Application of ZmSAMT gene in increasing release of salicylic acid methyl ester and aphid control in maize

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to a... ZmSAMT The application of the gene in increasing methyl salicylate release in corn and controlling aphids, the ZmSAMT The gene's base sequence is shown in SEQ ID NO.1. This invention studies the function and aphid-resistant mechanism of methyl salicylate, aiming to introduce it into the corn plant... ZmSAMT Gene overexpression increases the release of methyl salicylate from corn, which not only repels corn aphids but also attracts aphid natural enemies. By utilizing the interaction between corn, aphids, and natural enemies, aphid control is achieved. This invention has good application prospects for developing new aphid-resistant corn varieties.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a kind of ZmSAMT Application of a gene in improving the release amount of methyl salicylate of corn and aphid control. BACKGROUND

[0002] Corn aphid is an important pest that damages corn crops, and the traditional method for controlling corn aphid is to apply chemical insecticides. However, aphids occur in large numbers in the middle and late stages of corn growth, at which time the corn plants are tall, and the aphids are small and often gathered in the corn heart, causing difficulties in pesticide application. In addition, the traditional method of controlling aphids with chemical pesticides not only easily causes aphids to develop pesticide resistance, but also pollutes the environment, and therefore a new method for controlling corn aphids is urgently needed. SUMMARY

[0003] The application aims to provide a kind of ZmSAMT Application of a gene in improving the release amount of methyl salicylate of corn and aphid control, which solves the problems in the prior art.

[0004] The technical scheme adopted by the application is as follows:

[0005] The application provides a kind of ZmSAMT Application of a gene in improving the release amount of methyl salicylate of corn and aphid control, wherein the ZmSAMT The base sequence of the gene is shown in SEQ ID NO. 1.

[0006] Preferably, the overexpression corn is prepared by constructing a recombinant overexpression vector of the ZmSAMT gene to improve the release amount of methyl salicylate of corn, and further to achieve the purpose of controlling aphids.

[0007] Preferably, the aphid control refers to repelling aphids and / or attracting natural enemies of aphids.

[0008] Preferably, the aphid is Rhopalosiphum maidis.

[0009] The natural enemy of the aphid is Coccinella septempunctata.

[0010] Preferably, the preparation method of the recombinant overexpression vector comprises the following steps:

[0011] Corn RNA is extracted and reverse transcribed into cDNA;

[0012] The cDNA is used as a template, and the gene is amplified using primers shown in SEQ ID NO. 8 and SEQ ID NO. 9. ZmSAMT

[0013] The overexpression vector is subjected to enzyme digestion to obtain a linearized overexpression vector. ​

[0014] The gene is connected with the linearized overexpression vector to obtain a recombinant overexpression vector. ZmSAMT The gene is connected with the linearized overexpression vector to obtain a recombinant overexpression vector.

[0015] Preferably, the overexpression vector is pET-30a(+).

[0016] Preferably, when the overexpression vector is cut, the restriction endonuclease used is BamHI and HindIII.

[0017] Preferably, the corn RNA is derived from the leaf of corn.

