Method for evaluating scrotal hernia risk of boar
By detecting the genotype of the A255C SNP site in the boar genome, boars with a high risk of scrotal hernia are evaluated and screened, which solves the problem of difficulty in identifying pathogenic genes in existing technologies and achieves scientific guidance and economic benefits in boar breeding.
Patent Information
- Application Number
- CN202510915924.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2025-10-10
AI Technical Summary
Existing technologies make it difficult to identify the causative genes or genetic variations of boar scrotal hernia, making it difficult to completely eradicate the disease in pig herds, affecting the breeding value of pigs and causing economic losses to the pig farming industry.
By detecting the genotype of the A255C SNP site in the boar genome, the risk of scrotal hernia in boars is assessed using PCR amplification and genotyping methods. Kits and molecular markers are provided to assess the risk of scrotal hernia, screen out low-risk boars, and prevent or treat scrotal hernia by inhibiting the activity and expression of the COL4A5 protein.
Accurately and stably assess the risk of scrotal hernia in boars, guide boar breeding, reduce the risk of scrotal hernia, improve the breeding value and animal welfare of pigs, and provide economic benefits and scientific basis.
Smart Images

Figure BDA0005481593530000062 
Figure BDA0005481593530000081 
Figure BDA0005481593530000121
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for assessing the risk of scrotal hernia in boars. Background Art
[0002] Scrotal hernia is the most common genetic defect in boars and has also been widely reported in mammals such as mice and humans, posing a serious threat to animal and human health. The occurrence of scrotal hernia not only directly reduces the breeding value of pigs, but also leads to severe economic losses and poor animal welfare in the pig industry. my country accounts for more than half of the world's pig population. Identifying the causal genes and causal variants of scrotal hernia and applying them to molecular breeding of pigs is of great significance to my country's pig industry. Furthermore, as pigs are an ideal animal model for human disease research, the identification and study of the causal genes of scrotal hernia in pigs also provides a basis and clues for understanding the molecular genetic mechanisms of the disease in humans, which is of great practical significance.
[0003] With the advent of commercial porcine single nucleotide polymorphism (SNP) microarrays and the rapid development of genome sequencing technology, the use of genome-wide association analysis to identify SNPs or major genes that influence scrotal hernia in pigs has become a research hotspot. Many studies have identified candidate genes associated with scrotal hernia on different chromosomes, but without subsequent functional validation, the definitive causative gene or genetic variant has remained elusive, making complete eradication of the disease difficult in pig populations.
[0004] Type IV collagen A5 chain (Collagen Type IV Alpha 5 Chain, COL4A5), as type IV collagen, is the most important component protein in the basement membrane. The network structure it forms is the foundation of the basement membrane. Summary of the Invention
[0005] The purpose of the present invention is to evaluate the risk of scrotal hernia in boars and thus to guide boar breeding.
[0006] The present invention first protects a method for assessing the risk of scrotal hernia in boars.
[0007] The method for assessing the risk of scrotal hernia in boars to be protected by the present invention may be specifically method 1, which may include the following steps: detecting whether the genotype of the boar to be tested is genotype I or genotype II, where the risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II;
[0008] The boar of genotype I is a boar whose genotype based on the A255C SNP site is CC homozygous;
[0009] The boar of genotype II is a boar whose genotype based on the A255C SNP site is AA homozygous;
[0010] The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome.
[0011] The method for assessing the risk of scrotal hernia in boars to be protected by the present invention may be specifically method 2, which may include the following steps:
[0012] (1) Using the genomic DNA of the boar to be tested as a template, a primer pair consisting of an upstream primer F and a downstream primer R is used to perform PCR amplification to obtain a PCR amplification product; the PCR amplification product is detected and then evaluated as follows:
[0013] If the 255th position of the PCR amplification product is only C, the genotype of the boar to be tested based on the A255C SNP site is CC homozygous; if the 255th position of the PCR amplification product is only A, the genotype of the boar to be tested based on the A255CSNP site is AA homozygous;
[0014] The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome;
[0015] The upstream primer F is a single-stranded DNA molecule shown in SEQ ID NO: 2;
[0016] The downstream primer R is a single-stranded DNA molecule shown in SEQ ID NO: 3;
[0017] (2) Based on the results of (1), determine whether the genotype of the boar to be tested is genotype I or genotype II. Boars with genotype I have a higher risk of scrotal hernia than those with genotype II.
