Application of rice OsSRR1 gene in resistance to rice stripe disease

Abstract

The application belongs to the field of plant disease prevention and treatment, and particularly relates to application of a rice OsSRR1 gene in resistance to rice stripe disease. The application screens a new target gene OsSRR1 for preventing and treating rice stripe disease through transcriptome sequencing analysis, qRT-PCR verification and observation of disease resistance phenotypes of rice transgenic lines infected with rice stripe virus. After mutation of the gene, the content of rice stripe virus in the rice can be significantly reduced, and the formation of disease spots can be inhibited. In summary, the application provides use of the OsSRR1 gene and the mutant thereof in genetic improvement and breeding of rice disease resistance, and has great application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant disease control, and particularly relates to application of a rice OsSRR1 gene in resistance to rice stripe disease. BACKGROUND

[0002] Rice stripe disease is a disease caused by rice stripe virus (RSV), and its outbreak has become a major biological stress factor threatening global rice stable yield. Field investigation shows that the harmfulness of the disease is not only reflected in direct yield loss, but also in grain filling disorder caused by damage to the photosynthetic system of the plant, forming "pseudo-full grains" and other hidden damage characteristics. After years of research, it has been confirmed that rice stripe virus is the pathogenic agent. The virus completes the transmission cycle through the persistent multiplication of the gray rice leafhopper, and the population of the intermediate insect has a significant positive correlation with the prevalence of the disease. In recent years, based on the breeding of resistant varieties and the promotion and application of the comprehensive control technology system, the overall occurrence of the disease has shown a downward trend, but there is still a risk of persistent prevalence in local areas. Therefore, it is necessary to continue to implement the plant protection principle of "prevention first and comprehensive control", focus on the key nodes of the year-round infection cycle of the virus, and systematically implement the "four-in-one" comprehensive management strategy of "resistance (application of resistant varieties), avoidance (virus transmission period), interruption (transmission route), and treatment (intermediate control)", so as to build a long-term mechanism for sustainable control of the disease. However, there are still relatively few known target genes for preventing and treating rice stripe disease.

[0003] Serine / arginine-rich (SR) proteins are a class of RNA-binding proteins, which contain an RNA recognition domain (RRM) at the N-terminus and are rich in arginine-serine (RS) dipeptide repeats of different lengths at the C-terminus. SR proteins act as splicing factors in animals and plants, and have been studied in depth. For example, the MoSrp1 protein of Magnaporthe oryzae regulates the molecular mechanism of pathogenicity of the fungus by affecting the alternative splicing of introns in precursor mRNA; the deletion of the MoSRP1 gene leads to significant reduction in mycelial growth, spore development, sporulation capacity, and pathogenicity of the fungus, and also leads to thousands of abnormal intron alternative splicing events. However, the relationship between the OsSRR1 gene encoding serine / arginine-rich protein in rice and rice virus is not clear, and no research report has been found.

[0004] In summary, there is an urgent need to discover new targets for effectively preventing and treating rice stripe disease and to develop new disease-resistant methods. SUMMARY

[0005] In view of the technical problem that there are few targets for preventing and treating rice stripe disease, the application provides application of a rice OsSRR1 gene in resistance to rice stripe disease, and belongs to the field of plant disease prevention and treatment. The application preliminarily obtains 22 genes related to plant stripe virus infection and participating in RNA splicing and RNA binding through transcriptome sequencing analysis on rice infected with rice stripe virus; then, the expression amount of the genes is verified by using qRT-PCR technology, wherein the mRNA expression of four genes (LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710, LOC_Os04g02870) is obviously induced by rice stripe virus, so the four genes are constructed into rice knockout lines, and the disease resistance phenotype of the transgenic lines of rice is observed, and it is found that only the OsSRR1 gene knockout line shows an obvious disease resistance phenotype, that is, the content of rice stripe virus in rice can be significantly reduced and the formation of lesions is inhibited, so finally a new target gene OsSRR1 for preventing and treating rice stripe disease is screened. In summary, the application provides the use of the OsSRR1 gene and its mutant in genetic improvement and breeding of disease resistance in rice, and has great application prospect.

[0006] More specifically, the application targets the OsSRR1 gene for editing by using a CRISPR / Cas9 gene editing system. First, a YL-Hu-OsSRR1 knockout vector is constructed, and the vector is used to transform callus tissue induced from mature embryos of Zhonghua 11 rice by using rice callus transfection technology; after obtaining T0 generation transgenic rice seeds, the seeds are further propagated to obtain T1 generation seeds, and DNA of young leaves of single plants in the T1 generation is extracted, the sgRNA target site is amplified by using target-specific primers, and sequencing is performed, so that a stable hereditary homozygous mutant transgenic plant is obtained.