[0018] Preferably, the enzyme used for connecting the gene with the linearized overexpression vector is T4 DNA ligase. ZmSAMT Preferably, the enzyme used for connecting the gene with the linearized overexpression vector is T4 DNA ligase.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] The present application provides an application of a gene in increasing the release amount of corn methyl salicylate and in aphid control. ZmSAMT The base sequence of the gene is shown in SEQ ID NO. 1. Methyl salicylate is a common plant volatile substance, which has a significant repellent effect on multiple aphids and a significant attracting effect on the natural enemies of aphids. Salicylic acid carboxyl methyltransferase is a key synthetic enzyme of methyl salicylate in plants. Through the research on the function of the gene and the anti-aphid mechanism, the present application overexpresses the gene in corn plants to increase the release amount of crop methyl salicylate, which not only repels corn aphids but also attracts aphid natural enemies, and utilizes the interaction of corn-aphid-natural enemy to control aphids. ZmSAMT The base sequence of the gene is shown in SEQ ID NO. 1. Methyl salicylate is a common plant volatile substance, which has a significant repellent effect on multiple aphids and a significant attracting effect on the natural enemies of aphids. Salicylic acid carboxyl methyltransferase is a key synthetic enzyme of methyl salicylate in plants. Through the research on the function of the gene and the anti-aphid mechanism, the present application overexpresses the gene in corn plants to increase the release amount of crop methyl salicylate, which not only repels corn aphids but also attracts aphid natural enemies, and utilizes the interaction of corn-aphid-natural enemy to control aphids. ZmSAMT The base sequence of the gene is shown in SEQ ID NO. 1. Methyl salicylate is a common plant volatile substance, which has a significant repellent effect on multiple aphids and a significant attracting effect on the natural enemies of aphids. Salicylic acid carboxyl methyltransferase is a key synthetic enzyme of methyl salicylate in plants. Through the research on the function of the gene and the anti-aphid mechanism, the present application overexpresses the gene in corn plants to increase the release amount of crop methyl salicylate, which not only repels corn aphids but also attracts aphid natural enemies, and utilizes the interaction of corn-aphid-natural enemy to control aphids. ZmSAMT The base sequence of the gene is shown in SEQ ID NO. 1. Methyl salicylate is a common plant volatile substance, which has a significant repellent effect on multiple aphids and a significant attracting effect on the natural enemies of aphids. Salicylic acid carboxyl methyltransferase is a key synthetic enzyme of methyl salicylate in plants. Through the research on the function of the gene and the anti-aphid mechanism, the present application overexpresses the gene in corn plants to increase the release amount of crop methyl salicylate, which not only repels corn aphids but also attracts aphid natural enemies, and utilizes the interaction of corn-aphid-natural enemy to control aphids. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 For the relative expression analysis of the gene of normal corn and corn damaged by aphids at different time points. ZmSAMT For the relative expression analysis of the gene of normal corn and corn damaged by aphids at different time points.

[0022] Figure 2 For the PCR verification result of the gene cloning. ZmSAMT For the PCR verification result of the gene cloning.

[0023] Figure 3 For the enzyme cutting verification result.

[0024] Figure 4 For the SDS-PAGE analysis of the expression of ZmSAMT protein.

[0025] Figure 5 For the qRT-PCR analysis of the expression amount of the gene in different corn lines. ZmSAMT For the qRT-PCR analysis of the expression amount of the gene in different corn lines.

[0026] Figure 6 Effects of overexpression of corn plants on aphid population and natural enemies. A: Effects of overexpression of corn on the olfactory behavior of Schizaphis graminum; B: Effects of overexpression of corn on the olfactory behavior of Harmonia axyridis; C: Effects of overexpression of corn on the population of Schizaphis graminum; D: Results of defense response of adjacent plants. DETAILED DESCRIPTION

[0027] The application will be further described in the following specific examples, but the scope of the application is not limited. The details and forms of the technical solutions of the application can be modified or replaced without departing from the spirit and scope of the application, and these modifications or replacements all fall within the protection scope of the application.

[0028] The inventive concept of the application is as follows:

[0029] Methyl salicylate, abbreviated as MeSA, is a common insect-induced volatile substance, has strong volatility, has significant repellent effect on many aphids, and has significant attracting effect on natural enemies of aphids. Releasing MeSA slow-release balls into corn fields can effectively inhibit the population number of aphids, while increasing the population number of natural enemies. However, it is time-consuming and laborious to release MeSA slow-release balls in the field, and how to improve the release amount of MeSA from corn plants in the natural state is a core problem to be solved.

[0030] Salicylic acid carboxyl methyltransferase, namely SAMT, is a kind of methyltransferase taking S-adenosyl methionine as a methyl donor and salicylic acid as a receptor, which can catalyze the conversion of SA to MeSA, induce the release of odor compounds by using plant transgenic technology, regulate pest behavior, and thus achieve the purpose of pest control.