[0018] The boar of genotype I is a boar whose genotype based on the A255C SNP site is CC homozygous;
[0019] The boar of genotype II is a boar whose genotype based on the A255C SNP site is AA homozygous.
[0020] In the above method, the genomic DNA of the boar to be tested can be genomic DNA of a boar tissue to be tested, and the tissue can specifically be ear tissue.
[0021] The present invention also protects a kit for assessing the risk of scrotal hernia in boars, which may include a substance for detecting whether the genotype of the boar to be tested is genotype I or genotype II;
[0022] The genotype I is based on the A255C SNP site, which is a CC homozygous type;
[0023] The genotype II is based on the A255C SNP site, which is AA homozygous;
[0024] The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome.
[0025] The kit for assessing the risk of scrotal hernia in boars may specifically be composed of a substance for detecting whether the genotype of the boar to be tested is genotype I or genotype II.
[0026] Any of the aforementioned substances for detecting whether the genotype of the boar to be tested is genotype I or genotype II can specifically be a primer pair consisting of any of the aforementioned upstream primers F and any of the aforementioned downstream primers R.
[0027] Any of the aforementioned substances for detecting whether the genotype of the boar to be tested is genotype I or genotype II can also be used to determine the nucleotide type at the A255C SNP site in the boar genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. The SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and / or a chip based on fluorescent molecule DNA binding reaction.
[0028] The present invention also protects the molecular marker shown in SEQ ID NO: 1.
[0029] The use of any of the above-mentioned kits or any of the above-mentioned molecular markers in assessing the risk of scrotal hernia in boars also falls within the scope of protection of the present invention.
[0030] The use of any of the above-mentioned kits or any of the above-mentioned molecular markers in screening boars with a low risk of scrotal hernia also falls within the scope of protection of the present invention.
[0031] In the above application, the boar with a low risk of scrotal hernia may specifically be a boar of genotype II.
[0032] The boar of genotype II may be a boar whose genotype based on the A255C SNP site is homozygous for AA.
[0033] Use of any of the above-mentioned kits or any of the above-mentioned molecular markers in boar breeding. The purpose of the boar breeding is to cultivate boar breeds with a low risk of scrotal hernia or a low risk of scrotal hernia.
[0034] In the above, the higher than may specifically be statistically higher.
[0035] The breed of any of the above-mentioned boars can be Large White or Landrace.
[0036] The present invention also protects the use of a substance that inhibits the activity and / or expression of COL4A5 protein in the preparation of a product for preventing and / or treating scrotal hernia.
[0037] In the above application, the substance that inhibits the activity and / or expression of COL4A5 protein can specifically be a COL4A5-Homo interference sequence; the COL4A5-Homo interference sequence consists of the sense chain sequence shown in SEQ ID NO: 4 and the antisense chain sequence shown in SEQ ID NO: 5.
[0038] Experiments have demonstrated that the method provided by the present invention can assess or assist in assessing the risk of scrotal hernia in boars by detecting the CC homozygous genotype at the A255C SNP locus, with reliable, stable, and accurate results. The present invention has significant application value and is suitable for large-scale population testing. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 The levels of COL4A5 protein in the lower abdominal tissues of individual boars in the healthy group and the scrotal hernia disease group were detected by immunohistochemistry.
[0040] Figure 2 Real-time fluorescence quantitative PCR was used to detect the relative expression levels of COL4A5, ITGB1, FBN1, FBN2, and FN1 genes in the lower abdominal tissues of individual boars in the healthy group and the scrotal hernia group. ** indicates P < 0.01, and * indicates P < 0.05.
[0041] Figure 3 Real-time fluorescence quantitative PCR was used to detect the effect of COL4A5 knockdown on the gene expression of extracellular matrix proteins in WPMY cells. *** indicates P < 0.001, ** indicates P < 0.01, * indicates P < 0.05, and ns indicates no significant difference.
