Gene detection primer combination for safe medication of children, kit and application

By optimizing the primer combinations and nucleic acid mass spectrometry technology for genetic testing of safe drug use in children, the problem of drug accumulation caused by slow drug metabolism in children has been solved, and efficient and accurate multi-gene locus testing has been achieved. It is suitable for whole blood and dried blood samples, simplifies the operation process, and reduces the risk of drug side effects.

CN120758613APending Publication Date: 2025-10-10SHANDONG UNIV QILU HOSPITAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510798504.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Children metabolize drugs slowly and are prone to drug accumulation. Existing technologies lack drug detection methods suitable for children, which leads to problems such as decreased drug efficacy, inaccurate dosage, and drug contamination. Traditional detection methods also have problems with nonspecific amplification and interference peak height.

Method used

A primer combination for genetic testing of safe drug use in children was designed, including amplification primers and single-base extension primers. The gene locus arrangement and sequence were optimized, and nucleic acid mass spectrometry technology was used for detection. It covers 93 gene loci and is suitable for whole blood and dried blood samples, realizing 4-well detection.

Benefits of technology

It has achieved comprehensive testing of genes for safe drug use in children. The test results are accurate and sensitive, with a wide range of applications, simple operation, low cost, and suitable for hospitals at all levels. It has strong applicability and can complete the test within 8-10 hours, reducing the risk of drug side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758613A_ABST
    Figure CN120758613A_ABST
Patent Text Reader

Abstract

The invention provides a gene detection primer combination for safe medication of children, a kit and application, and belongs to the technical field of medication gene detection. The primer group for amplifying the safe medication gene for children comprises an amplification primer gene locus arrangement group 1 to 4, and the nucleotide sequences of the amplification primer gene locus arrangement group 1 to 4 are respectively as shown in SEQ ID NO. 1 to 54, SEQ ID NO. 55 to 102, SEQ ID NO. 103 to 146 and SEQ ID NO. 147 to 198. Aiming at comprehensive sites of safe medication genes for children, the primer combination or the kit is accurate and reliable in detection result, high in sensitivity, strong in specificity and small in required template amount, meets screening detection of a small amount of heel blood and dried blood spots of children or newborns, and is simple and objective in detection result interpretation, not easy to make mistakes, high in flux and low in cost; the requirement on the number of samples is low, detection can be carried out at any time, and the kit is suitable for clinical application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pharmacogenetic testing, and particularly relates to a primer combination for child safe medication gene testing, a kit and application. BACKGROUND

[0002] Children are the starting point of human growth and development, and each organ of the body is in the growth and development stage. The liver and kidney functions are not yet perfect, and there are significant differences between the pediatric population and adults in pharmacokinetics and pharmacodynamics. Drug metabolism in children is relatively slow, which can easily cause drug accumulation, and in severe cases, drug poisoning can occur, and even more, permanent damage to the body can occur. With the research of pharmacogenomics, more and more "gene-drug" has been elucidated, and pharmacogenomics has been more widely used in clinical practice. Therefore, it is necessary to individualize medication for children based on drug-related genes to improve the safety and effectiveness of medication.

[0003] According to the relevant data of the State Food and Drug Administration in 2017, among more than 3,500 chemical drug preparations, less than 60 are for children. 90% of the drugs on the domestic market do not have a dosage form suitable for children, and most of them are "reduced versions" of adult drugs. The organs and body functions of children are not yet mature, and there are large differences in height, weight, tissue organs, and internal organ functions among children of different ages. The metabolism of drugs is different from that of adults. Due to the lack of drug specifications and dosage forms, it is necessary to use adult drug specifications for children in clinical practice, which leads to a decrease in drug efficacy, inaccurate dosages, drug contamination, and a series of other problems.

[0004] According to survey data, the number of pediatric emergency patients and the proportion of sick children in the population are relatively large, but the proportion of children's special drugs in the pharmaceutical market is very small. The main reason is that a large number of children patients use adult drugs without specifying the usage and dosage for children, and without systematic pediatric clinical research. According to the "2016 Children's Drug Safety Survey Report", about 30,000 children are deafened each year due to unreasonable drug use, and children account for as high as 32% of the population who died from unreasonable drug use. The incidence of adverse reactions in children and newborns is much higher than that in near-adults, and the proportion of children poisoned by drugs in clinical treatment is also increasing year by year. Therefore, child safe medication gene testing is very important for providing children with reasonable, effective, safe, and economical drug treatment.

