Self-replicating RNA vector, gene delivery system and application thereof

By modifying the VEEV 5'UTR structure of the self-replicating RNA vector, the problems of insufficient expression duration and efficiency of self-replicating mRNA in tumor treatment were solved, the immune response was reduced, and the effect of long-term, stable and efficient expression of the target protein in tumor cells was achieved.

CN120758535BActive Publication Date: 2026-03-31SHANGHAI CELL DIFF MEDICINE LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-09
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing self-replicating mRNAs have problems with insufficient expression duration and efficiency in tumor treatment. At the same time, their self-replication process may trigger an excessively strong immune response, leading to side effects and reduced efficacy. Existing strategies are difficult to balance safety and high efficiency.

Method used

By modifying the 5'UTR structure of Venezuelan equine encephalitis virus (VEEV), a novel self-replicating RNA vector compatible with multiple capping strategies was designed to reduce innate immune responses while maintaining efficient expression characteristics. Specifically, the 5'UTR was modified, and preferred modified sequences were screened to reduce cytotoxicity and improve protein expression.

Benefits of technology

The target protein was stably expressed in tumor cells for a long period of time, the expression levels of IFNβ1 and RIG-I were reduced, the protein expression was maintained at a high efficiency, and the IgG level was significantly increased, showing that the modified 5'UTR mutant has good expression effect and safety in vivo and in vitro.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758535B_ABST
    Figure CN120758535B_ABST
Patent Text Reader

Abstract

The application relates to the field of biological medicine, in particular to a self-replicating RNA carrier, a gene delivery system and application thereof. The 5'UTR end structure of the self-replicating RNA is optimized through a system, the innate immune response of the self-replicating RNA is regulated, the cytotoxicity is reduced while the replication characteristics are maintained, and the efficient expression characteristics are maintained, so that a new strategy for developing a low-toxicity and high-efficiency gene therapy carrier is provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a self-replicating RNA vector, a gene delivery system, and its applications. Background Technology

[0002] In the field of cancer treatment, traditional linear non-replicating mRNAs can only mediate short-term high expression of target proteins in cells, which is insufficient in terms of expression duration and efficiency. They cannot meet the requirement of long-term stable expression of target proteins in tumor cells with rapid proliferation capabilities. However, self-replicating mRNAs (saRNAs), due to their self-replication ability, can achieve the same protein expression level as traditional linear mRNAs at a lower dose and can prolong the existence time of target proteins in vivo. This feature can reduce the dosage and number of injections used in mRNA therapy for cancer applications. The advantage is that high expression of related tumor suppressor factors or cytokines in tumor cells can be achieved at low doses, thereby achieving the purpose of cancer treatment.

[0003] When saRNA is delivered into cells, it forms double-stranded RNA during its self-replication process. These double-stranded RNAs resemble replicating viral RNA, potentially triggering an innate immune response that could enhance drug efficacy. However, this immune response is a double-edged sword. While it may promote an immune response, it can also cause side effects. Furthermore, an overly strong innate immune response could suppress saRNA expression, thus hindering drug efficacy. Therefore, the immunogenicity of saRNA requires precise design and adjustment. Existing solutions (such as nucleotide modification and UTR optimization) can partially reduce immunogenicity. For example, nucleoside modification reduces mRNA immunogenicity. However, exogenous nucleotide modification cannot fundamentally solve the loss of expression efficiency because these exogenous nucleotides are not available in cells in vivo (Karikó K, et al. Immunity (2005)). The literature (Kulasegaran-Shylini et al. Virology. 2009 Apr 25;387(1):211-21) also points out that replacing A3 with G3 on the 5U of the original Venezuelan equine encephalitis virus and making point mutations on the original replication sequence element NSP2 can improve the toxicity of the virus to cells and further enhance the expression of the target protein.

[0004] In addition, several existing patents involve RNA replicons. For example, CN116096409A discloses an RNA replicon that encodes a stable SARS-CoV-2 spike protein, containing elements such as the alphavirus 5'UTR, non-structural genes, subgenomic promoters, and 3'UTR, capable of inducing a certain immune response. However, the IgG level of the cited drug only reached a maximum of 10^3.96 on day 42. US2021290756A1 also discloses an RNA molecule containing the alphavirus 5'UTR sequence, possessing cap structures (Cap1, Cap0, etc.) and used in vaccine applications, but it is not a self-replicating structure that balances safety and efficacy. To expand the potential application prospects of self-replicating RNA constructed from alphavirus self-replicating vectors in tumor drugs or vaccines, it is necessary to ensure high efficiency while further ensuring safety.

[0005] In summary, self-replicating RNA technology has shown great promise in fields such as vaccines and cancer treatment. Existing literature and patents mainly focus on the application of alphavirus-derived RNA replicons and different capping methods, but there are currently no reports on novel self-replicating RNA vectors, gene delivery systems, and their applications that can be compatible with multiple capping strategies and reduce innate immune responses. Summary of the Invention

[0006] This invention differs from previous applications based solely on alphavirus-derived RNA replicons and different capping methods. By modifying the structure of the VEEV TC-83 5'UTR, this invention provides a novel self-replicating RNA vector that is compatible with multiple capping strategies and reduces innate immune responses. While maintaining the replication properties of saRNA, it reduces saRNA cytotoxicity and maintains highly efficient expression characteristics.

[0007] This invention is mainly based on the alphavirus (VEEV) backbone (GenBank: L01443.1, its nucleotide sequence is shown in SEQ ID NO. 16) viral saRNA sequence, and modifies the 5'UTR to achieve a balance between cytotoxicity and expression efficiency. The modified 5'UTR sequence of this invention is shown in the following general formula:

[0008] [ (N1) x (N2) y ] z (N3) w ataggcggcgcatgagagaagcccagaccaattacctacccaaa,

[0009] The research of this invention involves two stages. The first stage involves designing a lead sequence—that is, different 5'UTR modifications—and synthesizing the corresponding saRNAs. Then, the expression levels of these saRNAs in cells are verified, thereby initially screening out the preferred modified saRNAs and further verifying the modification effect.