[0007] The experimental results show that the symptoms of OsSRR1 mutant transgenic plants inoculated with RSV, including the expression amount of virus at the RNA level and the protein level, are significantly lower than those of wild control ZH11 plants. It can be seen that the OsSRR1 mutant transgenic rice can significantly enhance the resistance of rice to RSV infection, and has good application value in the field of transgenic plants. In summary, the application has practical guiding significance for breeding transgenic plants resistant to rice stripe disease, and also has important application prospect in the field of plant disease prevention and treatment.

[0008] To achieve the above object, the technical scheme adopted by the application is as follows:

[0009] In one aspect, the present application provides an application of SRR1 gene / protein as a target in preventing and treating plant diseases caused by Tenuiviruses, wherein the SRR1 gene has a nucleotide sequence as shown in SEQ ID NO: 1, and the SRR1 protein has an amino acid residue sequence as shown in SEQ ID NO: 2.

[0010] In some specific embodiments, the SRR1 gene / protein is OsSRR1 gene / protein derived from rice, wherein the sequence of the OsSRR1 gene is shown in SEQ ID NO: 1, and the sequence of the OsSRR1 protein is shown in SEQ ID NO: 2.

[0011] The Tenuiviruses include Echinochloa hojablanca virus (EHBV), Maize stripe virus (MSpV), Rice grassy stunt virus (RGSV), Rice hoja blanca virus (RHBV), Rice stripe virus (RSV), and Urochloa hoja blanca virus (UHBV), preferably Rice stripe virus (RSV).

[0012] Further, the plant is a plant of Poaceae.

[0013] The plant of Poaceae includes, but is not limited to, rice, corn, wheat, oat, and barley; more preferably rice, and most preferably Zhonghua 11.

[0014] In another aspect, the present application provides a SRR1 gene mutant, which is generated by mutating a region shown in SEQ ID NO: 3 in the sequence shown in SEQ ID NO: 1.

[0015] The type of the mutation includes: addition, deletion, and substitution of nucleotides.

[0016] Further, the gene mutant lacks any one or more of the 33rd to 37th bases in the sequence shown in SEQ ID NO: 1.

[0017] In some embodiments, the gene mutant comprises the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. More specifically, SEQ ID NO: 6 is the sequence shown in SEQ ID NO: 1 with the deletion of the 37th nucleotide; and SEQ ID NO: 7 is the sequence shown in SEQ ID NO: 1 with the deletion of the 33rd-36th nucleotides.

[0018] The present application utilizes the CRISPR / Cas9 gene editing technology to introduce mutations in the region of ATATCGCAGTCCCCCTAGGAGGG (SEQ ID NO: 3) of the OsSRR1 gene, and prepares a plurality of OsSRR1 gene mutants. In the present application, two types of mutants are selected for subsequent research, and it is confirmed that the mutants can enhance the resistance of rice to stripe rust. More preferably, the 37th nucleotide of the OsSRR1 gene (SEQ ID NO: 1) is deleted, i.e., the mutant corresponds to SEQ ID NO: 6.

[0019] In another aspect, the present application provides a SRR1 protein mutant, characterized in that the protein mutant is a prematurely terminated SRR1 protein, and the sequence of the SRR1 protein has the amino acid residue sequence shown in SEQ ID NO: 2 or an amino acid residue sequence having 80% or more homology with the amino acid residue sequence.

[0020] The SRR1 protein mutant is encoded by the SRR1 gene mutant described above. In other words, the SRR1 protein of the present application is indirectly produced by the CRISPR / Cas9 gene editing technology.

[0021] The "premature termination" refers to the deletion / addition / substitution of a base at a specific site in the open reading frame of the SRR1 gene, which forms a stop codon in advance, and then cannot produce a complete SRR1 protein. The site of the SRR1 gene mutation determines the amino acid sequence and activity of the encoded protein. It should be understood that gene mutation may result in loss of protein function, or may enhance the activity of the protein, which needs to be analyzed on a case-by-case basis.

[0022] Further, the number of amino acid residues constituting the SRR1 protein mutant is less than 50.

[0023] Further, the protein mutant terminates prematurely at the 45th or 46th amino acid site of the SRR1 protein.

[0024] The protein mutant terminated at the 45th amino acid site corresponds to the OsSRR1 gene mutant missing nucleotides 33-36 (i.e., SEQ ID NO: 7), and the protein mutant terminated at the 46th amino acid site corresponds to the OsSRR1 gene mutant missing nucleotide 37.

[0025] Specifically, the protein mutant contains the amino acid residue sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5.

[0026] The amino acid residue sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5 correspond to the protein mutants terminated at the 45th and 46th amino acid sites, respectively. The present application proves that the protein mutant terminated at the 46th amino acid site can not only improve the ability of rice to resist stripe disease, but also enable the SRR1 protein to normally perform its function in the normal growth and development of rice, and thus the protein mutant is preferred.

[0027] Further, the use of the SRR1 gene mutant or the protein mutant in the preparation of an agent for resisting plant diseases, wherein the gene mutant is as described above and the protein mutant is as described above.