[0005] Nucleic acid mass spectrometry (NMS) is a type of mass spectrometry capable of detecting nucleic acids. It is a multiplex PCR analysis and detection system developed based on time-of-flight mass spectrometry. Its advantages of low cost, high throughput, and rapid detection have led to rapid growth in recent years. Compared to traditional molecular diagnostic methods, NMS offers advantages in multiplexing, accuracy, and high throughput. This is due to its detection principles and technical approach. First, NMS detects nucleic acid molecules directly based on molecular weight differences. Targets can be distinguished as long as their molecular weights after amplification are different, unlike traditional qPCR, which is limited by the number of fluorescent channels. Therefore, NMS can typically analyze 30 to 50 or more targets. Second, due to its two-step amplification reaction and direct mass detection, NMS offers exceptional accuracy and specificity, as well as strong resistance to interference, making it suitable for analyzing low-abundance targets in complex backgrounds.

[0006] According to statistics from the China Deaf Children Rehabilitation Center, approximately 30,000 children in my country become deafened each year due to improper medication use, plunging them into a world of silence. Of the over one million deaf and mute children, over 30% suffer from the toxic side effects of improper medication. Drug-induced deafness often occurs because these children are carriers of drug-induced deafness genes, namely, those with mitochondrial mutations A1555G or C1494T. Aminoglycosides such as streptomycin, gentamicin, and kanamycin are ototoxic and can damage children's auditory nerves. Therefore, specialized screening for newborn carriers of the aminoglycoside deafness gene can effectively prevent drug-induced deafness. Nucleic acid time-of-flight mass spectrometry, with its high number of loci, high sensitivity, high throughput, and minimal time, is a suitable method for screening newborns for deafness genes in children for safe medication use. Summary of the Invention

[0007] In view of this, the object of the present invention is to provide a primer combination, a kit and an application for gene detection of safe medication for children.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a primer set for amplifying a gene for safe medication for children. The primer set includes amplification primer gene site arrangement groups 1 to 4, wherein the nucleotide sequence of the amplification primer gene site arrangement group 1 is shown as SEQ ID NOs. 1 to 54; the nucleotide sequence of the amplification primer gene site arrangement group 2 is shown as SEQ ID NOs. 55 to 102; the nucleotide sequence of the amplification primer gene site arrangement group 3 is shown as SEQ ID NOs. 103 to 146; and the nucleotide sequence of the amplification primer gene site arrangement group 4 is shown as SEQ ID NOs. 147 to 198.

[0010] The application has higher detection effect in detecting ultra-low concentration samples (less than 5 ng / μL) through primer optimization, and the specific scheme is as follows: for 6 gene sites with poor detection effect, after a pair of amplification primers is added, two pairs of amplification primers with different TM values at the same site are realized, denaturation and extension at different temperatures are realized, and the amplification efficiency is improved.

[0011] The application provides a primer combination for child safe medication gene detection, which comprises a single base extension primer for child safe medication gene detection and the amplification primer for child safe medication gene detection in claim 1; the single base extension primer comprises single base extension primer gene site arrangement groups 1-4; the nucleotide sequence of the single base extension primer gene site arrangement group 1 is shown as SEQ ID NO. 199-273; the nucleotide sequence of the single base extension primer gene site arrangement group 2 is shown as SEQ ID NO. 274-339; the nucleotide sequence of the single base extension primer gene site arrangement group 3 is shown as SEQ ID NO. 340-402; and the nucleotide sequence of the single base extension primer gene site arrangement group 4 is shown as SEQ ID NO. 403-478.

[0012] The application provides a kit for detecting child safe medication genes, which comprises the primer group for amplifying child safe medication genes or the primer combination for child safe medication gene detection.