[0010] In the general formula for 5'UTR design of the lead sequence: N1=A, x=0 or 1; N2=G, y=1; z=1-5; N3=A or G, w=0-5. Following the general formula, the following 5'UTR sequences were designed and the corresponding saRNAs were synthesized. Protein expression levels (HNF4a protein) were then detected in cells to preliminarily evaluate the protein expression levels of the sequence-modified saRNAs in cells. Seq lead-1 is the wild-type VEEV backbone 5'UTR, and Seq lead-2 to Seq lead-13 are 5'UTR mutants. The saRNAs contained in Seq lead-1 to Seq lead-6 sequences were synthesized using a vaccinia virus capping enzyme method, while Seq lead-7 to Seq lead-13 sequences were synthesized using a one-step co-transcriptional capping method. The modified sequences of this invention are shown in Table 1 below:

[0011] Table 1: 5'UTR sequence list

[0012]

[0013] After evaluating the expression levels of self-replicating RNA based on the above sequences, the following preferred 5'UTR sequences were screened (see Table 2). Then, saRNAs carrying different target genes were synthesized to further evaluate cytotoxicity, expression levels of target proteins in in vitro cells, and in vivo drug efficacy, in order to confirm the efficacy of the modified RNA.

[0014] Table 2: 5'UTR sequence list

[0015]

[0016] In a first aspect, the present invention provides an saRNA vector comprising a 5' untranslated region (5'UTR) of Nsp1-Nsp4 nonstructural protein genes, a target gene, a 3' untranslated region (3'UTR), and a polyA tail, wherein the sequence of the 5' untranslated region is shown in the following general formula:

[0017] [ (N1) x (N2) y ] z (N3) w ataggcggcgcatgagagaagcccagaccaattacctacccaaa,

[0018] Where N1=A, x=0 or 1; N2=G, y=1; z=1-5; N3=A or G, w=0-5; and when x=0, z=2-5.

[0019] Preferably, in the 5' end non-coding region sequence, N1=A, x=1; N2=G, y=1; z=1-3, N3=A or G, w=0-5.

[0020] Preferably, in the 5' end non-coding region sequence, N1=A, x=0; N2=G, y=1; z=2 or 3, w=0.

[0021] Preferably, the 5' uncoded region has a sequence selected from the group consisting of:

[0022] The nucleotide sequence shown in any one of SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 or its complementary sequence;

[0023] Or a nucleotide sequence that has at least 80% homology with the nucleotide sequence shown in any one of SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 or its complementary sequence;

[0024] Or a nucleotide sequence that has at least 85% homology with the nucleotide sequence shown in any one of SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 or its complementary sequence;

[0025] Or a nucleotide sequence that has at least 90% homology with the nucleotide sequence shown in any one of SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 or its complementary sequence.

[0026] More preferably, the 5' end non-coding region sequence is composed as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0027] More preferably, the 5' end non-coding region sequence is composed as shown in SEQ ID NO.7 to SEQ ID NO.9.

[0028] More preferably, the 5' end non-coding region sequence is composed as shown in SEQ ID NO.12 and SEQ ID NO.13.

[0029] Preferably, the self-replicating RNA vector further includes a 5' cap, a non-structural gene, a 26S subunit promoter, a 3' uncoding region (3'UTR), and a polyadenylated tail.

[0030] Preferably, the self-replicating RNA is based on an engineered alphavirus genome.

[0031] More preferably, the self-replicating RNA is based on the VEEA genome.

[0032] In a preferred embodiment of the present invention, the nucleotide sequence of the self-replicating RNA vector is shown in SEQ ID NO.17-32.

[0033] In a second aspect, the present invention provides a gene delivery system comprising a self-replicating RNA vector and a delivery medium as described above, wherein the target gene expresses mammalian cell protein, viral protein, bacterial protein, fungal protein, protozoan protein, or parasitic protein.

[0034] Preferably, the mammalian cell protein is a nucleoprotein.

[0035] Preferably, the nuclear protein is a transcription factor. More preferably, the transcription factor is HNF4α.

[0036] Preferably, the viral protein is a coronavirus protein. More preferably, the coronavirus protein is RBD.

[0037] Preferably, the delivery medium is lipid-based nanoparticles (LNPs).

[0038] Preferably, the lipids include:

[0039] 1,2-Distearate-sn-glycerophosphate choline, molar ratio 5%-20%;

[0040] Cholesterol, molar ratio 30%-55%;

[0041] 1,2-Diosynyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000, molar ratio 0.5%-3%;

[0042] Ionizable lipids, molar ratio 30%-60%.

[0043] Preferably, the N:P ratio in the lipid-based nanoparticles ranges from 5:1 to 10:1, and the particle size of the nanoparticles is 40-300 nm.

[0044] More preferably, the lipid-based nanoparticles (LNPs) comprise ionizable lipids (Sinobonger, ALC-0315), 1,2-distearate-sn-glycerophosphate choline (DSPC) (Avanti, 850365P), cholesterol (Sigma-Aldrich, C8667), and 1,2-dicylo-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (NOF, GM020).

[0045] A third aspect of the present invention provides the use of the self-replicating RNA vector or gene delivery system as described above in the preparation of a drug or vaccine for treating tumors.

[0046] Preferably, the tumor is liver cancer, pancreatic cancer, intestinal cancer, or stomach cancer.

[0047] Preferably, the vaccine is a novel coronavirus vaccine.

[0048] In a fourth aspect, the present invention provides a pharmaceutical composition comprising a self-replicating RNA vector as described above, or a gene delivery system as described above.

[0049] The advantages of this invention are:

