and then resuspended in an appropriate amount of complete medium (89% RPMI-1640 + 10% FBS + 1% penicillin-streptomycin). After centrifugation (1000 rpm / min x 5 min), the supernatant was discarded, and the cells were resuspended in an appropriate amount of complete medium (89% RPMI-1640 + 10% FBS + 1% penicillin-streptomycin). After counting, the cell concentration was adjusted to 2 x 10 7 cells / mL. The tumor cells were subcutaneously inoculated into the right side of the animal near the axillary position, with a dose of 2 x 10 6 cells per mouse, 0.1 mL per mouse. After inoculation, the growth of tumor cells in vivo was observed and measured twice a week, and the tumor volume was calculated.

[0239] According to the immune reconstruction, the tumor volume was screened to be 100 mm 3The animals were randomly divided into 3 groups according to the tumor volume, the model control group, the 7F3-hIgG1 group and the HuC132-3 group, 10 animals in each group. The drug administration started on the day of grouping, the dose was 20 mg / kg, the volume was no more than 100 ul / animal / time, 2 times / week, and the administration was continuous for 5 times. The growth of tumor cells in vivo was observed and measured twice a week after drug administration, and the tumor volume was calculated. At the same time, the positive rate of immune cells in the immune reconstituted mice was detected on the 4th, 10th and 17th day after drug administration. The experimental results showed that compared with the model control group, the tumor volume of the mice in the HuC132-3 administration group was significantly reduced, and the difference was extremely significant in statistics (p<0.001), and the antitumor effect was better than that of the control antibody 7F3 (see Figure 13 A). The ratio of the tumor volume of the test group to the control group was calculated, and the T / C value of the HuC132-3 group was reduced to less than 10% at the end of the experiment (see Figure 13 B); the tumor volume of the mice was greater than 1500mm 3 The standard for defining mouse death was established, and the survival curve of the mice was drawn, as shown in Figure 13 C, it can be seen from the survival curve that the huC132-3 antibody effectively prolongs the survival of the mice. At the same time, the peripheral blood of the mice was analyzed by immune cells using a Beckman flow cytometer (Beckman, DxFLEX) using fluorescently labeled antibodies, including anti-human CD3 antibody (Biolegend, 300406), anti-human CD4 antibody (Biolegend, 300514) and anti-human CD8 antibody (Biolegend, 344706), and the results showed that there was no difference in the positive rate of the above immune cell markers in each group of mice, and there was no significant difference in statistics (p>0.05) Figure 13 F-H), which shows that the proportion of hCD3 + , hCD4 + , hCD8 + T cells in the blood of the test animal group is equivalent to that of the control group, and there is no statistical difference, which shows that our immune reconstruction is successful, and the HuC132-3 administration plays a role in inhibiting tumors.

[0240] The tumor tissues of the mice harvested after the end of the experiment were paraffin-embedded, fixed and deparaffinized, and antigen repair was performed. After blocking with blocking solution, incubation was performed according to the hCD8 antibody reagent (Abeam, ab237710) at the dilution ratio specified in the instructions, and then HRP-labeled goat anti-rabbit secondary antibody (Abeam, ab205718) was added for incubation, followed by rinsing, and then microscopic photography and analysis were performed. The staining results are shown in Figure 13 I, which shows that the CD8 +T cells were widely distributed and stronger than 7F3 administration group and model control group. The tumor tissues of model control group and huC132-3 group animals at the end of the experiment were subjected to hCD8 and CD31 fluorescence double staining, wherein CD31 antibody was FITC488 labeled and hCD8 antibody was Cy3.5 labeled. The results are shown in the following figure Figure 13 The lower figure of I also reproduced CD8 + T cells were widely distributed in tumor tissues. Both staining results showed that huC132-3 antibody might enhance the CD8 + T cell infiltration into the tumor, thereby inhibiting the growth of the tumor.

[0241] Finally, it should be noted that: the above examples are used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. An anti-CD93 antibody or antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region respectively have three HCDRs and three LCDRs selected from any one of the following heavy chain variable region and light chain variable region combinations: (1) the heavy chain variable region shown in SEQ ID NO: 11, and the light chain variable region shown in SEQ ID NO: 12; (2) the heavy chain variable region shown in SEQ ID NO: 13, and the light chain variable region shown in SEQ ID NO:

14.