[0013] The application detects the polymorphism of child safe medication genes by using the primer group for amplifying child safe medication genes, the primer combination for child safe medication gene detection or the kit, and has the following advantages: first, the application is comprehensive for the sites of child safe medication genes and covers at least the pathogenic mutation types with high incidence in Chinese population statistically summarized in all the latest databases, guidelines or expert consensus; second, the detection result is accurate and reliable, has high sensitivity and strong specificity, requires less template amount, meets the screening and detection of small amount of heel blood or dry blood pieces of children or newborns; in addition, the detection operation is simple and fast, the result interpretation is simple and objective, is not prone to error, has high throughput and low cost, requires low sample number, can be detected at any time, is suitable for clinical application, so that the child safe medication gene detection of local hospitals at all levels can be carried out in time and conveniently, as many children or newborn populations as possible are covered for screening and diagnosis, and reasonable suggestions can be given to guide the clinic, so that the drugs that may cause serious side effects are avoided, and the harm of taking medicine is minimized.

[0014] Preferably, the concentration of each primer in the primer set for amplifying the child safety drug gene is 0.3 to 3 μM, and further preferably 0.4 to 2.5 μM, such as 0.5 μM, 1 μM or 2 μM; the concentration of each primer in the primer combination for child safety drug gene detection is 5 to 20 μM. The specific primer concentrations can be found in the molar concentrations in Table 2.

[0015] In the present invention, the kit further includes a PCR reaction mixture, a digestion reaction mixture, and a single-base extension reaction mixture. In one embodiment, the PCR reaction mixture includes 10× PCR buffer containing MgCl2, dNTP Mix, and PCR enzyme; the digestion reaction mixture includes SAP buffer and SAP enzyme; and the single-base extension reaction mixture includes iPLEX Buffer Plus, iPLEX Termination mix, and iPLEX Pro Enzyme. The present invention does not specifically limit the sources of the various components in the above-mentioned PCR reaction mixture, digestion reaction mixture, and single-base extension reaction mixture; commercially available products in this field can be used.

[0016] The present invention also provides a use of the above-mentioned primer set for amplifying a gene for safe medication for children, a primer combination for detecting a gene for safe medication for children, or a kit in the preparation of a product for detecting polymorphisms of a gene for safe medication for children. In the present invention, the product includes a reagent or a kit.

[0017] The present invention comprehensively identifies the sites of genes for safe drug use in children, including ADD1rs4961G>T, VKORC1rs9923231C>T, CYP2C19rs4986893G>A, AGTR1rs5186A>C, ALDH2rs671G>A, IFNL4rs11881222A>G, CYP2D6rs28371725C>T, CYP3A4rs4646437G>A, G6PDrs398123546G>A, SCN1Ars3812718C>T, HTR1Ars6295C>G, APOErs429358T>C, ABCB1rs104 5642G>A, CYP4F2rs2108622C>T, UGT2B15rs1902023A>C, GLCCI1rs37973G>A, GCLCrs761142A>C, LTC4Srs730012A>C, DRD2rs1799978T>C, NAT2rs179 9930G>A, TPMTrs1142345T>C, HLA-B5801rs78489254C>T, UGT1Ars10929303C>T, CRHR1rs1876828C>T, NAT2rs1799931G>A, HLA-A1502rs3909184T>C , CYP2C19rs12248560C>T, G6PDrs137852327C>T, CYP3A5rs776746G>A, CYP2D6rs5030865C>T, MT-RNR1rs267606618T>C, MTHFRrs1801133C>T, CYP2D 6rs16947G>A, ADORA2Ars2298383C>T, NUDT15rs116855232C>T, G6PDrs72554665C>A, ACErs4343A>G, G6PDrs1050828C>T, UGT1A4rs2011425T>G, UGT 1Ars1042640G>C, G6PDrs137852342G>A, CYP2D6rs1058164G>C, MT-RNR1rs267606617A>G, G6PDrs137852314C>T, G6PDrs137852340T>C, SLC22A8rs1 1568482T>A, IFNL4rs12979860C>T, KCNJ11rs5219C>T, MT-RNR1rs267606619C>T, PEAR1rs12041331G>A, CYP2D6rs1065852G>A, G6PDrs72554664C>T,GRIK4rs1954787C>T, INFL3rs8099917T>G, ABCC2rs717620C>T, ITPArs1127354C>A, NAT2rs1801280T>C, FKBP5rs4 713916G>A, SCN2Ars2304016A>G, ​​MC4Rrs489693C>A, salbutamolrs6988229C>T, CRHR2rs7793837A>T, CYP1A1rs26 06345C>A, HLA-A3101rs17179220G>A, CYP3A4rs2242480C>T, PPARGrs1801282C>G, EPHX1rs2234922A>G, CYP2B6rs 3745274G>T, CYP2D6rs3892097C>T, CYP2C9rs1799853C>T, NOSIAPrs10919035C>T, LTA4Hrs2660845G>A, CYP2C19rs 4244285G>A, CYP2D6rs1135840G>C, C11orf65rs11212617C>A, MTHFRrs1801131A>C, NAT2rsl041983C>T, ADRB2rs1 042713G>A, APOErs7412C>T, ANKK1rs1800497G>A, SLCO1B1rs4149056T>C, ADRB1rs1801253C>G, ABCB1rs2032582A >T\C, EPHX1rs1051740T>C, SCN1Ars2298771T>C, ALOX5rs2115819G>A, CYP2C9rs1057910A>C, COMTrs4680G>A, NUDT15rs186364861G>A, GP1BArs6065C>T, VKORC1rs9934438A>G, G6PDrs137852331T>C and OPRM1rs1799971A>G.