[0050] Unlike previous applications based solely on alphavirus-derived RNA replicons and different capping methods, this invention modifies the structure of the VEEV TC-83 5'UTR to provide a novel self-replicating RNA vector that is compatible with multiple capping strategies and reduces innate immune responses. While maintaining the replication properties of saRNA, it reduces saRNA cytotoxicity and maintains efficient expression characteristics. Based on the Venezuelan equine encephalitis virus (VEEV) backbone, seven 5'UTR mutants (SEQ ID NO. 3, 4, 7, 8, 9, 12, 13) were designed, and two different target proteins were synthesized and subjected to corresponding detection. Compared with the original structure (CN116096409A / SEQ ID NO.1), the 5'UTR mutant can reduce the expression levels of IFNβ1 and RIG-I of the target protein HNF4α by 40-60% (SEQ ID NO. 3, 4, 7, 8, P < 0.01), while maintaining the long-term expression of HNF-4α protein. WB data 3 days after transfection showed that the optimized structure can maintain the high level of expression of the target protein, indicating that the 5'UTR mutant can maintain the replication characteristics of saRNA, reduce the cytotoxicity of saRNA, and maintain the high efficiency of expression. The saRNA for the target protein RBD reduced the expression levels of IFNβ1 and RIG-I (SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 decreased to 20-40% of SEQ ID NO. 1, P < 0.01), while maintaining high-efficiency expression of RBD protein. This indicates that the 5'UTR mutant can reduce the innate immune response. After immunizing mice with the modified 5'UTR saRNA, IgG levels were significantly increased (IgG titers on day 42 exceeded 10^5, while the highest IgG level on day 42 for the drug cited in CN116096409A was only 10^3.96). Moreover, RNA structure prediction (mfold) also showed that the 5'UTR of SEQ ID NO. 3 formed a stable hairpin structure (ΔG = -12.3 kcal / mol), which may have masked the immune recognition motif. In vivo experiments showed that intratumoral injection of SEQ ID NO. 3, 4, 7, 8 HNF4α-saRNA-LNP (target protein HNF4α) had a higher tumor inhibition rate against transplanted hepatocellular carcinoma cells in mice than SEQ ID NO. 1, and intramuscular injection increased the negative-strand RNA copy number, indicating a longer-lasting expression. Similarly, intramuscular injection of SEQ ID NO. 3, 4, 7, 8, 9, 12, 13 RBD-saRNA-LNP (target protein RBD) produced enzyme-labeled specific binding antibodies (original RBD strain) with higher titers than SEQ ID NO. 1, and intramuscular injection in mice showed an increase in the negative-strand RNA copy number, indicating a longer-lasting expression. This is also related to the results of producing higher-titer IgG binding antibodies in the animals.

[0051] In summary, this invention modifies the 5'UTR by inserting an insertion into the G-rich region of the 5'UTR, which can regulate the innate immune response of saRNA, providing a new strategy for developing low-toxicity and highly efficient gene therapy vectors. Attached Figure Description

[0052] Figure 1 Schematic diagram of saRNA plasmid structure.

[0053] Figure 2 Agarose gel electrophoresis image of HNF4α-saRNA transcribed in vitro from different 5'UTRs in lead1-13.

[0054] Figure 3 The protein expression level of HNF-4α after transfection of cells with HNF-4α-saRNA of Seq lead 1~13 (Day 1).

[0055] Figure 4 Seq1-8 different 5'UTR HNF4α-saRNA in vitro transcribed into agarose gel electrophoresis image.

[0056] Figure 5 Seq1-8 different 5'UTRs transcribed into RBD-saRNA in vitro and then electrophoresed on an agarose gel.

[0057] Figure 6 Protein expression levels of HNF-4α after transfection of cells with HNF-4α-saRNA-LNP of the Seq1-8 structure (Day 1 and Day 3).

[0058] Figure 7 Protein expression levels of RBD after transfection of cells with Seq1-8 structured RBD-saRNA-LNP (Day 1 and Day 3).

[0059] Figure 8 Microscopic images of cells after transfection with HNF-4α-saRNA-LNP of Seq1-8 structure (Day 1 and Day 3).

[0060] Figure 9 Microscopic images of cells after transfection with Seq1-8 structured RBD-saRNA-LNP (Day 1 and Day 3).

[0061] Figure 10 Inflammatory factors after transfection of cells with 5'UTR HNF4α-saRNA-LNP (293T cells).

[0062] Figure 115'UTR RBD-saRNA transfection of cells with inflammatory factors (293T cells).

[0063] Figure 12 The positive-sense genome copy number in muscle of HNF4α-saRNA-LNP with different 5'UTR structures.

[0064] Figure 13 The positive-strand genome copy number in muscle of RBD-saRNA-LNPs with different 5'UTR structures.

[0065] Figure 14 Negative-strand genome copy number in muscle of HNF4α-saRNA-LNPs with different 5'UTR structures.

[0066] Figure 15 Negative-strand genome copy number in muscle of RBD-saRNA-LNPs with different 5'UTR structures.

[0067] Figure 16 Growth curves of subcutaneous tumors implanted in mice with HNF4α-saRNA-LNPs of different 5'UTR structures.

[0068] Figure 17 Intratumoral injection of HNF4α-saRNA-LNP with different 5'UTR structures into subcutaneous tumors (D5 tumor weight) in mice.

[0069] Figure 18 . ELISA detection of IgG antibodies in the serum of mice immunized with RBD-saRNA-LNP. Detailed Implementation

[0070] The specific embodiments provided by the present invention will be described in detail below with reference to examples. The advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0071] Unless otherwise described, embodiments of the present invention will employ conventional techniques of molecular biology, cell biology, and immunology, all of which are known to those skilled in the art. These techniques are fully described in the following literature: for example, *Molecular Cloning: A Laboratory Manual*, 4th edition (2017); *A Concise Laboratory Manual of Cell Biology* (2007); *A Concise Laboratory Manual of Immunology* (2010). Alternatively, the instructions provided by the reagent manufacturer may be followed.

[0072] Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0073] Example:

[0074] I. Experimental Methods:

[0075] Initial screening of lead sequences (Seq lead1-13) confirmed the protein expression levels of saRNAs with different structures in cells.

[0076] 1. Plasmid construction of saRNAs with different 5'UTR structures (Seq lead1-13):

[0077] The saRNA backbone is derived from an engineered alphavirus (VEEV) genome, containing genes encoding non-structural proteins capable of RNA replication. The structural protein sequences are replaced by target gene (GOI) sequences. The saRNA sequence structure includes a 5' cap, a 5' UTR, four non-structural genes (NSP1-4), a 26S subunit promoter, and target gene (GOI) sequences HNF4α, a 3' UTR, and a polyadenylated tail. The original plasmid sequence was synthesized by an external company. Using a point mutation kit (Yisheng, 11003ES10), different 5' UTR saRNAs were constructed from the original plasmid through point mutation. These plasmids were then transformed into DH5α competent cells (Yisheng, 11802ES80). After successful sequencing, the cells were preserved for subsequent testing.

[0078] The HNF4α, GENBANK No.: NM_000457.6, has the nucleotide sequence shown in Seq-9 (SEQ ID NO.14).