[0028] In another aspect, the present application provides a biological material containing the above-mentioned SRR1 gene or the above-mentioned SRR1 gene mutant or the above-mentioned SRR1 protein mutant, wherein the biological material is any one or more of a vector, a host cell, a transformed plant cell, and a plant.

[0029] In some modes, the corresponding SRR1 gene / protein mutant is prepared or generated in the biological material (such as callus, rice plant) using the CRISPR / Cas9 gene editing technology. In the present application, the biological material refers to the OsSRR1 knockout mutant (OsSRR1-ko) of Zhonghua 11; more specifically, the OsSRR1-ko includes OsSRR1-ko-#1 and OsSRR1-ko-#2, wherein the OsSRR1-ko-#1 corresponds to the protein mutant terminated at the 46th amino acid site (SEQ ID NO: 5) or the gene mutant (SEQ ID NO: 6) missing nucleotide 37 of the sequence shown in SEQ ID NO: 1; the OsSRR1-ko-#2 corresponds to the protein mutant terminated at the 45th amino acid site (SEQ ID NO: 4) or the gene mutant (SEQ IN NO: 7) missing nucleotides 33-36 of the sequence shown in SEQ ID NO: 1; and the OsSRR1-ko-#1 and the corresponding mutation mode thereof are preferred.

[0030] Furthermore, the present invention provides the application of biological materials containing the above-mentioned SRR1 gene or the above-mentioned SRR1 gene mutant or the above-mentioned SRR1 protein mutant in rice disease resistance breeding.

[0031] In some embodiments, the biological material is rice, specifically the variety Zhonghua 11.

[0032] The beneficial effects of this invention include:

[0033] 1. Using RNA-Seq technology, through a series of screenings, a new target gene, OsSRR1, for the control of rice stripe virus was obtained, providing a new approach to the control of rice stripe virus.

[0034] 2. Using CRISPR / Cas9 technology, multiple OsSRR1 gene / protein mutants were obtained, and an OsSRR1 gene / protein mutant that can both improve rice resistance to rice stripe virus and perform normal regulation of other physiological processes was identified, providing a new option for plant disease resistance breeding. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 Hierarchical clustering analysis of differentially expressed genes.

[0037] Figure 2 : Results of RNA-level expression of alternative splicing-related genes.

[0038] Figure 3 The mutation status of the OsSRR1 gene / protein in the OsSRR1-ko knockout lines, among which, Figure 3 In the figure, A represents the mutation status of the OsSRR1 gene; Figure 3 B in the figure represents the mutation status of the OsSRR1 protein.

[0039] Figure 4 mRNA expression level of OsSRR1 gene in OsSRR1-ko knockout lines.

[0040] Figure 5 Symptoms of disease in OsSRR1-ko knockout strains and control strain Zhonghua 11 after RSV infection.

[0041] Figure 6qRT-PCR detection results of RSV virus content in OsSRR1-ko knock-out line and control Zhonghua 11 after RSV infection.

[0042] Figure 7 Detection results of RSV virus protein level in OsSRR1-ko knock-out line and control Zhonghua 11 after RSV infection, CP protein: coat protein.

[0043] The meanings of the symbols in the figures are as follows:

[0044] ZH11: wild type Zhonghua 11 rice; OsSRR1-ko: Zhonghua 11 rice line with OsSRR1 gene knocked out. DETAILED DESCRIPTION

[0045] The present application will be further described in conjunction with the drawings and specific examples in the description, which are only used to explain the present application and are not used to limit the scope of the present application; all other examples obtained by those skilled in the art without making creative efforts on the basis of the examples in the present application belong to the scope of protection of the present application.

[0046] The test methods used in the following examples are conventional methods, and three replicates are provided; the rice varieties used in the present application are Nip and Zhonghua 11, and the relevant culture media are shown in Table 1; the materials, reagents, etc. used are commercially available reagents and materials, unless otherwise specified.

[0047] Table 1 Culture media used in the present application

[0048]

[0049] Example 1: Experimental methods

[0050] 1.1 Artificial inoculation of RSV

[0051] The rice materials (such as Nip, Zhonghua 11, OsSRR1-ko transgenic line) were soaked and germinated for 2-3 days; after the radicle broke through the seed coat, the radicle end was vertically planted downward into a standard glass culture vessel with a volume of 1 L using the directional seeding method, about 30 seeds were placed in each beaker, three biological replicates were set, and the culture was carried out at 30°C under 16 h light / 8 h dark conditions.

[0052] The artificial virus transmission process mainly includes three steps of identification of RSV virus source, acquisition of virus by intermediate insects, and virus transmission by intermediate insects.