[0018] In the present invention, the test sample includes whole blood, oral swab or dried blood film, and the kit of the present invention can be used to detect samples with a sample concentration of less than 5 ng / μL.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) The present invention provides a kit for detecting genes for safe drug use in children based on nucleic acid mass spectrometry technology, which effectively expands the number of gene sites detected to 93 sites. Compared with the previous detection range, the detection is more comprehensive and covers a wider range of drugs used by children, making the detection more applicable.

[0021] (2) The gene loci tested are commonly used drugs for children, including drug-induced deafness genes, common antibiotics such as gentamicin, and antiviral drugs such as isoniazid. The detection is more comprehensive and faster. It achieves the detection volume that can only be achieved in a sequencer. At the same time, there is no need to accumulate samples, and a single sample can also be tested. Sequencing detection usually takes at least 1 week to produce results, while nucleic acid mass spectrometry detection only takes 8 to 10 hours to produce results, greatly improving its clinical applicability.

[0022] (3) In nucleic acid mass spectrometry, multi-site detection is often subject to nonspecific amplification, nonspecific extension of single-base extension primers, and primer dimers, which can interfere with the test results by causing excessively high interference peaks and insufficient single-base extension. The present invention addresses the difficulty of mutual interference between sites by using a primer optimization protocol, four groups of gene site arrangements, and sequence adjustments. This results in a detection kit that can detect 93 gene sites using four wells, ensuring no interference between multiple sites.

[0023] (5) The present invention selects 126 drugs with clear pathogenic clinical significance and the most commonly used drugs in Chinese children. After multiple screening and optimization of amplification primers and single-base extension primer combinations, 93 sites can be detected in 4 wells; after multiple optimization and improvement of pretreatment reagents, multiple components can be premixed, which significantly improves the stability and repeatability of micro-system preparation and detection, is easy to operate, and effectively reduces the threshold for use and difficulty of getting started; the whole process completes sample detection within 8 to 10 hours, with high detection throughput and easy to promote and apply on a large scale.

[0024] (6) In addition to being applicable to whole blood samples, the kit of the present invention can also be applied to the detection of dried blood samples, which only requires a small amount of sample for detection. Dried blood samples have the advantages of small blood collection volume, easy transportation and storage, and are more suitable for blood collection from children. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs12248560;

[0026] Figure 2 This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs1801253;

[0027] Figure 3This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs429358;

[0028] Figure 4 This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs1801133;

[0029] Figure 5 This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs12041331;

[0030] Figure 6 This is a comparison of the effects before and after optimization of the amplification primers for the gene locus rs4961;

[0031] Figure 7 This is the time-of-flight mass spectrometry detection image of the gene locus rs1042713 of the S1 sample;

[0032] Figure 8 This is the Sanger sequencing map of the gene locus rs1042713 of the S1 sample;