[0042] Figure 4 To detect the effect of interfering with COL4A5 on the cell apoptosis pathway in WPMY cells; * indicates P < 0.05.
[0043] Figure 5This is the partial sequencing result of a boar based on the A255C SNP site in step 1 of Example 5. DETAILED DESCRIPTION
[0044] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0045] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0046] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.
[0047] The Uniprot ID of COL4A5 protein (Pig) is A0A287A007, and the GeneBank number of the gene encoding COL4A5 protein (i.e., COL4A5 gene (Pig)) is 100737091. In this application, the COL4A5 protein is COL4A5 protein (Pig), and the COL4A5 gene is COL4A5 gene (Pig).
[0048] In the following examples, WPMY cells are immortalized human prostate stromal cells, which are products of Xiamen Yimo Biotechnology Co., Ltd., with catalog number IM-H077. WPMY cells were cultured in DMEM medium (C11995500BT, Gibico) supplemented with 5% (v / v) fetal bovine serum (A5669701, Gibico).
[0049] In the following examples, the inventors collected lower abdominal tissue blocks from six boars (all Large White breed) based on phenotypic observation. The lower abdominal tissue blocks from each of the six boars were stored in liquid nitrogen. Three of the six boars had scrotal hernias, forming the scrotal hernia disease group; three were healthy, forming the healthy group.
[0050] Example 1: The expression levels of COL4A5 gene, COL4A5 protein and extracellular matrix genes in the lower abdominal tissue of pigs with scrotal hernia were significantly downregulated
[0051] 1. Immunohistochemical detection of COL4A5 protein expression in pig lower abdominal tissues
[0052] 1. The collected pig lower abdominal tissue blocks were fixed with 4% paraformaldehyde buffer, then rinsed, trimmed, gradient dehydrated, and paraffin-embedded. They were then cut into 4 μm thick serial sections using a microtome.
[0053] 2. Bake the slices from step 1 for 4 hours, dewax with gradient alcohol to water, and perform antigen repair in a microwave oven with EDTA (pH 9.0). After cooling to room temperature, wash three times with 1× PBS buffer.
[0054] 3. After completing step 2, block the sections with 3% H₂O₂ for 30 minutes, then wash three times with 1× PBS buffer. Block the sections with goat serum working solution (a mixture of goat serum and 1× PBS buffer at a ratio of 1:10) for 20 minutes. Remove the serum without washing. Finally, use rabbit anti-human COL4A5 antibody (Abmart, Cat. No. PK14126) as the primary antibody. Add 50 μl of primary antibody working solution (a mixture of rabbit anti-human COL4A5 antibody and 1× PBS buffer at a ratio of 1:200) to each sample and incubate at 4°C overnight.
[0055] 4. Take the slices prepared in step 3 out of the refrigerator, return to the temperature for 30 minutes, and wash with 1× PBS buffer for 5 minutes each time, for a total of 3 times; then add secondary antibody and incubate at 37°C for 1 hour (the working concentration of the secondary antibody is 1:500).
[0056] 5. Return the sections prepared in step 4 to the warm state for 20 minutes, wash three times with 1× PBS buffer, then develop the color with DAB for 1 minute 20 seconds, and terminate the color development with PBST buffer (pH 7.25-7.45); finally, counterstain the cell nuclei with hematoxylin for 1 minute and rinse for 10 minutes.
[0057] 6. After completing step 5, dehydrate the sections with gradient alcohol and xylene to make them transparent, and finally seal them with neutral gum. Use KFBIO-KF-PRO-120 to scan the entire image.
[0058] Follow the above steps, replacing step 3 with step 3A, and keeping other steps unchanged, as a negative control.
[0059] Step 3A: After completing Step 2, block the sections with 3% H₂O₂ for 30 minutes, then wash three times with 1× PBS buffer. Block the sections with goat serum working solution (a 1:10 mixture of goat serum and 1× PBS buffer) for 20 minutes without washing, and remove the serum. Finally, add 50 μl of 1× PBS buffer to each sample and incubate at 4°C overnight.
[0060] Some test results can be found in Figure 1 The results showed that the COL4A5 protein level was downregulated in the lower abdominal tissues of boars in the scrotal hernia group compared with the healthy group.