[0053] First, the total RNA was extracted from the rice plants carrying RSV in the field; RT-qPCR experiments were performed using RSV (CP) virus-specific primers to detect the mRNA level of the virus in the diseased plants. The tested virus-carrying plants were transplanted after pretreatment according to the following process: removing old leaves and retaining young stem and leaf tissues, moving the virus-carrying rice samples into 5 L transparent glass containers for substrate fixation, using rice soil to implement root wrapping treatment, and optimizing water contact. The surface of the container was covered with multiple layers of filter paper to absorb the remaining liquid and maintain a suitable humidity environment for insect activity; after transplantation, the newly hatched small brown planthopper nymphs (1-2 instars) were brushed onto the virus-infected seedlings using a soft brush, and the gauze was sealed before being placed in an artificial climate chamber (26°C, 16 h light: 8 h darkness) to complete the natural virus acquisition process. The virus acquisition period was set to 3-5 days, and the virus acquisition duration was adjusted according to the physiological state of the virus source; after virus acquisition was completed, the insects were transferred to healthy Wu Yujing 3 seedlings to complete the 10-12 day loop culture, and the host plants were replaced regularly to ensure normal insect development.

[0054] After the virus feeding was completed, the virus transmission stage of the intermediate insects was entered. At the beginning of the intermediate insects entering the loop stage, the cultivation program of the virus receptor plants needed to be started simultaneously. The specific implementation method is as follows: when the seedling height in the above-mentioned step is level with the top of the 5 L transparent glass container, it can be used as the receptor material for virus inoculation; the intermediate insects that have completed the development in the loop period are inoculated with the virus at a density of 2 insects per plant. The number of insects inoculated is precisely controlled using an insect sucking device, and the insects are uniformly dispersed on the surface of the receptor plants using a soft brush. The continuous inoculation period is 72 h; the inoculation duration is appropriately adjusted according to the physiological state of the receptor plants and the insect activity index. After the inoculation is terminated, the intermediate insects are brushed onto healthy Wu Yujing 3 seedlings using a soft brush. The receptor plants that have completed inoculation need to be treated with water compensation, and are placed in an artificial climate environment for 48 h of adaptive recovery, and then are transplanted to the field test area according to the standard agricultural operation specifications, and the disease development process is continuously observed and recorded.

[0055] Finally, virus inoculation experiments were performed using 3-4 instar healthy small brown planthoppers carrying RSV, and 2-3 small brown planthoppers per plant were inoculated onto 3-4 leaf stage (two-week-old) rice leaves, and the same instar small brown planthoppers not carrying RSV were inoculated onto rice as a control. After the rice was fed to the small brown planthoppers for 3 days, all the insects were brushed out.

[0056] 1.2 Detection of gene expression levels

[0057] The detection of the expression levels of the genes includes RNA levels (such as qRT-PCR and RNA-seq) and protein levels (such as Western blot).

[0058] 1.2.1 Detection of RNA levels

[0059] Total RNA of plants was extracted using TRIzol reagent extraction kit after rice leaves inoculated with RSV for 30 days. The RNA was used as follows: sent to Hangzhou Lianchuan Biological Company for transcriptome sequencing; the expression amount of specific genes was detected by qRT-PCR technology (ChamQ SYBR qPCR Master Mix (Low Rox) kit), and the information of the genes and the quantitative primers used are shown in Table 2.

[0060] Table 2 Information of genes and qRT-PCR quantitative primers

[0061]

[0062] 1.2.2 Detection at protein level

[0063] The experimental steps of Western blot are as follows:

[0064] Before Western blot analysis, SDS-PAGE gel needs to be prepared, and different concentrations of SDS-PAGE gel need to be prepared because different proteins have different molecular weights. In this study, 12% SDS-PAGE gel was used. The specific operation steps are as follows:

[0065] (1) Install the gel preparation device in the fume hood and fix the gel plate. Add an appropriate amount of dd H2O to the center of the gel plate and stand for 10 min. Check the sealing by the change of liquid level.

[0066] (2) After confirming that the gel plate is fixed, prepare 12% SDS-PAGE lower separation gel. Mix well and add 5 mL of gel per plate into the pre-assembled gel plate. Then add isopropanol to make the liquid level flat. Stand at room temperature for 1 h to solidify.

[0067] (3) After the separation gel is completely solidified, pour off the isopropanol or absorb it with filter paper. Then prepare 5% SDS-PAGE upper concentrated gel solution. Add 1 mL of gel per plate into the gel plate. When inserting the sample comb, tilt 45° slowly to avoid air bubbles. Stand for 20 min to solidify. After solidification, pull out the comb, and then perform Western blot electrophoresis operation.

[0068] The specific experimental steps of Western blot protein detection are as follows:

[0069] A. Electrophoresis and wet transfer membrane parameters

[0070] (1) Electrophoresis condition setting: After assembling the electrophoresis device, inject 1x electrophoresis buffer, set the gradient voltage program: for the upper concentrated gel, 90 V constant voltage electrophoresis for 20 min, and then adjust to 120 V for 60 min after the sample migrates to the separation gel;

[0071] (2) Electrophoresis termination: terminate electrophoresis when the front band of the pre-stained protein marker migrates to the bottom of the gel, or terminate electrophoresis according to the size of the desired band, remove the non-target area gel according to the protein molecular weight marker;

[0072] (3) Wet transfer membrane process: immerse the PVDF membrane in methanol for more than 15 s for activation, at this time the membrane should uniformly change from opaque to translucent, then immerse in equilibration buffer for more than 2 min, assemble in the order of anode-sponge-membrane-gel-sponge-cathode, and complete protein transfer using the GenScript automatic wet transfer system.