[0079] 2. Preparation of saRNAs with different 5'UTR structures:

[0080] The preparation of saRNA began with a linear template. To prepare a linear template for saRNA transcription, plasmid DNA was restriction-digested with BspQI enzyme (New England Biolabs, R0712L) and purified using a PureLink® PCR purification kit (Invitrogen, K310002). A mixture of T7 RNA polymerase (Promega, P1300), 1000 U / ml RNase inhibitor (New England Biolabs, M0314L), 2 U / ml inorganic pyrophosphatase (New England Biolabs, M2403L), 5 mM NTPs (New England Biolabs, N0466S), and a cap analog (Shenji, 5011) was prepared for transcription. The mixture was incubated at 37°C for 2 hours for in vitro transcription of the template. After transcription, DNase I (1 U / μg DNA) was added and incubated at 37°C for 30 minutes to remove the DNA template. The transcribed RNA was then purified and recovered using LiCl precipitation. Seq leads 1-6 were prepared using a two-step capping reaction with vaccinia virus capping enzymes. Seq leads 7-13 used a one-step capping method with co-transcription of cap analogs to prepare saRNA. This yielded the saRNA (target protein HNF4α) from Seq leads 1-13:

[0081] 3. Detection of target protein expression after transfection of cells with saRNAs of different 5'UTR structures using transfection reagents:

[0082] Huh7 liver cancer cells were treated at a rate of 3×10 5 Cells were seeded into 6-well plates and cultured overnight. Different 5'UTR saRNAs diluted with Opti-MEM were added and mixed with lipo-3000 (Thermo) transfection reagent. After 6 hours of culture, 1 mL of DMEM medium containing 20% ​​FBS was added. On day 1, transfected cells were lysed using RIPA lysate to extract proteins, and intracellular HNF4α protein expression levels were detected by Western blot.

[0083] 4. Through pilot experiments, Seq2-8 were selected (see Table 2) for further evaluation of cytotoxicity, target protein expression levels in vitro and in vivo to confirm the effectiveness of the remodeling. Plasmids with different 5'UTR structures and carrying two target genes were constructed as follows:

[0084] The saRNA backbone is derived from an engineered alphavirus (VEEV) genome, containing genes encoding non-structural proteins that enable RNA replication. The structural protein sequences are replaced by target gene (GOI) sequences. The saRNA sequence structure includes a 5' cap, a 5' UTR, four non-structural genes (NSP1-4), a 26S subunit promoter, and the target genes (GOIs) are HNF4α, the original SARS-CoV-2 strain RBD, a 3' UTR, and a polyadenylated tail. The original plasmid sequence was synthesized by an external company. A point mutation kit (Yisheng, 11003ES10) was used to construct plasmids with different 5'UTR saRNAs on the original plasmid via point mutation. These plasmids were then transformed into DH5-a competent cells (Yisheng, 11802ES80) to synthesize different target gene sequences. Molecular cloning was performed using the restriction endonucleases ApaI and NotI. T4 ligase was used to ligate different target gene fragments into vectors containing different 5'UTR saRNAs. These were then transformed into DH5-a competent cells (Yisheng, 11802ES80). After successful sequencing, the cells were preserved for subsequent testing.

[0085] The HNF4α, GENBANK No.: NM_000457.6, has the nucleotide sequence shown in SEQ ID NO.14.

[0086] The RBD, GENBANK number: OP896053.1, has the nucleotide sequence shown in SEQ ID NO. 15.

[0087] 5. Preparation of saRNAs with different 5'UTR structures:

[0088] The preparation of saRNA began with a linear template. To prepare a linear template for saRNA transcription, plasmid DNA was restriction-digested with BspQI enzyme (New England Biolabs, R0712L) and purified using a PureLink® PCR purification kit (Invitrogen, K310002). A mixture of T7 RNA polymerase (Promega, P1300), 1000 U / ml RNase inhibitor (New England Biolabs, M0314L), 2 U / ml inorganic pyrophosphatase (New England Biolabs, M2403L), 5 mM NTPs (New England Biolabs, N0466S), and a cap analog (Shenji, 5011) was prepared for transcription. The mixture was incubated at 37°C for 2 hours for in vitro transcription of the template. After transcription, DNase I (1 U / μg DNA) was added and incubated at 37°C for 30 minutes to remove the DNA template. The transcribed RNA was then purified and recovered using LiCl precipitation. Seq-1, Seq-2, and Seq-3 were prepared using a two-step capping reaction with vaccinia virus capping enzymes. Seq-4, Seq-5, Seq-6, Seq-7, and Seq-8 were prepared using a one-step capping method with cap analog co-transcription. This yielded saRNAs (target protein HNF4α) for Seq-1 to Seq-8, as well as saRNAs (target protein RBD of the original SARS-CoV-2 strain) for Seq-1 to Seq-8.

[0089] Seq-12: HNF4αsaRNA sequence of Seq-1 5'UTR (SEQ ID NO. 17)

[0090] The HNF4αsaRNA sequence of Seq-13:Seq-2 5'UTR (SEQ ID NO. 18)

[0091] Seq-14: HNF4αsaRNA sequence of Seq-3 5'UTR (SEQ ID NO. 19)

[0092] The HNF4αsaRNA sequence of Seq-15: Seq-4 5'UTR (SEQ ID NO. 20)

[0093] The HNF4αsaRNA sequence of Seq-16: Seq-5 5'UTR (SEQ ID NO. 21)

[0094] The HNF4αsaRNA sequence of Seq-17: Seq-6 5'UTR (SEQ ID NO. 22)

[0095] The HNF4αsaRNA sequence of Seq-18: Seq-7 5'UTR (SEQ ID NO. 23)

[0096] The HNF4αsaRNA sequence of Seq-19: Seq-8 5'UTR (SEQ ID NO. 24)

[0097] Seq-20: RBD saRNA sequence of Seq-1 5'UTR (SEQ ID NO. 25)

[0098] Seq-21: The RBD saRNA sequence of the 5'UTR of Seq-2 (SEQ ID NO. 26)

[0099] Seq-22: RBD saRNA sequence of Seq-3 5'UTR (SEQ ID NO. 27)

[0100] Seq-23: RBD saRNA sequence of Seq-4 5'UTR (SEQ ID NO. 28)

[0101] Seq-24: Seq-5 5'UTR RBD saRNA sequence (SEQ ID NO. 29)

[0102] The RBD saRNA sequence of Seq-25: Seq-6 5'UTR (SEQ ID NO. 30)

[0103] The RBD saRNA sequence of Seq-26: Seq-7 5'UTR (SEQ ID NO. 31)

[0104] The RBD saRNA sequence of Seq-27: Seq-8 5'UTR (SEQ ID NO. 32).