[0061] 2. Real-time fluorescence quantitative PCR (qPCR) detection of the expression levels of COL4A5, ITGB1, FBN1, FBN2, and FN1 genes in pig lower abdominal tissues
[0062] Scrotal hernia is a condition in which abdominal contents protrude into the scrotum due to incomplete development of the abdominal wall or peritoneum. It is often associated with abnormalities in the extracellular matrix and weakened connective tissue. The extracellular matrix is a complex structure composed of macromolecules secreted by cells into the extracellular matrix. It is composed of the interstitial matrix and the basement membrane. The interstitial matrix is a reticular structure primarily composed of collagen, elastin, fibronectin, and various proteoglycans. FBN1 and FBN2 are involved in the formation of elastin, which primarily imparts tissue flexibility and extensibility. FN1, as a fibronectin, regulates cell-matrix interactions by binding to cell-surface integrin receptors. Type IV collagen is the most important component protein of the basement membrane. Given the important role of COL4A5 in maintaining the structure of the extracellular matrix, it is possible that COL4A5 is involved in the development of scrotal hernia. To determine the expression of important functional genes in the peritoneal tissue of pigs with scrotal hernia, real-time fluorescence quantitative PCR (qPCR) was used to detect whether there were significant differences in the expression levels of COL4A5, fibrillins FBN1 and FBN2, fibronectin FN1, and integrin ITGB1 in the lower abdominal tissues of boars with scrotal hernia and healthy groups.
[0063] 1. Take 0.1 g of lower abdominal tissue blocks from 6 boars from liquid nitrogen, grind them into powder in liquid nitrogen, and obtain lower abdominal tissue samples.
[0064] 2. Add 1 mL of Trizol to each of the lower abdominal tissue samples obtained in step 1, and extract total RNA from the lower abdominal tissue using the Trizol method; then use a Nanodrop nucleic acid analyzer (Thermo Scientific) to detect the purity and concentration of the total RNA from the lower abdominal tissue.
[0065] 3. Follow the reverse transcription kit PrimeScript TM Reverse transcribe the total RNA from the lower abdominal tissue using the RT reagent Kit with gDNA Eraser (PerfectReal Time) (RR047, TAKARA) according to the instructions (the entire reaction was performed on ice) to obtain cDNA from the lower abdominal tissue. The specific steps are as follows:
[0066] (1) Prepare reaction system ①. Reaction system ① consists of 5 μL total RNA from lower abdominal tissue, 2 μL 5× gDNA Eraser Buffer, 1 μL gDNA Eraser, and 2 μL RNase-free dH2O.
[0067] (2) Place reaction system ① in a PCR instrument, treat at 42°C for 2 minutes, and store at 4°C.
[0068] (3) Add 1 μL PrimeScript RT Enzyme Mix, 1 μL RTPrimer Mix, 4 μL 5× PrimeScript Buffer 2, and 4 μL RNase Free dH2O to the system prepared in step (2) and mix well. Then, treat at 37°C for 15 min, 85°C for 5 s, and store at 4°C to obtain cDNA from the lower abdominal tissue.
[0069] 5×gDNA Eraser Buffer, gDNA Eraser, PrimeScript RT Enzyme Mix, RT PrimerMix, and 5×PrimeScript Buffer 2 are all PrimeScript TM Components of the RT reagent Kit with gDNA Eraser.
[0070] 4. According to TB Premix Ex Taq TM Following the instructions for the RT-PCR assay using the Tli RNaseH Plus (RR820, Takara) kit, qPCR was performed to detect the relative expression levels of the COL4A5, ITGB1, FBN1, FBN2, and FN1 genes in cDNA from lower abdominal tissue (using GAPDH as an internal reference). The nucleotide sequences of the primers for each gene are shown in Table 1.
[0071] Table 1
[0072]
[0073] Test results are shown in Figure 2 The results showed that compared with the healthy control group, the relative expression levels of COL4A5, ITGB1, FBN1, FBN2, and FN1 genes in the lower abdominal tissues of boars with scrotal hernia were significantly downregulated. This suggests that the expression of extracellular matrix genes in the lower abdominal tissues of boars with scrotal hernia is dysregulated.