[0033] Figure 9 This is the time-of-flight mass spectrometry detection image of the gene locus rs1042713 of the S2 sample;

[0034] Figure 10 This is the Sanger sequencing map of the gene locus rs1042713 of the S2 sample;

[0035] Figure 11 This is the time-of-flight mass spectrometry detection image of the gene locus rs11568482 of the S1 sample;

[0036] Figure 12 This is the Sanger sequencing map of the gene locus rs11568482 of the S1 sample;

[0037] Figure 13 This is the time-of-flight mass spectrometry detection image of the gene locus rs11568482 of the S2 sample;

[0038] Figure 14 This is the Sanger sequencing map of the gene locus rs11568482 of the S2 sample;

[0039] Figure 15 This is the time-of-flight mass spectrometry detection image of the gene locus rs78489254 of the S1 sample;

[0040] Figure 16 This is the Sanger sequencing map of the gene locus rs78489254 of the S1 sample;

[0041] Figure 17 This is the time-of-flight mass spectrometry detection image of the gene locus rs78489254 of the S2 sample;

[0042] Figure 18 This is the Sanger sequencing map of the gene locus rs78489254 of the S2 sample;

[0043] Figure 19 This is the time-of-flight mass spectrometry detection image of the gene locus rs137852340 of the S1 sample;

[0044] Figure 20 This is the Sanger sequencing map of the gene locus rs137852340 of the S1 sample;

[0045] Figure 21 This is the time-of-flight mass spectrometry detection image of the gene locus rs137852340 of the S2 sample;

[0046] Figure 22 This is the Sanger sequencing map of the gene locus rs137852340 of the S2 sample;

[0047] Figure 23 This is the time-of-flight mass spectrometry detection image of the gene locus rs10929303 of the S1 sample;

[0048] Figure 24 This is the Sanger sequencing map of the gene locus rs10929303 of the S1 sample;

[0049] Figure 25 This is the time-of-flight mass spectrometry detection image of the gene locus rs10929303 of the S2 sample;

[0050] Figure 26 This is the Sanger sequencing map of the gene locus rs10929303 of the S2 sample;

[0051] Figure 27 This is the time-of-flight mass spectrometry detection image of the gene locus rs8099917 of the S1 sample;

[0052] Figure 28 This is the Sanger sequencing map of the gene locus rs8099917 of the S1 sample;

[0053] Figure 29 This is the time-of-flight mass spectrometry detection image of the gene locus rs8099917 of the S2 sample;

[0054] Figure 30 This is the Sanger sequencing map of the gene locus rs8099917 of the S2 sample. DETAILED DESCRIPTION

[0055] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0056] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0057] Example 1

[0058] A primer set for amplifying a gene for safe medication use in children. The present invention detects 93 gene loci for medication use in children and designs amplification primers using four gene locus arrangement groups and sequence adjustment. The sequence information of the amplification primers is shown in Table 1.

[0059] Table 1 Amplification primer sequences for pediatric drug safety gene testing (4 wells, i.e., 4 site arrangement groups)

[0060]

[0061]

[0062]

[0063]

[0064] Example 2

[0065] A primer combination for genetic testing of safe medication for children, the primer combination consisting of an amplification primer for genetic testing of safe medication for children and a single-base extension primer for genetic testing of safe medication for children;

[0066] The present invention detected 93 pediatric drug use gene loci and designed a combination of amplification primers and single-base extension primers using a 4-locus permutation group and sequence adjustment approach.

[0067] The amplification primers are the primer set for amplifying the pediatric drug safety gene described in Example 1. The specific amplification primer sequence information is shown in Table 1, and the single-base extension primer sequence information for pediatric drug safety gene detection is shown in Table 2.