[0105] 6. LNPs encapsulate saRNAs with different 5'UTR structures:

[0106] The lipid nanoparticles were synthesized and encapsulated via rapid mixing of an ethanol phase and an aqueous phase in a microfluidic device (nano-micro). The aqueous phase was a 50 mM citrate buffer (pH 5.5) containing purified saRNA. The ethanol phase contained ionizable lipids (Sinobond, ALC-0315), 1,2-distearate-sn-glycerophosphocholine (DSPC) (Avanti, 850365P), cholesterol (Sigma-Aldrich, C8667), and 1,2-dicyloyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DMG-PEG 2000) (NOF, GM020). The mRNA-LNPs were assembled in a molar ratio of 9.4:42.5:1.8:46.3 (DSPC:cholesterol:DMG-PEG 2000:ALC-0315), N / P=6. The particle size, PDI, saRNA concentration, and encapsulation efficiency of the saRNA-LNP formed by this formulation were measured.

[0107] 7. Detection of target protein expression and cell status examination after transfection of cells with saRNA-LNPs of different 5'UTR structures:

[0108] Huh7 liver cancer cells were treated at a rate of 3×10 5 Cells were seeded into 6-well plates and cultured overnight. Different 5'UTRs of saRNA-LNP diluted with Opti-MEM were added. After 6 hours of culture, 1 mL of DMEM medium containing 20% ​​FBS was added. Transfected cells were lysed using RIPA lysate on days 1 and 3 to extract proteins. Western blot analysis was used to detect intracellular RBD or HNF4α protein expression levels. Cell status was observed by photographing on days 1 and 3 after saRNA transfection.

[0109] 8. Detection of changes in inflammatory factor levels after transfection of cells with saRNA-LNPs of different 5'UTR structures:

[0110] 293T cells were fed at a rate of 3 × 10 5 Cells were seeded into 6-well plates and cultured overnight. Cells were washed with PBS and saRNA-LNPs of different 5'UTRs diluted with Opti-MEM were added. After 6 hours of culture, 1 mL of DMEM medium containing 20% ​​FBS was added. Cells were harvested 24 hours after transfection, and RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). The RNA was reverse transcribed into cDNA, and quantitative PCR was used to detect the expression of innate immune response-related genes IFNβ1 and RIG-I.

[0111] The qPCR primers are as follows:

[0112] GAPDH-F primer: 5'-GCACCGTCAAGGCTGAGAAC-3' (SEQ ID NO.33)

[0113] GAPDH-R primer: 5'-GCCTTCTCCATGGTGGTGAA-3' (SEQ ID NO.34)

[0114] IFNβ1-F primer: 5'-GCTTGGATTCCTACAAAGAAGCA-3' (SEQ ID NO.35)

[0115] IFNβ1-R primer: 5'-ATAGATGGTCAATGCGGCGTC-3' (SEQ ID NO.36)

[0116] RIG-IF primer: 5'-TGGCATATTGACTGGACGTG-3' (SEQ ID NO.37)

[0117] RIG-IR primer: 5'-AGGATGACAAGATTGCACTG-3' (SEQ ID NO.38)

[0118] 9. After intramuscular injection of saRNA-LNPs with different 5'UTR structures into mice, tissue samples were taken from the injection site to detect the self-replicating RNA replication efficiency:

[0119] During replication, saRNA uses the positive-strand genome as a template to replicate the negative-strand genome, and then uses the negative-strand genome as a template to replicate a new positive-strand genome. If the presence of the negative-strand genome can be detected, it can be proven that srRNA is continuously replicating, thus maintaining the continuous existence of srRNA.

[0120] Experiment 1: SaRNA-LNPs (SEQ ID NO. 17-21, target protein HNF4α) with different 5'UTR structures (Seq-1~Seq-5 in Table 2) were injected into mice and the translation and replication efficiency of self-replicating RNA in vivo was detected: A total of 45 C57BL / 6 mice were divided into 5 groups of 9 mice each; each mouse was injected with 3 μg of saRNA-LNPs of Seq1~5 on day 0.

[0121] Experiment 2: SaRNA-LNPs (SEQ ID NO. 25-32, target protein novel coronavirus original strain RBD) with different 5'UTR structures (Seq-1~Seq-8 in Table 2) were injected into mice and the translation and replication efficiency of self-replicating RNA in vivo was detected: A total of 72 C57BL / 6 mice were divided into 8 groups of 9 mice each; each mouse was injected with 3 μg of saRNA-LNPs of Seq1~8 on day 0.

[0122] On days 1, 3, and 7 post-injection, muscle tissue from the injection site of mice was collected. After tissue homogenization, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). RNA was then reverse transcribed. Two sets of reverse transcription were performed on each sample: one set used SRT as the reverse transcription primer to obtain cDNA of the positive strand of srRNA from the total RNA; the other set used ART as the reverse transcription primer to obtain cDNA of the negative strand of srRNA from the total RNA. Quantitative PCR was then used to detect the copy number of saRNA after reverse transcription into cDNA.

[0123] The reverse transcription primers are as follows:

[0124] Positive-strand specific primer (SRT): 5'-TACTGCCTTGCACAGCTC-3' (SEQ ID NO.39)

[0125] Negative-strand specific primer (ART): 5'-CAGGTCACTGATAATGACC-3' (SEQ ID NO.40)

[0126] 10. Tumor inhibition experiment in mice by intratumoral injection of HNF4α-saRNA-LNP (target protein HNF4α) with different 5'UTR structures via subcutaneous implantation:

[0127] To evaluate the in vivo efficacy of saRNA-LNPs with different 5'UTR structures (Seq-1~Seq-5 in Table 2), animal experiments were conducted using intratumoral injection of five saRNA-LNPs expressing the target protein HNF4α (Seq-12~Seq-16, SEQ ID NO. 17-21) into nude mice for subcutaneous implantation of liver tumors (Huh7). Animals were 6-8 week old male nude mice (BALB / c immunodeficient strain), purchased from Shanghai BK / KY Biotechnology Co., Ltd., and housed under specific pathogen-free environmental conditions using a 12-hour on / off light cycle. 1×10 6 Huh-7 cells were subcutaneously injected into the right axilla of male nude mice. The tumor size was measured in two dimensions using calipers, and the volume was calculated using the following formula: Volume = Length × (Width) 2× 1 / 2. When the average tumor volume reaches approximately 100 mm. 3 Mice were randomly divided into 6 groups (n=6 per group). The administration dose was 10 μg / 100 μL saRNA LNP (Seq1–5) and 100 μL physiological saline (solvent control). Tumor volume was measured before administration (D0) and on D1, D2, and D4 after administration, and tumor growth curves were plotted. On day 5 post-injection, mice were sacrificed, and tumors were excised and weighed. Tumor inhibition rate was calculated.