[0073] B. Western blot detection process

[0074] (1) Blocking treatment: immerse the transferred PVDF membrane in 5% skimmed milk for blocking, shake at room temperature for 90 min;

[0075] (2) Antibody incubation: dilute the primary antibody working solution with blocking solution according to the titer, shake at room temperature for 120 min, and incubate overnight at 4°C for low-abundance proteins;

[0076] (3) Secondary antibody reaction: after three TBST rinses, add 1:10000 diluted species-specific secondary antibody, shake at room temperature for 60 min;

[0077] (4) Signal detection: remove the water on the surface of the PVDF membrane, evenly cover the membrane surface with ECL developing solution, collect the signal through the chemiluminescence imaging system, and after development, use the ponceau red staining method for loading amount uniformity verification.

[0078] The specific antibody of the CP protein of RSV virus was provided by Professor Wu Jianxiang of Zhejiang University; the chemical reagents used in the experiment included ponceau red dye, different pH value Tris-HCl buffer system (pH 8.8 and 6.8), sodium dodecyl sulfate (SDS), polyacrylamide (APS), and concentrated TBS buffer (20x), which were all purchased from Shanghai Sangon; the protein immunoblotting detection system used EasySee Western Blot Kit from GenScript Biotech Co., Ltd.; and the protein molecular weight standard used pre-stained color Marker from Beijing Kangrunchengye Biological Technology Co., Ltd.

[0079] 1.3 Construction of rice YL-Hu-OsSRR1 vector

[0080] The YL-Hu-OsSRR1 vector is a CRISPR / Cas9 gene editing vector. The present application uses overlapping PCR method to construct the vector, and the construction scheme is as follows: according to the OsSRR1 gene sequence shown in SEQ ID NO: 1, primers are designed on the CRISPR-GE website, and the sgRNA fragment is cloned from rice, and the target sequence is: ATATCGCAGTCCCCCTAGGAGGG (SEQ ID NO: 3). The PCR primer sequence is: YL-Hu-OsSRR1-F: CAGTGGTCTCATGCAACTGTGCGGTGTGTTAAAGT (SEQ ID NO: 56); YL-Hu-OsSRR1-R: CAGTGGTCTCAAAACCCAGTAATGCCTTACCCGCTGT (SEQ ID NO: 57).

[0081] After the PCR product is recovered and purified, the target sequence is connected to the U3 promoter and the gRNA scaffold, respectively, with the pYLsgRNA-OsU3 vector as the template; the two products obtained by PCR are mixed as templates, and the U3 promoter, the target sequence and the gRNA scaffold are connected together by overlapping PCR to form an sgRNA expression cassette; the gRNA expression cassette product and the uncut pYLCRISPR / Cas9Pubi-H plasmid are mixed, and the mixture is digested with Bsa I enzyme at 37°C, and the reaction time is 15 min; after the enzyme digestion reaction is completed, 1.5 μL 10 × DNA Ligase Buffer and 35 U T4 ligase are added, and the variable temperature cycle enzyme digestion and ligation are performed for 15 cycles, and the cycle program is 37°C for 5 min; 10°C for 5 min, and 20°C for 5 min; positive clones are selected, sequenced, and confirmed that the expression vector YL-Hu-OsSRR1 has been successfully constructed, the recombinant plasmid is obtained, and the quality of the plasmid is detected by 1% agarose gel electrophoresis. The recombinant vector with correct sequencing is transformed into Agrobacterium GV3101.

[0082] 1.4 Genetic transformation of rice

[0083] 1.4.1 Callus induction and subculture: Select newly harvested mature wild-type rice seeds (Zhonghua 11), peel the husk, pour into a 50 mL centrifuge tube, add 15 mL of 75% ethanol for 1 minute, pour off the ethanol, rinse with sterile water three times, pour off, add 15 mL of 30% sodium hypochlorite solution, and sterilize for 20 minutes. After pouring off the sodium hypochlorite, rinse with sterile water for 5-6 times. Use a pipette gun to absorb the excess water, and transfer the seeds to the induction medium, and place in a 28°C light incubator for 3 weeks. The callus that grows is picked up with a sterilized tweezers and transferred to the subculture medium, and subcultured in a 28°C light incubator for 1 week.