[0031] MeSA is one of the few plant-derived repellents that can be applied in the field to control aphids, but because MeSA is easy to volatilize and degrade in the natural environment, therefore how to prepare efficient and inexpensive MeSA slow-release agent has been an important factor restricting its large-scale field application. The characteristics and innovation points of the application are to explore the function of MeSA key synthesis enzyme gene ZmSAMT in corn plants, to increase the release amount of transgenic corn MeSA by improving the expression level of ZmSAMT the gene, to improve the aphid resistance of transgenic corn, and to provide a new solution to the problem of how to efficiently release MeSA in the field application, and also to provide a theoretical basis for the development of corn aphid-resistant varieties.

[0032] In order to make the skilled in the art better understand the technical solutions of the present application can be implemented, the following specific examples of the present application is further described. In the description of the present application, if not special, the reagents used are commercially available, the method used are conventional techniques in the art.

[0033] The abbreviations of the present application are shown in Table 1.

[0034] Table 1 Abbreviations of the present application

[0035]

[0036] Example 1

[0037] ZmSAMT The application of the gene in improving the release of methyl salicylate of corn and aphid control is as follows:

[0038] 1. Experimental method.

[0039] 1.1. Materials.

[0040] Xiumi 335: used for ZmSAMT Expression pattern analysis of the gene

[0041] KN5585: used for preparing overexpression ZmSAMT Plant of the gene.

[0042] 1.2, ZmSAMT Sequence prediction analysis of the gene.

[0043] ZmSAMT The complete CDS sequence of the gene is derived from the NCBI database. The base sequence of the gene described in the present application is shown in SEQ ID NO. 1. ZmSAMT

[0044] SEQ ID NO. 1:

[0045] ​

[0046] 1.3 ZmSAMT Gene expression patterns: RNA extraction and qRT-PCR analysis.

[0047] With primers ZmSAMT- F and ZmSAMT-R For ZmSAMT qRTPCR of genes, using Actin Genes are used as internal reference values. Primer sequences are shown in Table 2.

[0048] Eight hundred *Paecilomyces gracilis* aphids were inoculated onto six-leaf stage *Xianyu 335* maize plants. Maize leaves unaffected by *Paecilomyces gracilis* and those affected by *Paecilomyces gracilis* were collected at 24h, 48h, 72h, and 96h, with healthy plants serving as the control (CK). RNA was extracted from the leaves and reverse transcribed into cDNA. The cDNA was then used as a template for qRT-PCR. The qRT-PCR reaction system is shown in Table 3; the procedure is shown in Table 4. Each group had three biological replicates and three parallel replicates. Using 2... -ΔΔCt The method involves qRTPCR analysis.

[0049] Table 2 Primer sequences used for qRTPCR

[0050]

[0051] Table 3 qRT-PCR reaction system

[0052]

[0053] Table 4 qRT-PCR reaction procedure

[0054]

[0055] 1.4 ZmSAMT Gene cloning.

[0056] RNA was extracted from the leaves of Xianyu 335 plant and reverse transcribed to obtain cDNA. Primers were designed using Primer 5.0 software; the primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7. The cDNA was used as a template for amplification... ZmSAMT PCR amplification was performed. The amplification system is shown in Table 5, and the amplification procedure is shown in Table 6. After PCR amplification, the products were detected by agarose gel electrophoresis. If a band of the predicted size was obtained, the PCR product was excised and recovered. The gel recovery method was performed according to the instructions of the Kangwei Century Gel Reagent Kit.

[0057] F primer, SEQ ID NO.6:

[0058] ATGGATATAAGACGTGATTTCCATATGGC.

[0059] R primer, SEQ ID NO. 7:

[0060] TCACTCTTTCTTCAAGCACATGGCG.