[0128] 11. Study on humoral immune response in mice injected with RBD-saRNA-LNP (target protein RBD of the original novel coronavirus strain) containing different 5'UTR structures:

[0129] To evaluate the in vivo effects of saRNA-LNPs (Seq-20~Seq-27, SEQ ID NO. 25-32) with different 5'UTR structures (Seq-1~Seq-8 in Table 2), animal experiments were conducted using intramuscular injection of eight saRNA-LNPs expressing the target protein RBD into BALB / c mice. Six- to eight-week-old female BALB / c mice were purchased from Shanghai BK / KY Biotechnology Co., Ltd., and housed under specific pathogen-free environmental conditions using a 12-hour on / off light cycle. After acclimatization, mice were intramuscularly injected with 5 μg / 100 μL saRNA LNP and 100 μL physiological saline (solvent control). The immunization interval was 35 days, with two administrations. Blood samples were collected 7 days after the last administration, and serum samples were processed. The level of IgG antibodies produced in mice after immunization was detected using ELISA.

[0130] II. Experimental Results:

[0131] Initial screening of lead sequences (Seq lead1-13) confirmed the protein expression levels of self-replicating RNAs with different 5U structures in cells.

[0132] 1. The self-replicating RNA plasmid structure used in this embodiment is as follows: Figure 1 As shown, it contains 5'Cap, 5'UTR non-structural proteins 1-4 (NSP 1-4), a subgenomic promoter (sgp), a foreign gene insertion region (GOI), a 3'UTR, and a polyadenylated tail. This invention utilizes saRNA expression of hepatocyte nuclear factor HNF4α as a lead model to evaluate the in vitro protein expression of self-replicating RNA with different 5'UTRs. Different 5'UTR sequences were constructed into plasmids through point mutation. After successful sequencing, plasmid amplification was performed. Glycerol bacteria were inoculated at a 1:1000 ratio into the culture medium and cultured overnight at 37°C. Plasmids meeting the required specifications were extracted using a plasmid extraction kit.

[0133] 2. Preparation of self-replicating RNA:

[0134] The plasmid was linearized using BspQI restriction endonuclease according to the recommended system. The linearized template was recovered using a PCR purification kit, and saRNA was synthesized in vitro via transcription. The quality of the synthesized saRNA was assessed by agarose gel electrophoresis. The results are shown below. Figure 2 The synthesized self-replicating RNA bands were of the correct size, and the purity of the 13 different 5'UTR saRNAs was similar, all meeting the requirements for subsequent experiments.

[0135] 3. Detection of protein expression in cells transfected with 5'UTR saRNA of different structures:

[0136] Huh-7 hepatocellular carcinoma cells were transfected with Seq lead1-13 HNF4α-saRNA using a transfection reagent. Protein samples were collected using RIPA lysis buffer on day 1, and intracellular HNF4α protein levels were detected by Western blot. Figure 3 Compared to the original self-replicating RNA sequence vectors, the HNF4α-saRNA target protein expression levels of Seq lead 3, 4, 7, 8, 9, 12, and 13 structures were higher. Therefore, these sequence vectors were selected and renamed Seq2-8 (Table 2).

[0137] The optimized Seq2-8 further confirmed the safety and effectiveness of the self-replicating RNA of the modified UTR.

[0138] 4. The self-replicating RNA plasmid structure used in this embodiment is as follows: Figure 1 As shown, it contains 5'Cap, 5'UTR non-structural proteins 1-4 (NSP 1-4), a subgenomic promoter (sgp), a foreign gene insertion region (GOI), a 3'UTR, and a polyadenylated tail. This invention uses saRNA expressing hepatocyte nuclear factor HNF4α and the RBD of the original novel coronavirus strain as models to evaluate self-replicating RNAs with different 5'UTRs. Different 5'UTR sequences were constructed into plasmids through point mutation. After correct sequencing, plasmid amplification was performed. Glycerol bacteria were inoculated 1:1000 into the culture medium and cultured overnight at 37°C. Plasmids meeting the requirements were extracted using a plasmid extraction kit.

[0139] 5. Preparation of self-replicating RNA:

[0140] The plasmid was linearized using BspQI restriction endonuclease according to the recommended system. The linearized template was recovered using a PCR purification kit, and saRNA was synthesized in vitro via transcription. The quality of the synthesized saRNA was assessed by agarose gel electrophoresis. The results are shown below. Figure 4 , Figure 5The synthesized self-replicating RNA bands were of the correct size, and the purity of the saRNAs from the eight different 5'UTRs of the two GOIs was close, all meeting the requirements for subsequent experiments.

[0141] 6. LNPs encapsulate saRNAs with different 5'UTR structures:

[0142] The saRNA was mixed with liposome solution using a microfluidic device. The sRNA-LNPs were assembled using a molar ratio of 9.4:42.5:1.8:46.3 (DSPC:cholesterol:DMG-PEG 2000:LP-1), N / P=6. After synthesizing lipid nanoparticles, the encapsulation solution was replaced with the formulation buffer by dialysis (100kD). After dialysis, the LNPs were characterized. The encapsulation rate and RNA concentration of LNPs were detected using Ribogreen, and the particle size and PDI (dispersion index) of LNPs were detected using a nanoparticle size analyzer (DLS principle). The results are shown in Tables 3 and 4. All eight saRNAs from the two GOIs prepared could form lipid nanoparticles that met the requirements. The particle size after dialysis was 60-70nm, PDI<0.3, concentration was 100±10%, and encapsulation rate was >95%, which met the requirements for subsequent cell and animal evaluations. The consistency of the drug was good.

[0143] Table 3. Particle size, PDI, concentration, and encapsulation efficiency of HNF4α-saRNA-LNP with different 5'UTRs after dialysis in Seq12-19.

[0144]

[0145] Table 4. Particle size, PDI, concentration, and encapsulation efficiency of different 5'UTR RBD-saRNA-LNPs after dialysis in Seq20-27

[0146]

[0147] 7. Detection of protein expression and observation of cell state after transfection of cells with different 5'UTR saRNA-LNP structures:

[0148] Huh-7 hepatocellular carcinoma cells were transfected with Seq1-8 HNF4α-saRNA-LNP (Seq12-19) on days 1 and 3 using RIPA lysis buffer. Intracellular HNF4α protein levels were detected by Western blot. Figure 6 As can be seen, the expression level of the target protein HNF4α-saRNA-LNP (Seq13-19) with the Seq2-8 structure is relatively high, and it still has a high expression level at D3, indicating that the protein expression is maintained for a long time. Morphological observation of cells transfected with different HNF4α-saRNA-LNPs before sample collection ( Figure 8 It was observed that cells exhibited extensive apoptosis on the third day after transfection with Seq1 HNF4α-saRNA-LNP, indicating stronger cytotoxicity. Transfection with other structures showed weaker cytotoxicity. This result showed a certain correlation with the HNF4α protein expression level.