[0084] 1.4.2 Transformation and culture of Agrobacterium: Transform the plasmid containing the target vector into Agrobacterium GV3101 (manufacturer: Shanghai Weidi, product number: AC1003S) using the following steps: take 5 μL YL-Hu-OsSRR1 plasmid (concentration 100 ~ 200 ng / μL) and add to 100 μL of Agrobacterium GV3101 competent cells, mix well with a pipette gun, add to a sterile and pre-cooled 4°C electrode cup, and perform electric shock transformation at a voltage of 220 V. Add LB liquid medium without antibiotics, and shake culture at 28°C for about 3 hours. Uniformly spread on LB solid medium containing 50 μg / mL Kan and 50 μg / mL Rif, and incubate at 28°C in the dark for 2-3 days until single colonies appear.

[0085] 1.4.3 Agrobacterium transfection of callus: Use a pipette gun to aspirate the infection solution and rinse the Agrobacterium on the plate to prepare the Agrobacterium suspension required for rice transformation. Select a sufficient number of calli (good callus state, bright yellow color, round and hard texture, and particle diameter of about 3 mm is appropriate), and place in a 100 mL sterile flask. Add an appropriate amount of Agrobacterium suspension (ensure that there is enough bacteria solution to contact the material), and place at room temperature for 20 minutes, and shake from time to time. Pour off the bacteria solution, and place the callus on sterile filter paper to absorb the excess bacteria solution, and then transfer to solid co-culture medium with a layer of sterile filter paper, and incubate at 26°C in the dark for 3 days.

[0086] 1.4.4 Selection culture: The callus after 3 days of co-culture needs to be washed, i.e. transfer the callus on the co-culture medium to a sterilized flask with 1 mL of blue gun head, and rinse twice with sterile water. The third time, rinse with sterile water containing 500 μg / L carbenicillin. After absorbing the excess water with a pipette gun, transfer the callus to sterile filter paper, and use the clean bench to blow dry the water on the callus. The blowing time is controlled at about 30 minutes. After the callus is dried, transfer it to the selection medium for selection culture, and the culture conditions are 28-30°C and dark culture. The selection time is 3-4 weeks.

[0087] 1.4.5 Seedling rooting: when the seedlings grow to about 2-3 cm and have obvious root system, they can be transferred to the rooting medium for further growth; the rooting medium should be poured into a higher bottle or tube, so that the grown seedlings have enough space to grow upwards; the optimal conditions for rooting are sterile light culture at 28-30 degrees Celsius.

[0088] 1.5 Identification and screening of positive transgenic plants

[0089] Take T0 and T1 single seedling leaves, extract DNA by CTAB method, amplify sgRNA targeting site with target specific primers, detect the amplification product by 1% gel electrophoresis, recover the specific and correct size band from the gel, and sequence; the sequencing primers are as follows: OsSRR1-F: ACTGTGCGGTGTGTTAAAGT (SEQ ID NO: 58); OsSRR1-R: AGTAATGCCTTACCCGCTGT (SEQ ID NO: 59). Then, the expression of OsSRR1 gene in transgenic plants was detected by qRT-PCR experiment. Finally, two strains with homozygous mutation, high positive rate and no expression of OsSRR1 gene were selected from the positive strains for subculture, and T2 generation seeds were obtained for the study of resistance to rice stripe disease (including observation of disease resistance traits).

[0090] 1.6 Analysis of rice resistance after inoculation of RSV

[0091] The resistance analysis of rice mainly observes the symptoms of rice after the disease occurs and detects the expression amount of virus in rice leaves. Among them, 30 days after inoculation of virus, the traits of rice are observed. When observing the traits, two groups are set, one group is normal growing rice (Mock group), including OsSRR1-ko transgenic lines of Zhonghua 11 background (OsSRR1-ko-#1 (n = 15) and OsSRR1-ko-#2 (n = 15)) and wild type of Zhonghua 11 (n = 15); the other group is OsSRR1-ko transgenic lines (OsSRR1-ko-#1 and OsSRR1-ko-#2) inoculated with RSV virus according to the method described in step 1.1 (n = 15) and wild type of Zhonghua 11 (n = 15), and Zhonghua 11 is the control.

[0092] Collect the above untreated and RSV virus infected rice leaves (n = 3) respectively, and detect the expression of virus by qRT-PCR and Western blot technology, the specific steps are described in step 1.2.

[0093] Example 2: Preliminary screening of target genes for preventing and treating rice stripe disease

[0094] To further explore the host factors responding to rice stripe virus, this invention artificially inoculates two-week-old Nip plants with RSV (details in Example 1). After 30 days, leaves from diseased (n = 3) and healthy (n = 3) rice plants were collected for total plant RNA extraction. After quality control and RNA purity analysis, the extracted total plant RNA was used as transcriptome sequencing samples for high-throughput sequencing.