[0061] The PCR product after glue recovery was ligated to the Blunt vector, incubated at 16°C for 30 min. The ligation product was transformed into DH5a E. coli competent cells, spread on LB solid medium containing Amp resistance for screening, incubated at 37°C overnight, and single colonies were picked for expansion to obtain bacterial liquid and plasmid extraction. PCR verification was performed using the bacterial liquid and plasmid as templates. If the PCR band size was consistent with the gene size, the bacterial liquid and plasmid were sent to Changchun Shengong Biotechnology Co., Ltd. for sequencing. ZmSAMT

[0062] Table 5 ZmSAMT PCR amplification system of the gene

[0063]

[0064] Table 6 ZmSAMT PCR amplification procedure of the gene

[0065]

[0066] 1.5, Construction of recombinant overexpression vector.

[0067] The CDS region of the gene was amplified from corn using the primer shown in SEQ ID NO. 8 and SEQ ID NO. 9 as a template; the overexpression vector pET-30a(+) was double-digested with BamHI and HindIII to obtain a linearized overexpression vector; the gene and the linearized overexpression vector were connected using T4 DNA ligase, so that the gene was inserted into the multiple cloning site region of the pET-30a(+) vector to obtain a recombinant plasmid. ZmSAMT ZmSAMT ZmSAMT

[0068] SEQ ID NO. 8:

[0069] CCATGGCTGATATCGGATCCATGGATATAAGACGTGATTTCCATATGGC.

[0070] SEQ ID NO. 9:

[0071] TCGAGTGCGGCCGCAAGCTTTCACTCTTTCTTCAAGCACATGGCG.​​​​

[0072] The recombinant plasmid is transformed into E. coli competent cells and coated on LB solid medium containing Kan resistance. The single colonies after screening are picked and cultured in LB liquid medium overnight. The bacterial solution is detected by PCR, and the PCR product is detected by agarose gel electrophoresis. The bacterial solution with a band size consistent with the expected size is sent to Jilin Shenguo Biological Company for sequencing. The recombinant overexpression vector is obtained by extracting the plasmid of the strain with correct sequencing. Part of the recombinant overexpression vector is sent to a transgenic overexpression corn for synthesis of overexpression ZmSAMT genes, which is completed by Boyuan Biological Technology Co., Ltd.; and the other part is used for protein induction expression.

[0073] 1.6, induction and expression of ZmSAMT protein.

[0074] (1) The strain containing the recombinant overexpression vector and the strain containing the empty vector are inoculated into LB liquid medium containing kanamycin, and cultured at 37°C in a constant temperature oscillator for 12h. The next day, the inoculation amount is 1% (v / v) into fresh LB medium, and the bacterial solution concentration is continuously monitored until OD 600 0.5±0.1, and then 0.5mM of IPTG is added for induction expression.

[0075] (2) After 16°C induction culture, the bacteria are collected by centrifugation at 4°C and 5000g for 10min, and the bacterial solution is resuspended with phosphate buffer. 200μL of the suspension is labeled as the induced bacterial solution, and the remaining bacteria are treated by ice bath ultrasonic crushing to achieve cell lysis. The lysate is centrifuged at 12000g for 30min, and the supernatant and precipitate are separated. The precipitate is resuspended with PBS and labeled as the inclusion body component.

[0076] (3) All samples are mixed with 5 times the concentration of buffer at a volume ratio of 4:1, and denatured by boiling water for 8min to prepare detection samples suitable for SDS-PAGE gel electrophoresis analysis.

[0077] 1.7, expression of overexpression ZmSAMT genes in corn ZmSAMT gene expression detection.

[0078] The overexpression corn plants obtained in the application are 7, marked as OE1~OE7. The corn leaves are subjected to RNA extraction, reverse transcription into cDNA, and gel electrophoresis detection of the quality of the cDNA. The qualified cDNA is used as a template for qRT-PCR and stored at-80°C.

[0079] According to ZmSAMT the primer designed according to the gene sequence, the system is configured according to the qRT-PCR kit instruction manual, and then centrifuged. The qRT-PCR detection is performed.

[0080] qRT-PCR reaction program: 95°C pre-denaturation for 3 min; 95°C for 5 s, 60°C for 30 s, 30 cycles; then 95°C for 5 s. Melting curve was recorded every 0.5°C for 5 s from 65°C to 95°C. Three replicates were set up for each sample. The relative gene expression level was calculated using a 2-1T / T ratio. -△△CT The method is used for calculation and analysis.