[0149] Huh-7 hepatocellular carcinoma cells were transfected with Seq1-8 RBD-saRNA-LNP (Seq20-27) on days 1 and 3 using RIPA lysis buffer. Western blot analysis was used to detect intracellular RBD protein levels. Figure 7 As can be seen, the target protein expression levels of RBD-saRNA-LNPs (Seq21-27) in Seq2-8 structures were high, and they still maintained high expression at D3, indicating a long duration of protein expression maintenance. Morphological observation of cells transfected with different RBD-saRNA-LNPs before sample collection... Figure 9 It was observed that cells underwent extensive apoptosis on the third day after transfection with Seq-1 RBD-saRNA-LNP, indicating stronger cytotoxicity. Transfection with other structures showed weaker cytotoxicity. This result showed a certain correlation with the protein expression level of RBD.

[0150] 8. Results of detecting changes in inflammatory factor levels after transfection of cells with different 5'UTR saRNA-LNP structures:

[0151] Cells were transfected with HNF4α-saRNA-LNP (Seq12-19, target protein HNF4α) for 24 hours. RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50), reverse transcribed into cDNA, and then quantitatively PCR was performed to detect the levels of innate immune response-related genes IFNβ1 and RIG-I. Each sample was tested in triplicate. Results are shown below. Figure 10 The results show that Seq-1 HNF4α-saRNA-LNP transfection of cells elicits a higher innate immune response, while the levels of inflammatory factors induced by Seq2~Seq8 are lower.

[0152] Cells were transfected with RBD-saRNA-LNP (Seq20-27, target protein RBD) for 24 hours. RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50), reverse transcribed into cDNA, and then quantitatively PCR was performed to detect the levels of innate immune response-related genes IFNβ1 and RIG-I. Each sample was tested in triplicate. Results are shown below. Figure 11The results show that Seq-1 RBD-saRNA-LNP transfection of cells elicits a higher innate immune response, while the levels of inflammatory factors induced by Seq2~Seq8 are lower.

[0153] 9. After intramuscular injection of saRNA-LNPs with different 5'UTR structures into mice, tissue samples were taken from the injection site to detect the self-replicating RNA replication efficiency:

[0154] Forty-five C57BL / 6 mice were divided into five groups of nine each. Each mouse was injected with 3 μg of saRNA-LNP (Seq12-16, target protein HNF4α) from Seq1 to Seq5. Muscle tissue was collected from the injection site on days 1, 3, and 7 post-injection. After tissue homogenization, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). Reverse transcription was performed on the RNA. Two sets of reverse transcription were performed on each sample: one set used SRT as the reverse transcription primer to obtain cDNA of the positive strand of srRNA from the total RNA; the other set used ART as the reverse transcription primer to obtain cDNA of the negative strand of srRNA from the total RNA. Quantitative PCR was used to detect the saRNA genome copy number after reverse transcription to cDNA. The results for positive and negative strand copy numbers are shown below. Figure 12 , Figure 14 The saRNA was injected into mice via intramuscular injection, and the level of negative-stranded genome at the injection site was detected. The saRNAs from Seq2 to Seq5 showed higher levels of negative-stranded genome on days 3 and 5, indicating that these saRNAs have better replication persistence than the original Seq-1 sequence.

[0155] A total of 72 C57BL / 6 mice were divided into 8 groups of 9 mice each. Each mouse was injected with 3 μg of saRNA-LNP (Seq20-27, target protein RBD) from Seq1 to Seq8. Muscle tissue was collected from the injection site on days 1, 3, and 7 post-injection. After tissue homogenization, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). Reverse transcription was performed on the RNA. Two sets of reverse transcription were performed on each sample: one set used SRT as the reverse transcription primer to obtain cDNA of the positive strand of srRNA from the total RNA; the other set used ART as the reverse transcription primer to obtain cDNA of the negative strand of srRNA from the total RNA. Quantitative PCR was used to detect the saRNA genome copy number after reverse transcription to cDNA. The results for positive and negative strand genome copy numbers are shown below. Figure 13 , Figure 15The saRNA was injected into mice via intramuscular injection, and the level of negative-strand genome at the injection site was detected. The saRNAs from Seq2 to Seq8 showed higher levels of negative-strand genome on days 3 and 5, indicating that these saRNAs have better replication persistence than the original Seq-1 sequence.

[0156] 10. Results of tumor inhibition experiments in mice by intratumoral injection of HNF4α-saRNA-LNP with different 5'UTR structures:

[0157] saRNA-LNPs (Seq12-16, target protein HNF4α) with different 5'UTR structures (Seq-1~Seq-5 in Table 2) were injected into tumor-bearing mice. Subcutaneous tumor volume was measured after injection, and tumor growth curves were plotted (see Table 2). Figure 16 Five days after saRNA injection, mice were sacrificed, tumors were removed and weighed, and tumor weight was recorded. Figure 17 The tumor inhibition rate was calculated and is shown in Table 5. The results showed that intratumoral injection of saRNA-LNPs of Seq1–5 slowed tumor growth, with a tumor inhibition rate exceeding 50%. Seq-1 showed a relatively weak inhibitory effect on tumor growth, while saRNAs of Seq2–Seq5 all showed better tumor inhibition rates. These results suggest that saRNAs of Seq2–5 can effectively induce more persistent HNF-4α expression in vivo, thereby inhibiting the growth of mouse hepatocellular carcinoma implants.

[0158] Table 5. Tumor inhibition rate of subcutaneous tumor implantation in mice with different 5'UTR structures using HNF4α-saRNA-LNP intratumoral injection.