[0074] Example 2: Interference with the COL4A5 gene leads to a significant decrease in the gene expression of extracellular matrix proteins
[0075] The basement membrane is an extracellular matrix widely distributed throughout the body, providing support and barrier functions. The basement membrane is composed of type IV collagen (including COL4A5), laminin, entactin, and proteoglycans. To determine the effect of COL4A5 on the basement membrane, this study examined the expression of genes involved in the formation of the basement membrane, including integrin ITGB1, fibrillin (FBN1, FBN2), fibronectin FN1, and laminins (LAMB1, LAMB2, LAMA3, LAMA4, LAMC1), entactin (NID1, NID2), and type IV collagen (COL4A1, COL4A2, COL4A6).
[0076] 1. Obtaining transfected WPMY cells
[0077] 1. Suzhou Genema Gene Co., Ltd. synthesized the COL4A5-Homo interference sequence for targeted knockdown of the COL4A5 gene and the control sequence for no gene knockdown.
[0078] The sense strand sequence of the COL4A5-Homo interference sequence is 5'-GGGUGUUCUCCAGGAUCAATT-3' (SEQ ID NO: 4), and the antisense strand sequence is 5'-UUGAUCCUGGAGAACACCCTT-3' (SEQ ID NO: 5).
[0079] The sense strand sequence of the control sequence is 5′-UUCUCCGAACGUGUCACGUTT-3′, and the antisense strand sequence is 5′-ACGUGACACGUUCGGAGAATT-3′.
[0080] 2. The cell concentration in 1 mL is 2×10 6 WPMY cell resuspension at 100 μg / ml was evenly seeded into 6-well plates and cultured at 37°C and 5% CO2 until the cell confluence reached 90%. Then, interference sequences (COL4A5-Homo interference sequence or control sequence) were transfected to obtain transfected WPMY cells.
[0081] 2. qPCR detection of the relative expression levels of COL4A5 gene and extracellular matrix protein genes in transfected WPMY cells
[0082] 1. The total RNA of the transfected WPMY cells obtained in step 1 was extracted using the Trizol method, and then the cDNA of the transfected WPMY cells was obtained by referring to the method in step 3 of step 2 of Example 1.
[0083] 2. According to TB Premix Ex Taq TM Following the instructions of the PCR amplification kit (Tli RNaseH Plus, RR820, Takara), qPCR was used to detect the relative expression levels of COL4A5, ITGB1, FBN1, FBN2, FN1, LAMA3, LAMA4, LAMB1, LAMB2, LAMC1, NID1, NID2, COL4A1, COL4A2, and COL4A6 genes in cDNA from transfected WPMY cells (using TUBA1B as an internal reference). The nucleotide sequences of the detection primers for each gene are shown in Table 2.
[0084] Table 2
[0085]
[0086] The results of real-time fluorescence quantitative PCR were shown in Figure 3 .
[0087] Figure 3 The results in Figure A show that the relative expression level of the COL4A5 gene in WPMY cells transfected with the COL4A5-Homo interference sequence (i.e., the COL4A5 interference group) was significantly downregulated compared to WPMY cells transfected with the control sequence (i.e., the control group), indicating that the COL4A5-Homo interference sequence is effective in interfering with the COL4A5 gene.
[0088] Figure 3 Results in Figure B show that compared with WPMY cells transfected with the control sequence (i.e., the control group), the relative expression levels of ITGB1, FBN1, FBN2, FN1, LAMA4, LAMB1, LAMC1, NID1, NID2, and COL4A6 genes were significantly downregulated in WPMY cells transfected with the COL4A5-Homo interference sequence (i.e., the COL4A5 interference group). This suggests that when the COL4A5 gene is inhibited, stromal cells inhibit the expression of ECM components, reducing tissue flexibility and ductility, weakening the interaction between cells and ECM, and especially damaging the basement membrane, which is not conducive to the growth of muscle fibers and weakening the strength of the abdominal wall.