[0081] 1.8 Overexpression ZmSAMT Evaluation of genetically modified corn.

[0082] 1.8.1 Behavioral response.

[0083] This invention utilizes the corn aphid, the cereal constrictor aphid ( Rhopalosiphum padi ) and the natural enemy of the cereal constrictor aphid, the multicolored ladybug ( Harmonia axyridis To evaluate the expression ZmSAMT Genetically modified maize plants. The behavioral responses of the cereal aphid and the ladybug to maize plants were measured using a Y-shaped olfactory instrument. The Y-shaped olfactory instrument consists of a 14cm long basal tube and two 12cm long arm tubes, with the two arms at a 75° angle. The inner diameter of each tube is uniformly 2cm.

[0084] 1.8.2 Envelopment test.

[0085] The shroud test was conducted according to the methods described in the references below.

[0086] References: Jiang Shanshan, Deng Qing, Fan Jia, Sun Jingrui, Chen Julian. Olfactory behavioral response of wheat aphid to E-β-farnesene [J]. Acta Entomologica Sinica, 2015, 58(7):776-782.

[0087] (1) Select wild-type KN5585 and OE3 at the 5-leaf stage and place them together in an insect rearing cage. Inoculate 15 rice constrictor aphids on each plant and observe the total number of aphids after two weeks. Each group of experiments was repeated three times.

[0088] (2) Detection of overexpression ZmSAMT Can genetically modified corn plants elicit a defensive response in neighboring plants?

[0089] The experimental design is as follows:

[0090] Two maize plants, CK and OE3, at the 5-leaf stage, were selected for the experiment. Two CK plants were placed together in insect rearing cage 1, and designated CK1 and CK2 respectively. One CK plant and one OE3 plant were then placed in insect rearing cage 2, designated CK3. Fifteen *Paecilomyces gracilis* aphids were introduced into CK1 and OE3 respectively. The number of *Paecilomyces gracilis* aphids on CK2 and CK3 was observed after two weeks. Each experiment was repeated three times. The entire experiment was conducted in a light incubator at 25℃, 60% relative humidity, a photoperiod of 16L:8D, and a light intensity of 20000 lux.

[0091] 2. Experimental results.

[0092] 2.1 ZmSAMT Gene expression analysis.

[0093] This invention was obtained from the NCBI database. ZmSAMT The gene consists of 1158 nucleotides and encodes 384 amino acids. Based on primary structure prediction, the ZmSAMT protein has a molecular weight of 43.73 kDa and an isoelectric point of 5.56. L-leucine is the major amino acid constituting the ZmSAMT protein, while tryptophan is the least abundant amino acid. ZmSAMT has an average hydrophilicity of -0.332, classifying it as a hydrophilic protein. Its instability coefficient is 38.73, and its adipose coefficient is 81.79, classifying it as a stable protein.

[0094] This invention is applicable to both maize leaves unaffected by the grain aphid and maize leaves affected by the grain aphid. ZmSAMT Tissue-specific expression analysis of the gene was performed, and the results are shown below. Figure 1 After discovering that the corn plants were being fed on by the cereal tube aphid, ZmSAMT Gene expression levels were significantly increased. In maize leaves unaffected by the cereal aphid... ZmSAMT The gene expression levels at 24h, 48h, 72h, and 96h were 27.87, 27.69, 27.30, and 25.16, respectively; in maize leaves damaged by the cereal aphid... ZmSAMT The gene expression levels at 24h, 48h, 72h, and 96h were 54.86, 70.88, 54.13, and 46.53, respectively. Further analysis revealed that at 48h, the expression levels of the gene in maize leaves damaged by the cereal aphid were... ZmSAMT The expression level was 2.56 times that of maize leaves that were not damaged by the grain aphid.

[0095] 2.2 ZmSAMT Gene cloning.