[0159] Tumor Inhibition Rate (TGI) = (1 - Tumor weight in experimental group / Tumor weight in control group) × 100%

[0160]

[0161] 11. Study on humoral immune response in mice injected with RBD-saRNA-LNPs of different 5'UTR structures:

[0162] To evaluate the in vivo immunization efficacy of RBD-saRNA-LNPs (Seq20-27, target protein RBD) with different 5'UTR structures (Seq-1~Seq-8 in Table 2), animal experiments were conducted in BALB / c mice using intramuscular injection of eight RBD-saRNA-LNPs expressing the target protein RBD. 5 μg / 100 μL of saRNA LNP (Seq20-27) and 100 μL of physiological saline (solvent control) were administered intramuscularly. Immunization was performed twice, with a 35-day interval between doses. Blood samples were collected before the second dose (D35) and on day 7 after the second dose. Serum samples were processed, and the level of specific IgG antibodies (original RBD strain) produced in mice after immunization was detected using ELISA. The results are shown below. Figure 18 The results showed that intramuscular injection of Seq-2 to Seq-8 RBD-saRNA-LNP produced enzyme-labeled specific binding antibodies (original RBD strain) with higher titers than those of Seq-1 RBD-saRNA-LNP, while intramuscular injection in mice showed an increase in negative strand RNA copy number, indicating a longer-lasting expression.

[0163] III. Conclusion:

[0164] Self-replicating RNA (saRNA) has shown potential in tumor vaccines and gene therapy due to its long-lasting protein expression capabilities, but its inherent immunogenicity and cytotoxicity limit its clinical application. This invention aims to balance replication efficiency and immunogenicity by systematically optimizing the 5'UTR structure of saRNA. Based on the Venezuelan equine encephalitis virus (VEEV) backbone, 12 5'UTR mutants (Seq lead-2 to Seq lead-13) were initially designed. Based on protein expression levels, 7 5'UTR mutants (Seq-2 to Seq-8) were optimally designed, and two different target proteins were selected for synthesis and corresponding detection. Compared with the original structure, the 5'UTR mutant saRNAs for the target protein HNF4α reduced the expression levels of IFNβ1 and RIG-I (40-60% reduction in Seq-2 to Seq-5, P < 0.01), while maintaining high-efficiency expression of HNF-4α protein, indicating that the 5'UTR mutants can reduce the innate immune response. The saRNA targeting the RBD protein reduced the expression levels of IFNβ1 and RIG-I (from Seq-2 to Seq-8, it decreased to 20-40% of that of Seq-1, P < 0.01) while maintaining high-efficiency expression of the RBD protein. This also showed that the 5'UTR mutant reduced the innate immune response. Furthermore, RNA structure prediction (mfold) indicated that the 5'UTR of Seq-2 formed a stable hairpin structure (ΔG = -12.3 kcal / mol), potentially masking the immune recognition motif. In vivo experiments showed that intratumoral injection of HNF4α-saRNA-LNP (target protein HNF4α) from Seq-2 to Seq-5 resulted in a higher tumor inhibition rate against transplanted hepatocellular carcinoma cells in mice compared to Seq-1, and intramuscular injection increased the negative-strand RNA copy number, suggesting longer-lasting expression. Similarly, intramuscular injection of Seq-2 to Seq-8 RBD-saRNA-LNP (target protein RBD) can produce enzyme-labeled specific binding antibodies (original strain RBD) with higher titers than Seq-1. Intramuscular injection in mice showed an increase in negative strand RNA copy number, indicating longer-lasting expression, which is also related to the result of producing higher titers of IgG binding antibodies in animals.

[0165] In summary, this invention modifies the 5'UTR by inserting an insertion into the G-rich region of the 5'UTR, which can regulate the innate immune response of saRNA, providing a new strategy for developing low-toxicity and highly efficient gene therapy vectors.

[0166] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. A self-replicating RNA vector, characterized in that, The 5' non-coding region sequence consists of the nucleotide sequence as shown in SEQ ID NO. 7 or its complementary sequence; the gene of interest expresses a mammalian cell protein or a viral protein.

2. The self-replicating RNA vector of claim 1, wherein, The self-replicating RNA vector further comprises a 5' cap, a non-structural gene, a 26S subunit group promoter, a 3' non-coding region, and a poly A tail.

3. The self-replicating RNA vector of claim 1, wherein, The self-replicating RNA is based on an engineered alphavirus genome.

4. The self-replicating RNA vector of claim 3, wherein, The self-replicating RNA is based on a VEEA genome.

5. A gene delivery system, characterized by, The gene delivery system comprises a self-replicating RNA vector as claimed in any one of claims 1-4 carrying a gene of interest and a delivery vehicle.

6. The gene delivery system according to claim 5, wherein The mammalian cell protein is a nuclear protein.

7. The gene delivery system of claim 6, wherein, The nuclear protein is a transcription factor.

8. The gene delivery system of claim 7, wherein, The transcription factor is HNF4α.

9. The gene delivery system of claim 5, wherein, The viral protein is a coronavirus protein.

10. The gene delivery system of claim 9, wherein, The coronavirus protein is RBD.

11. The gene delivery system according to claim 5, characterized by The delivery vehicle is a lipid-based nanoparticle.

12. The gene delivery system of claim 11, wherein, The lipid comprises: 1,2-distearoyl-sn-glycero-phosphocholine, molar ratio 5%-20%; cholesterol, molar ratio 30%-55%; 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000], molar ratio 0.5%-3%; ionizable lipid, molar ratio 30%-60%.

13. The gene delivery system of claim 12, wherein, The N:P ratio in the lipid-based nanoparticle ranges from 5:1 to 10:1, and the particle size of the nanoparticle is 40-300 nm.

14. Use of the self-replicating RNA vector as claimed in any one of claims 1-4, or the gene delivery system as claimed in any one of claims 5-8, 11-13, in the preparation of a medicament for treating tumors; the tumors are liver cancer; the gene of interest expresses HNF4α.

15. Use of the self-replicating RNA vector as claimed in any one of claims 1-4, or the gene delivery system as claimed in any one of claims 5, 9-13, in the preparation of a vaccine; the vaccine is a coronavirus vaccine; the gene of interest expresses RBD.

16. A pharmaceutical composition comprising, The pharmaceutical composition comprises the self-replicating RNA vector as claimed in any one of claims 1-4, or the gene delivery system as claimed in any one of claims 5-13.

Citation Information

Patent Citations

  • RNA replicons encoding stabilized coronavirus spike proteins

    CN116096409A

  • Coronavirus vaccine compositions and methods

    US20210290756A1

  • Gene delivery system and application thereof in preparation of tumor treatment drugs

    CN118178685A

  • Synthetic self-amplifying mRNA molecules with secretory antigens and immunomodulators

    CN119563028A