[0089] Example 3: Interference with the COL4A5 gene induces cell apoptosis by inhibiting the activity of the ITGB1-FAK signaling pathway
[0090] COL4A5 protein affects the structural integrity of the basement membrane, which contains binding sites for integrins. Integrins are an important family of cell surface receptors. β1 integrins activate FAK protein through tyrosine phosphorylation, triggering downstream signaling pathways that inhibit apoptosis and promote cell survival and proliferation. Inhibition of FAK signaling leads to upregulation of pro-apoptotic factors such as caspase-3 cleavage, thereby promoting apoptosis. Therefore, in this study, Western blot analysis was used to examine the expression levels of ITGB1 protein, phosphorylation of FAK proteins involved in the signaling pathway, and caspase-3 protein expression.
[0091] The specific steps of Western blot are as follows:
[0092] 1. Take a 6-well plate containing the transfected WPMY cells obtained in Example 2, gently rinse twice with 1× PBS buffer, add 200 μL of 1× RIPA lysis buffer to each well, and let it stand on ice for 10 minutes (to achieve sufficient lysis); then centrifuge at 4°C and 12000 rpm for 10 minutes, and collect the supernatant, which is the cell lysate.
[0093] 2. Add 5× reduced SDS polyacrylamide gel electrophoresis loading buffer to the cell lysate, incubate at 70°C for 10 min, and then perform SDS-PAGE electrophoresis (110 V for 10 min, and stop at 170 V until bromophenol blue migrates to the bottom of the gel).
[0094] 3. After completing step 2, the gel protein was transferred to a PVDF membrane (transfer condition 300mA, 1h), blocked with 5% skim milk powder, and washed three times with 1×TBST; then rabbit anti-human ITGB1 antibody (Proteintech, cat. no. 12594-1-AP) for detecting ITGB1 protein, rabbit anti-human Phospho-FAK (Tyr397) antibody (CST, cat. no. 8556) for detecting tyrosine phosphorylation of FAK protein (i.e., p-FAK), rabbit anti-human FAK antibody (CST, cat. no. 3285) for detecting FAK protein, and rabbit anti-human FAK antibody (CST, cat. no. 1366) for detecting c-FAK were added. Caspase-3 antibody (Abcam, Catalog No. ab13847) for detecting aspase-3 protein, c-Caspase-3 antibody (Abcam, Catalog No. ab13847) for detecting c-Caspase-3 protein, and rabbit anti-human α-Tubulin antibody (Proteintech, Catalog No. 11224-1-AP) for detecting α-Tubulin protein were used as primary antibodies. After incubation, the cells were washed three times with 1×TBST. Finally, goat anti-rabbit IgG-HRP (SE134, Solarbio) was added as a secondary antibody and incubated. Chemiluminescence development was performed.
[0095] Western blot test results are shown in Figure 4 The results were as follows: Compared with WPMY cells transfected with the control sequence (i.e., the control group), WPMY cells transfected with the COL4A5-Homo interference sequence (i.e., the COL4A5 interference group) showed a significant downregulation of ITGB1 protein levels and a significant upregulation of caspase-3 protein cleavage levels (represented by c-Caspase-3 / caspase-3), indicating activation of the apoptosis signaling pathway. Furthermore, the phosphorylation level of FAK protein (represented by p-FAK / FAK) was significantly downregulated, indicating inhibition of the FAK signaling pathway. These results indicate that abnormally low COL4A5 expression in stromal cells not only disrupts the integrity of the ECM structure but also affects the signaling process, inducing cell apoptosis by inhibiting the activity of the FAK signaling pathway.
[0096] Example 4: Discovery of the A255C SNP site in the pig genome and establishment of a pig genotyping method based on the A255C SNP site
[0097] 1. Discovery of the A255C SNP site in the pig genome
[0098] The present invention discovered the COL4A5 gene, which affects the development of scrotal hernia in pigs, and identified a single nucleotide polymorphism (SNP) site, A255C, within the COL4A5 gene. The A255C SNP site is located at nucleotide position 255 from the 5' end of SEQ ID NO: 1 in the pig genome, at position 89062326 on the pig chromosome X, and is associated with either AA homozygous or CC homozygous genotypes.