[0095] After sequencing was completed, a total of 3.6 × 10⁻⁶ samples were generated. 8 A 100 bp terminal readout was obtained, expressing a total of 21,567 genes. Then, differential expression analysis was performed on the obtained data based on a fold change of ≥ 2 or ≤ 0.05. The analysis revealed 8,952 differentially expressed genes after RSV infection. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis and hierarchical clustering were performed on these differentially expressed genes. Figure 1 Similar to previous studies, this study found a significant enrichment of hormone-related pathways and transcription factors associated with disease resistance pathways. Notably, cluster 8 primarily clustered 22 genes related to mRNA splicing, RNA splicing, and RNA binding functions. These genes have rarely been reported to be associated with plant resistance to rice stripe virus blight. To discover new disease resistance genes, this study conducted an in-depth analysis of cluster 8, specifically performing qPCR validation on these genes. Figure 2 (See Table 3). After RSV infection, the expression levels of 3 genes decreased, and 6 genes were significantly reduced. Overall, more than half of the genes were strongly induced after RSV infection. Among them, the genes with the highest induced expression levels were LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710, and LOC_Os04g02870. Therefore, further investigation is needed to determine whether these proteins play a role in RSV infection of plants.

[0096] Table 3. Trends in expression levels of different genes after RSV infection.

[0097]

[0098] Example 3: Further screening of target genes for the control of rice stripe virus

[0099] The present application further screens the target genes for preventing and treating rice stripe disease by constructing knock-out rice (Zhonghua 11) strains of LOC_Os12g38430 (OsSRR1), LOC_Os01g06290, LOC_Os03g17710 and LOC_Os04g02870 genes respectively, and observing the phenotypes of the strains in resisting rice stripe disease. Due to the limited space, the above process is described by taking LOC_Os12g38430 (OsSRR1) as an example, and the specific experimental steps are the same as those described in Example 1.

[0100] In the present embodiment, the CRISPR / Cas9 editing technology is used to knock out the target gene, and specifically, a mutation is introduced in the region shown in SEQ ID NO: 3 of the OsSRR1 gene (SEQ ID NO: 1). It should be understood that when the CRISPR / Cas9 technology is used for gene editing, only mutations in a certain sequence region can be ensured, and the mutation types (such as deletion, addition, substitution of nucleotides) occurring in the region are uncontrollable and random.

[0101] In the present embodiment, 20 mutants (OsSRR1-ko) with the OsSRR1 gene knocked out are obtained, and the mutation of each strain is different. Then, two OsSRR1 gene knockout strains (OsSRR1-ko-#1 and OsSRR1-ko-#2) with high positive rates and homozygous mutations are obtained through screening, and the specific mutations are shown in Figure 3

[0102] The sequencing results show that OsSRR1-ko-#1 lacks one base A at the target site, which means that the OsSRR1 protein terminates at the 46th amino acid site, corresponding to the sequence shown in SEQ ID NO: 5; and OsSRR1-ko-#2 lacks four bases CCCT at the target site, which causes the OsSRR1 protein to terminate at the 45th amino acid site, corresponding to the sequence shown in SEQ ID NO: 4. It should be understood that although the two protein mutants terminate at the 46th or 45th amino acid site, respectively, the sequences after the 12th or 11th amino acid residues of these protein mutants are not the same as those of the wild type ZH11 ( Figure 3 In other words, after the gene is mutated, the protein coding does not immediately terminate, but terminates after an error coding of a polypeptide. In summary, these mutations cause the activity and function of the OsSRR1 protein to be lost to different degrees. At the same time, the expression amount of the OsSRR1 gene in the mutants is detected Figure 4 ). In summary, the above experimental results show that the rice strains with the OsSRR1 gene knocked out are successfully constructed, and can be used for subsequent phenotype observation and determination of physiological indexes (including virus content). ​

[0103] Depend on Figure 5 It was found that, under normal growth conditions, compared with the control (ZH11), the leaves of OsSRR1-ko-#1 and OsSRR1-ko-#2 exhibited varying degrees of curling, with OsSRR1-ko-#2 showing more severe curling. Severe leaf curling in rice can have multiple negative impacts on rice growth and development, as well as final yield. For example, it significantly reduces photosynthetic efficiency, leading to insufficient energy and nutrient production, hindering growth and development at all stages (vegetative and reproductive growth), ultimately resulting in reduced yield and decreased rice quality. In addition, compared with the control (ZH11) and OsSRR1-ko-#1, OsSRR1-ko-#2 has a slightly shorter plant height and significantly more tillers, and the plant type is not compact enough (i.e., the plant is loose and the tillering angle is too large). These traits lead to poor ventilation and light penetration in the population, intensified light competition; it is impossible to plant densely, reducing the planting volume in a certain area; there are more ineffective tillers, resulting in serious nutrient waste; poor individual development and poor ear quality; and it increases the risk of lodging.

[0104] In terms of disease resistance, both the OsSRR1-ko-#1 and OsSRR1-ko-#2 lines showed excellent resistance to rice stripe virus compared to the control, specifically as follows: First, compared to the control, the OsSRR1 gene knockout lines were taller, had smaller lesion areas on their leaves, and had greener leaves, especially OsSRR1-ko-#1; Second, the virus content in the leaves of the OsSRR1 gene knockout lines was significantly lower. Figure 6 and Figure 7 ).