2. The anti-CD93 antibody or antigen-binding fragment thereof according to claim 1, wherein: The heavy chain variable region comprises heavy chain complementary determining regions HCDR1, HCDR2, and HCDR3 as shown in the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; the light chain variable region comprises light chain complementary determining regions LCDR1, LCDR2, and LCDR3 as shown in the amino acid sequences of SEQ ID NO: 4, SAS, and SEQ ID NO: 5, respectively; Alternatively, the heavy chain variable region comprises heavy chain complementary determining regions HCDR1, HCDR2 and HCDR3 as shown in the amino acid sequences of SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively, and the light chain variable region comprises light chain complementary determining regions LCDR1, LCDR2 and LCDR3 as shown in the amino acid sequences of SEQ ID NO:9, LAS and SEQ ID NO:10, respectively.

3. The anti-CD93 antibody or antigen-binding fragment thereof according to claim 2, characterized in that The antibody is a murine antibody, a single domain antibody, a chimeric antibody, a human antibody or a humanized antibody; And / or, the antigen-binding fragment is Fab, Fab', F(ab')2, Fv or a complementarity determining region fragment.

4. The anti-CD93 antibody or antigen-binding fragment thereof according to claim 3, wherein The antibody is a murine antibody or a chimeric antibody, wherein: The amino acid sequence of the heavy chain variable region of the antibody comprises the amino acid sequence shown in SEQ ID NO: 11, or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO:

11. Preferably, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO: 11; the amino acid sequence of the light chain variable region of the antibody comprises the amino acid sequence shown in SEQ ID NO: 12, or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO:

12. Preferably, the amino acid sequence of the light chain variable region is as shown in SEQ ID NO: 12; Alternatively, the amino acid sequence of the heavy chain variable region of the antibody comprises the amino acid sequence as shown in SEQ ID NO: 13, or an amino acid sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence as shown in SEQ ID NO:

13. Preferably, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO: 13; the amino acid sequence of the light chain variable region of the antibody comprises the amino acid sequence as shown in SEQ ID NO: 14, or an amino acid sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence as shown in SEQ ID NO:

14. Preferably, the amino acid sequence of the light chain variable region is as shown in SEQ ID NO:

14.

5. The anti-CD93 antibody or antigen-binding fragment thereof according to claim 4, wherein: When the antibody is a murine antibody, the murine antibody further comprises a murine heavy chain constant region and a murine light chain constant region, the murine heavy chain constant region is selected from one of murine IgG1, IgG2a, IgG2b or IgG3 constant regions, and the murine light chain constant region is a murine Ck type constant region; When the antibody is a chimeric antibody, the chimeric antibody further comprises a humanized antibody constant region.

6. A humanized anti-CD93 antibody or antigen-binding fragment thereof, which is constructed based on the anti-CD93 antibody or antigen-binding fragment thereof according to claim 1 or 2, using CDRs grafting technology and / or CDR region mutation design.

7. The humanized anti-CD93 antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The humanized anti-CD93 antibody or antigen-binding fragment thereof has a heavy chain variable region and a light chain variable region selected from any one of the following: (1) a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 15, and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 19; (2) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 16, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 19; (3) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 17, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 19; (4) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 18, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 19; (5) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 15, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 20; (6) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 16, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 20; (7) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 17, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 20; (8) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 18, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 20; (9) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 21, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 23; (10) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 22, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 23; (11) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 21, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 24; (12) a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 22, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:

24.

8. The humanized anti-CD93 antibody or antigen-binding fragment thereof according to claim 7, characterized in that: The heavy chain of the humanized anti-CD93 antibody or antigen-binding fragment thereof comprises a heavy chain constant region of human IgG1, IgG2, IgG3 or IgG4.

9. An ADC molecule comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8.

10. A bispecific or multispecific antibody molecule comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8. A fusion protein comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8.