[0099] SEQ ID NO: 1:
[0100] TTCCTTTCTGACTGGCACTTGTGATCAGATTTCTACTACTAGTTCTGCCAGGAATGGGCTATGTCATGATTTGAGGCAGTCCAACTCTACAATTTTTTTTTTTTTTTTGTCTTTTGTCTTTTCAGGGCTGTACCCACGGCACATGGAGGTTCCCAGGCTAGGGGTCTAATCGGAGCTGTTGCTACCGGCCTACACCGCAGCCACAGCAACACCAGATCCGATCCGTGTCTGCGACCTACACCACAGCTCATGGCMATGCCGGATCCTTAACCCACTGAGCGAGGCCAGAGATCGAACCCACAACCTCATGGTTCCTAGTCGGATTTGTTGACTGCTGCACCACGACGGGAACTCCAGCTCTATAATTTTTGAATCTTTTATTTCTCTTCTCTTGCTCTAGTTCCTTAAAAATAATGGGACTGAGGTTGATGGATATGAAATTATCATAATTCTATGAGTAATTAAAAGAATTATAGATGTATTTATAGAAAATGGAAAGTACAGTAGGATGTCAATAATAATTATTGTCAAAGCTAACAGGAATGTTTAGACCTACCATTAATTGGCTAACATTTGCTTCACTGG (M is A or C)
[0101] Since the genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules in reverse complement, the DNA molecule encoding protein is generally named as the sense DNA molecule; the DNA molecule reverse complementary to the sense DNA molecule is named as the antisense DNA molecule. The genotype of all sites is the genotype of the sense DNA.
[0102] II. Obtaining of primer pair for identifying A255C SNP site
[0103] According to the A255C SNP site and the nucleotide sequences before and after the A255C SNP site, a primer pair for identifying the A255C SNP site is designed and synthesized. The primer pair is composed of an upstream primer F and a downstream primer R, and is used for amplifying a target sequence including the A255C SNP site.
[0104] The nucleotide sequences of the upstream primer F and the downstream primer R are shown in Table 3.
[0105] Table 3
[0106] Primer name Nucleotide sequence (5'-3') and its position in the sequence listing Upstream primer F TTCCTTTCTGACTGGCACTTGT(SEQ ID NO:2) Downstream primer R CCAGTGAAGCAAATGTTAGCCAAT(SEQ ID NO:3)
[0107] III. Establishment of genotyping method of boar based on A255C SNP site
[0108] The inventors of the present application have established a genotyping method of boar based on A255C SNP site through a large number of experiments. The specific steps are as follows:
[0109] 1. Extracting genomic DNA of ear tissue of the boar to be tested.
[0110] 2. Using the genomic DNA of the ear tissue of the boar to be tested as a template, a primer pair composed of the upstream primer F and the downstream primer R is used for PCR amplification to obtain a PCR amplification product.
[0111] The reaction system is 25 μl, which is composed of 1 μl of genomic DNA of the ear tissue of the boar to be tested (concentration of 50 ng / μl), 1 μl of aqueous solution of upstream primer F (concentration of 10 pmol / μl), 1 μl of aqueous solution of downstream primer R (concentration of 10 pmol / μl) and 22 μl of gold medal Mix (Green). The gold medal Mix (Green) is a product of Genesee Biologics Co., Ltd., and the product catalog number is TSE101.
[0112] The reaction conditions are as follows: 94℃ for 2 min; 94℃ for 10 s, 61℃ for 5 s, 72℃ for 5 s, 30 cycles; 72℃ for 5 min.
[0113] 3. After step 2 is completed, the PCR amplification product is sequenced. According to the sequencing results, the genotype of the boar to be tested based on the A255C SNP site is determined. The specific judgment principle is as follows:
[0114] If the PCR amplification product of the boar to be tested is only C at the 255th position, the genotype of the boar to be tested based on the A255C SNP site is CC homozygote; if the PCR amplification product of the boar to be tested is only A at the 255th position, the genotype of the boar to be tested based on the A255C SNP site is AA homozygote.
[0115] Example 5, Association analysis of genotypes of 40 boars based on A255C SNP site and scrotal hernia phenotype
[0116] In this example, the ear tissues of 40 boars (including two breeds of Large White and Landrace) were collected through phenotype observation. Among the 40 boar individuals, 20 individuals were scrotal hernia and 20 individuals were healthy.