[0096] This invention extracts total RNA from the leaves of Xianyu 335, reverse transcribes it to generate cDNA, and then performs PCR amplification and gel extraction for recovery. ZmSAMTThe gene is connected to a blunt vector, transformed, and single colonies are picked for expansion and detection, and the sequencing results are aligned by DNAMAN. Figure 2 As shown in the figure, the size of the PCR amplified fragment is 1158bp, proving ZmSAMT that the gene is successfully cloned. Figure 2 In the figure, M: marker, lanes 1 and 2 are two corns not damaged by Rhopalosiphum maidis; lanes 3 and 4 are two corns damaged by Rhopalosiphum maidis.

[0097] 2.3, Construction of recombinant overexpression vector.

[0098] A gene fragment of about 1158bp is obtained by PCR amplification, and is directionally connected to a pET-30a(+) vector, and is introduced into E. coli competent cells DH5a by heat shock transformation. After initial screening of positive clones by colony PCR, typical single colonies are selected for Sanger bidirectional sequencing to verify the integrity of the inserted sequence, and a recombinant overexpression vector is obtained. The correct recombinant overexpression vector is subjected to restriction double enzyme digestion of BamHI / HindIII, and the results of agarose gel electrophoresis are consistent with the expected results, confirming the effectiveness of the enzyme digestion site. Figure 3 As shown in the figure, the size of the PCR amplified fragment is 1158bp, proving Figure 3 that the gene is successfully cloned.

[0099] 2.4, Induced expression of ZmSAMT protein.

[0100] After IPTG induction, SDS-PAGE detection shows that the molecular weight of ZmSAMT protein is about 50kDa, which is basically consistent with the predicted value, as shown in Figure 4 .

[0101] Figure 4 In the figure, M: protein marker; lane 1: total protein before induction of empty vector; lane 2: total protein after induction of empty vector; lane 3: total protein before induction of recombinant overexpression vector; lane 4: total protein after induction of recombinant overexpression vector; lane 5: supernatant after ultrasonic disruption of recombinant overexpression vector; lane 6: inclusion body component after ultrasonic disruption of recombinant overexpression vector; the arrow indicates the target protein.

[0102] 2.5, Expression amount of overexpressed ZmSAMT gene in corn. ZmSAMT

[0103] The present application obtains 7 strains of overexpressed corn, i.e., OE1-OE7, through a biological company, and detects the expression amount of ZmSAMT gene in the 7 strains of overexpressed corn by qRT-PCR. ZmSAMT The present application finds that the expression amount of ZmSAMT gene in the 7 strains of overexpressed corn​ZmSAMT The expression amount of the gene is significantly increased, p <0.05, as Figure 5 indicated. Among them, the highest expression amount is in OE3, followed by OE5; the expression amount of OE2 is the lowest, and the above results are all compared with the wild type WT. Since the expression amount of the gene in OE3 is the highest, subsequent experiments are all based on OE3. ZmSAMT

[0104] 2.6, evaluation of corn overexpressing ZmSAMT the gene.

[0105] 2.6.1, behavior response detection results.

[0106] In order to further verify whether OE3 has an impact on the population number of aphids and natural enemies of aphids, the application uses a "Y" type olfactometer for behavior response, and the results are shown in Figure 6 .

[0107] For behavior response, 90 aphids of Rhopalosiphum maidis and 90 aphids of Rhopalosiphum maidis are used, among which 13 aphids of Rhopalosiphum maidis are not selected, accounting for 14.4% of the total; 10 aphids of Rhopalosiphum maidis are not selected, accounting for 11.1% of the total. The results show that corn overexpressing ZmSAMT the gene can cause the behavior response of aphids of Rhopalosiphum maidis and aphids of Rhopalosiphum maidis. The selection rate of aphids of Rhopalosiphum maidis to CK is 55.5%, and the selection rate of aphids of Rhopalosiphum maidis to OE3 is 30%; the selection rate of aphids of Rhopalosiphum maidis to CK is 55.5%, and the selection rate of aphids of Rhopalosiphum maidis to OE3 is 33.33%. The number of aphids of Rhopalosiphum maidis selecting OE3 is significantly lower than that of CK, P <0.001; the number of aphids of Rhopalosiphum maidis selecting OE3 is also significantly lower than that of CK, P <0.01.