[0105] OsSRR1-ko-#1 and OsSRR1-ko-#2 strains both exhibit the phenotype of resistance to rice stripe disease, on the one hand, further verifying the disease resistance function of OsSRR1 gene, and providing a new target for preventing and treating rice stripe disease; on the other hand, the disease resistance ability of the two strains and the phenotype under normal growth conditions have certain differences, which may be caused by the inconsistent mutation forms of OsSRR1 gene / protein. Specifically, although the protein mutant in the OsSRR1-ko-#1 strain terminates early at the 46th amino acid site, it has been mutated since the 12th amino acid, while the protein mutant in the OsSRR1-ko-#2 strain is mutated after the 11th amino acid. In other words, the protein mutant of OsSRR1-ko-#1 has one more amino acid (P) aligned with the wild type OsSRR1 protein than OsSRR1-ko-#2. It is worth noting that the amino acid is proline, which plays a unique and key role in protein structure due to its special cyclic side chain structure (pyrrolidine ring), such as restricting conformation, increasing local rigidity and stability; breaking or terminating alpha-helix; promoting and stabilizing beta-turn (especially i+1 position); enhancing overall (thermal) stability by reducing non-folded state entropy; the peptide bond formed is prone to cis-trans isomerization, affecting folding kinetics and specific functional site structure, etc. Therefore, the proline at position 12 may be crucial for the conformation maintenance or function exercise (such as RNA binding and then regulating leaf shape, plant type, tillering, plant height) of OsSRR1 protein, which in turn leads to the phenotype difference between the two OsSRR1-ko knockout strains. Even if the OsSRR1-ko-#1 plant cannot produce complete OsSRR1 protein, the OsSRR1 mutant protein it generates still retains the function of regulating plant growth and development, maximally ensuring the improvement of plant disease resistance while not affecting the normal growth of the plant.

[0106] In summary, compared with OsSRR1-ko-#2, the phenotype (including plant height, leaf, plant type, and tiller number) of the OsSRR1-ko-#1 strain under normal growth conditions is closer to that of the wild type, which provides a certain guarantee for the yield of the OsSRR1-ko-#1 strain, that is, the application prospect of the OsSRR1-ko-#1 strain is greater than that of the OsSRR1-ko-#2 strain, so the OsSRR1-ko-#1 strain and the corresponding mutation mode are preferred; on the other hand, it also indicates that OsSRR1 gene not only participates in the resistance of plants to rice stripe disease, but also regulates the normal growth and development process of plants, in other words, when using OsSRR1 gene as a target gene for preventing and treating rice stripe disease, OsSRR1 protein needs to lose certain functions to improve the disease resistance of the plant; at the same time, OsSRR1 protein also needs to retain certain activity to reduce its impact on plant growth and development, so as to ensure that the plant is not only resistant to disease but also ensures yield.

[0107] In addition, the present application also respectively constructs knock-out lines of LOC_Os01g06290, LOC_Os03g17710 and LOC_Os04g02870 genes, but these lines do not show obvious disease resistance function (i.e. the traits are consistent with wild type after RSV infection), and even some lines show susceptible traits, thus OsSRR1 gene is preferred as a target for preventing and treating rice stripe disease.

[0108] The above shows and describes the basic principles and main features of the present application and the advantages of the present application, for those skilled in the art, it is obvious that the present application is not limited to the details of the above exemplary embodiments, and the present application can be realized in other specific forms without departing from the spirit or essential characteristics of the present application; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-limiting, the scope of the present application is defined by the appended claims rather than the above description, thus all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the content of the present application.

Claims

1. Use of SRR1 gene / protein mutants for preventing and controlling rice stripe disease caused by Tenuivirus rice stripe virus, characterized in that, The sequence of the SRR1 gene mutant is the nucleotide sequence shown in SEQ ID NO: 6; the sequence of the SRR1 protein mutant is the amino acid residue sequence shown in SEQ ID NO:

5.

2. Use according to claim 1, wherein The object to be controlled is a plant in the family Poaceae.

3. A mutant of the SRR1 gene, characterized in that, The sequence of the gene mutant is the nucleotide sequence shown in SEQ ID NO:

6.

4. A mutant of the SRR1 protein, characterized in that, The sequence of the protein mutant is the amino acid residue sequence shown in SEQ ID NO:

5.

5. Use of an SRR1 gene mutant or protein mutant in the preparation of an agent for resisting rice stripe disease, characterized in that, The gene mutant is as claimed in claim 3, and the protein mutant is as claimed in claim 4.

6. Application of a biological material containing the SRR1 gene mutant as claimed in claim 3 or the SRR1 protein mutant as claimed in claim 4 in breeding of rice resistant to the stripe disease.

Images