[0117] I. Detection of genotypes of 40 boars based on A255C SNP site
[0118] According to the method in Example 4, the ear tissues of the boars to be tested were replaced with ear tissue samples of 40 boars respectively, and other steps remained unchanged, to obtain the genotypes of the 40 boars based on the A255C SNP site.
[0119] Part of the sequencing peak diagram is shown in Figure 5 .
[0120] The quantitative statistical results of the genotypes of the 40 boars based on the A255C SNP site are shown in Table 4.
[0121] Table 4
[0122]
[0123] Note: P value is the significance level of chi-square test, P < 0.05 indicates significant difference.
[0124] 2. Association analysis between genotypes of 40 boars based on the A255C SNP locus and scrotal hernia phenotypes
[0125] SPSS 27 software was used to perform an association analysis between the genotypes of the 40 boars obtained in step 1, based on the A255C SNP locus, and the scrotal hernia phenotype, specifically using a chi-square test. The test results are shown in Table 4.
[0126] The results showed that the CC homozygous genotype at the A255C SNP locus had the highest frequency in the scrotal hernia population, while the AA homozygous genotype had the highest frequency in the healthy population, and the A allele frequency was much higher than that in the scrotal hernia population. This suggests that the polymorphism at the A255C SNP locus is significantly associated with the scrotal hernia phenotype, and that the CC homozygous genotype has a clear advantage in the development of scrotal hernia, making it a potential susceptible genotype.
[0127] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. A method for assessing the risk of scrotal hernia in boars, comprising the following steps: detecting whether the genotype of the boar to be tested is genotype I or genotype II, wherein the risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II; The boar of genotype I is a boar whose genotype based on the A255C SNP site is CC homozygous; The boar of genotype II is a boar whose genotype based on the A255C SNP site is AA homozygous; The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome.
2. A method for assessing the risk of scrotal hernia in boars, comprising the following steps: (1) Using the genomic DNA of the boar to be tested as a template, a primer pair consisting of an upstream primer F and a downstream primer R is used to perform PCR amplification to obtain a PCR amplification product; the PCR amplification product is detected and then evaluated as follows: If the 255th position of the PCR amplification product is only C, the genotype of the boar to be tested based on the A255C SNP site is CC homozygous; if the 255th position of the PCR amplification product is only A, the genotype of the boar to be tested based on the A255CSNP site is AA homozygous; The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome; The upstream primer F is a single-stranded DNA molecule shown in SEQ ID NO: 2; The downstream primer R is a single-stranded DNA molecule shown in SEQ ID NO: 3; (2) Based on the results of (1), determine whether the genotype of the boar to be tested is genotype I or genotype II. The risk of scrotal hernia in boars with genotype I is higher than that in boars with genotype II. The boar of genotype I is a boar whose genotype based on the A255C SNP site is CC homozygous; The boar of genotype II is a boar whose genotype based on the A255C SNP site is AA homozygous.
3. A kit for assessing the risk of scrotal hernia in boars, comprising a substance for detecting whether the genotype of the boar to be tested is genotype I or genotype II; The genotype I is based on the A255C SNP site, which is a CC homozygous type; The genotype II is based on the A255C SNP site, which is AA homozygous; The A255C SNP site is the 255th nucleotide from the 5' end of SEQ ID NO: 1 in the pig genome.
4. The kit according to claim 3, wherein: The substance for detecting whether the genotype of the boar to be tested is genotype I or genotype II is the primer pair consisting of the upstream primer F and the downstream primer R in claim 2.
5. The molecular marker shown in SEQ ID NO:
1.
6. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in assessing the risk of scrotal hernia in boars.
7. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in screening boars with a low risk of developing scrotal hernia.
8. Use of the kit according to claim 3 or 4 or the molecular marker according to claim 5 in boar breeding; the purpose of the boar breeding is to cultivate boar breeds with a low risk of or less prone to scrotal hernia.
9. The method according to claim 1 or 2, the kit according to claim 3 or 4, or the use according to any one of claims 6 to 8, characterized in that: The breed of the boar is Large White or Landrace.
10. Use of a substance that inhibits the activity and / or expression of COL4A5 protein in the preparation of a product for preventing and / or treating scrotal hernia.