12. A polynucleotide comprising a nucleotide sequence encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8.

13. The polynucleotide according to claim 12, characterized in that The polynucleotide is a polynucleotide group, and the polynucleotide group includes: a nucleotide sequence encoding the heavy chain variable region shown in SEQ ID NO: 11 and a nucleotide sequence encoding the light chain variable region shown in SEQ ID NO: 12; Alternatively, the nucleotide sequence encoding the heavy chain variable region shown in SEQ ID NO: 13 and the nucleotide sequence encoding the light chain variable region shown in SEQ ID NO:

14.

14. The polynucleotide according to claim 13, wherein The nucleotide sequence encoding the heavy chain variable region set forth in SEQ ID NO:11 includes the DNA sequence set forth in SEQ ID NO:25 or the RNA sequence corresponding thereto, and the nucleotide sequence encoding the light chain variable region set forth in SEQ ID NO:12 includes the DNA sequence set forth in SEQ ID NO:26 or the RNA sequence corresponding thereto; Alternatively, the nucleotide sequence encoding the heavy chain variable region as shown in SEQ ID NO: 13 includes the DNA sequence as shown in SEQ ID NO: 27 or the RNA sequence corresponding thereto, and the nucleotide sequence encoding the light chain variable region as shown in SEQ ID NO: 14 includes the DNA sequence as shown in SEQ ID NO: 28 or the RNA sequence corresponding thereto.

15. A nucleic acid construct comprising the polynucleotide according to any one of claims 12 to 14, and, optionally, at least one expression control element operably linked to the polynucleotide. 16 . A recombinant vector comprising the polynucleotide according to claim 12 , or the nucleic acid construct according to claim 15 .

17. A transformed host cell, wherein the polynucleotide according to any one of claims 12 to 14, the nucleic acid construct according to claim 15 or the recombinant vector according to claim 16 is transformed.

18. The transformed host cell according to claim 17, characterized in that The host cell is a bacterial, yeast or mammalian cell; Optionally, the bacteria is Escherichia coli; Optionally, the yeast is Pichia pastoris; Optionally, the mammalian cells are Chinese hamster ovary cells or human embryonic kidney 293 cells.

19. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, the ADC molecule according to claim 9, the bispecific or multispecific antibody molecule according to claim 10, the fusion protein according to claim 11, the polynucleotide according to any one of claims 12 to 14, the nucleic acid construct according to claim 15, the recombinant vector according to claim 16 and / or the transformed host cell according to claim 17 or 18, and a pharmaceutically acceptable excipient, diluent or carrier.

20. A reagent or kit for detecting the presence or expression level of a CD93 molecule, comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8 and / or the transformed host cell according to claim 17 or 18.

21. A method for preparing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, comprising: Under conditions suitable for the expression of the antibody or antigen-binding fragment thereof, the transformed host cell according to claim 17 or 18 is allowed to express the antibody or antigen-binding fragment thereof, and the expressed antibody or antigen-binding fragment thereof is recovered from the culture of the host cell.

22. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, the ADC molecule according to claim 9, the bispecific or multispecific antibody molecule according to claim 10, the fusion protein according to claim 11, the polynucleotide according to any one of claims 12 to 14, the nucleic acid construct according to claim 15, the recombinant vector according to claim 16, the transformed host cell according to claim 17 or 18, and / or the pharmaceutical composition according to claim 19 in the preparation of a medicament for preventing and / or treating a CD93-mediated disease, disorder or condition.

23. The use according to claim 22, characterized in that The disease is a tumor and / or an angiogenic proliferative disease; and / or the treatment is to alleviate, relieve, improve or inhibit the symptoms or progression of the disease, disorder or condition; Preferably, the tumor is breast cancer, ovarian cancer, prostate cancer, pancreatic cancer, kidney cancer, lung cancer, liver cancer, stomach cancer, colon cancer, bladder cancer, esophageal cancer, cervical cancer, gallbladder cancer, hematological tumor, lymphoma, glioblastoma and / or melanoma; Preferably, the angiogenic proliferative disease is selected from the group consisting of neovascular eye disease, psoriasis characterized by abnormal angiogenesis, psoriasis, rheumatoid arthritis or obesity.

Images