[0068] Table 2 Sequences of single-base extension primers for pediatric drug safety gene testing and their quality values ​​and concentrations (4 wells represent 4 site arrangement groups)

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] Example 3

[0077] A kit for genetic testing of safe drug use in children, comprising the following components:

[0078] (1) Nucleic acid sample pretreatment reagents for time-of-flight mass spectrometry detection system (purchased from Agena, USA, catalog number 10160F) include the following main components, see Table 3:

[0079] Table 3 Nucleic acid sample pretreatment reagents for time-of-flight mass spectrometry detection system

[0080]

[0081] (2) Amplification reaction primer premix: The amplification reaction primer premix is ​​TJ amplification primer (93-site synthetic PCR primer mixture), which is divided into 4 groups, namely amplification reaction primer premix 1 to 4. The amplification reaction primer premix 1 is a mixture of primers with nucleotide sequences as shown in SEQ ID NOs. 1 to 54, and the concentration of each primer is 0.5 μM; the amplification reaction primer premix 2 is a mixture of primers with nucleotide sequences as shown in SEQ ID NOs. 55 to 102, and the concentration of each primer is 0.5 μM; the amplification reaction primer premix 3 is a mixture of primers with nucleotide sequences as shown in SEQ ID NOs. 103 to 146, and the concentration of each primer is 0.5 μM; the amplification reaction primer premix 4 is a mixture of primers with nucleotide sequences as shown in SEQ ID NOs. 147 to 198, and the concentration of each primer is 0.5 μM.

[0082] (3) Single base extension reaction primer premix: The single base extension reaction primer premix is ​​a TJ extension primer (93-site synthetic UEP primer mixture), which is divided into 4 groups, namely single base extension reaction primer premixes 1 to 4. The single base extension reaction primer premix 1 is a mixture of primers with nucleotide sequences such as SEQ ID NOs. 199 to 273; the single base extension reaction primer premix 2 is a mixture of primers with nucleotide sequences such as SEQ ID NOs. 274 to 339; the single base extension reaction primer premix 3 is a mixture of primers with nucleotide sequences such as SEQ ID NOs. 340 to 402; the single base extension reaction primer premix 4 is a mixture of primers with nucleotide sequences such as SEQ ID NOs. 403 to 478. For the specific molar concentration of each primer shown in SEQ ID NOs. 199 to 478, please refer to Table 2.

[0083] (4) Desalting resin: including cation exchange resin powder to remove salt ions from the extension reaction solution;

[0084] (5) Detection chip: including a silicon-based chip containing 96 detection points with pre-spotted matrix (i.e. mass spectrometry chip in Table 3);

[0085] (6) Standard control: containing 93 site fragments of human child safety drug genes with known genotypes by SANGER sequencing, concentration of 1 ng / μL;

[0086] The human child safety drug gene fragments were extracted by the nucleic acid extraction reagent with the product number M202 purchased from Jifan Biotechnology (Beijing) Co., Ltd. and sequenced.

[0087] (7) Pure mutation control: containing 93 site mutant homozygous human child safety drug gene corresponding plasmid aqueous solution, concentration of 1 ng / μL;

[0088] Table 4 Gene fragments used for constructing pure mutation control and wild type control plasmids in well site 1

[0089]

[0090]

[0091] Table 5 Gene fragments used for constructing pure mutation control and wild type control plasmids in well site 2

[0092]

[0093]

[0094] Table 6 Gene fragments used for constructing pure mutation control and wild type control plasmids in well site 3

[0095]

[0096]

[0097]

[0098] Table 7 Gene fragments used for constructing pure mutation control and wild type control plasmids in well site 4

[0099]

[0100]

[0101] For example, the gene fragment required for constructing the plasmid is searched in the NCBI database according to the RS number or the sequence shown in the Alleles column of the RS number, such as the gene site ABCB1rs1045642 (G>A). The sequence constructed in the present invention, with the RS number rs1045642 shown in the Alleles column as the center, consisting of 27 bases to the left and 43 bases to the right, is TATGTTGGCCTCCTTTGCTGCCCTCACRATCTCTTCCTGTGACACCACCCGGCTGTTGTCTCCATAGGCAA (SEQ ID NO.479), where R represents A / G.

[0102] The gene fragment used to construct a pure wild-type control at gene locus ABCB1rs1045642 (G>A) was: TATGTTGGCCTCCTTTGCTGCCCTCACAATCTCTTCCTGTGACACCACCCGGCTGTTGTCTCCATAGGCAA (SEQ ID NO.480).