[0108] For behavior response, 90 adults and 90 larvae of Harmonia axyridis are used, among which 5 adults are not selected, accounting for 5.56% of the total; 8 larvae are not selected, accounting for 8.89% of the total. The selection rate of adults of Harmonia axyridis to CK is 30%, and the selection rate of adults of Harmonia axyridis to OE3 is 64.4%; the selection rate of larvae of Harmonia axyridis to CK is 36.67%, and the selection rate of larvae of Harmonia axyridis to OE3 is 54.44%. The number of adults of Harmonia axyridis selecting OE3 is significantly higher than that of CK, P <0.001; the number of larvae of Harmonia axyridis selecting OE3 is significantly higher than that of CK, P <0.05.

[0109] The application verifies that corn overexpressing ZmSAMT the gene has a repelling effect on aphids and an attracting effect on natural enemies of aphids.

[0110] 2.6.2, cage cover experiment - the influence of corn overexpressing ZmSAMT the gene on the population number of aphids.​

[0111] (1) All experiments were conducted under indoor culture conditions. The number of *Aphidius gracilis* feeding on OE3 and CK was counted separately. This experiment was performed in 3 biological replicates, and the values ​​are expressed as the average of the 3 biological replicates. The number of *Aphidius gracilis* feeding on CK was 451.33, while the number of *Aphidius gracilis* feeding on OE3 was 267. It can be seen that the population of *Aphidius gracilis* in OE3 was significantly reduced compared with the CK group. P <0.001. See results below. Figure 6 C.

[0112] (2) In the detection of overexpression ZmSAMT In the experiment to determine whether genetically modified maize plants could elicit a defensive response in neighboring plants, three biological replicates were performed, and the values ​​are expressed as the average of the three replicates. The population of *Aphidius gracilis* on CK2 maize plants was 473.33 individuals; the population on CK3 maize plants was 431.67 individuals, significantly lower than that on CK2. P <0.05, this result proves overexpression ZmSAMT Genetically modified corn plants can elicit a defensive response from neighboring plants.

[0113] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0114] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. ZmSAMT The application of the gene in increasing the release of salicylic acid methyl ester of corn and the application of the gene in the prevention and treatment of aphids, characterized in that, The ZmSAMT The base sequence of the gene is shown as SEQ ID NO. 1; The application refers to improving the release amount of salicylic acid methyl ester by overexpression ZmSAMT The gene further realizes the prevention and treatment of corn aphids. The prevention and treatment of corn aphids refers to repelling corn aphids and / or attracting natural enemies of corn aphids; The corn aphids are Rhopalosiphum maidis, and the natural enemies of the corn aphids are Hippodamia variegata.

2. Use according to claim 1, wherein By constructing the ZmSAMT The recombinant overexpression vector of the gene is used to prepare overexpression corn to increase the release amount of salicylic acid methyl ester of the corn, so as to further achieve the purpose of preventing and treating corn aphids.

3. Use according to claim 2, wherein the compound is ###0002### The preparation method of the recombinant overexpression vector comprises the following steps: extracting corn RNA and reverse transcribing into cDNA; Using cDNA as template, the primer shown as SEQ ID NO. 8 and SEQ ID NO. 9 is used to amplify ZmSAMT gene; performing enzyme cutting on the overexpression vector to obtain a linearized overexpression vector; The ZmSAMT The gene is ligated with the linearized overexpression vector to obtain a recombinant overexpression vector.

4. The use according to claim 3, wherein the compound is ###0002### The overexpression vector is pET-30a (+).

5. The use according to claim 3, wherein the compound is ###0002### When the overexpression vector is subjected to enzyme cutting, the restriction endonuclease used is BamHI and HindIII.

6. The use according to claim 3, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. The corn RNA is derived from the leaf of corn.

7. The use according to claim 3, wherein the compound is ###0003### For ligation ZmSAMT The enzyme used for the ligation of the gene to the linearized overexpression vector is T4 DNA ligase.

Images