[0103] The gene fragment used to construct the pure mutation control at gene locus ABCB1rs1045642 (G>A) was: TATGTTGGCCTCCTTTGCTGCCCTCACGATCTCTTCCTGTGACACCACCCGGCTGTTGTCTCCATAGGCAA (SEQ ID NO.481).

[0104] The gene fragment used to construct the pure wild-type control at gene locus CYP2C19rs12248560 (C>T) was GCAGTGATGGAGAAGGGAGAACTCTTATTTTTTCTCATGAGCATCTCTGGGGCTGTTTTCCTTAGATAAATAAAGTGGTTCTATTTAATGTGAAGCCTGTTTTATGAACAGGATGAATGTGGTATATATTCAGAATAACTAATGTTTGGAAGTTGTTTTGTTTTGCTAAAACAAAGTTTTAGCAAACGATTTTTTTTTTCAAATTTGTGTCTTCTGTTCTCAAAGCATCTCTGATGTAAGAGATAATGCGCCACGATGGGCATCAGAAGACCTCAGCTCAAATCCCAGTTCTGCCAGCTAT (SEQ ID NO.482).

[0105] The gene fragment used to construct the pure mutation control of gene locus CYP2C19rs12248560 (C>T) was GCAGTGATGGAGAAGGGAGAACTCTTATTTTTTCTCATGAGCATCTCTGGGGCTGTTTTCCTTAGATAAAIAAGTGGTTCTATTTAATGTGAAGCCTGTTTTATGAACAGGATGAATGTGGTATATATTCAGAATAACTAATGTTTGGAAGTTGTTTTGTTTTGCTAAAACAAAGTTTTAGCAAACGATTTTTTTTTTCAAATTTGTGTCTTCTGTTCTCAAAGTATCTCTGATGTAAGAGATAATGCGCCACGATGGGCATCAGAAGACCTCAGCTCAAATCCCAGTTCTGCCAGCTAT (SEQ ID NO.483).

[0106] The gene fragment used to construct the pure wild-type control at gene locus ADRB1rs1801253 (C>G) was: TTCAACCCCATCATCTACTGCCGCAGCCCCGACTTCCGCAAGGCCTTCCAGGGACTGCTCTGCTGCGCGCGCAGGGCTGCCCGCCGGCGCCACGCGACCCACGGAGACCGGCCGCGCGCCTCGGGCTGTCTGGCCCGGCCCGGACCCCCGCCATCGCCCGGGGCCGCCTCGGACGACGACGACGACGAT (SEQ ID NO.484).

[0107] The gene fragment used to construct the pure wild-type control at gene locus ADRB1rs1801253 (C>G) was: TTCAACCCCATCATCTACTGCCGCAGCCCCGACTTCCGCAAGGCCTTCCAGCGACTGCTCTGCTGCGCGCGCAGGGCTGCCCGCCGGCGCCACGCGACCCACGGAGACCGGCCGCGCGCCTCGGGCTGTCTGGCCCGGCCCGGACCCCCGCCATCGCCCGGGGCCGCCTCGGACGACGACGACGACGAT (SEQ ID NO.485).

[0108] The gene fragments disclosed in Tables 4-7 and the gene fragments shown in SEQ ID NO. 480-485 were introduced into the empty vector pUC57 by the conventional end-stick method, and Shanghai Generay Biotech Co., Ltd. was commissioned to construct the pure wild control and homozygous mutant control.

[0109] (8) Hybrid control: containing 93 site mutation homozygous human child safety drug gene corresponding plasmid aqueous solution and 93 site wild homozygous human child safety drug gene corresponding plasmid aqueous solution mixed in a ratio of 1:1, the concentration is 1 ng / μL;

[0110] (9) Pure wild control: containing 93 site wild homozygous human child safety drug gene corresponding plasmid aqueous solution, the concentration is 1 ng / μL.

[0111] Example 4

[0112] The method for detecting child safety drug genes by using the kit described in Example 3 is as follows:

[0113] The DNA in the dried blood film was extracted by using a whole blood extraction kit (purchased from Shanghai Generay Biotech Co., Ltd.), and the DNA sample was measured for concentration. The sample concentration was 0.005 ng / μL, and the DNA sample was obtained.

[0114] Each test reaction system was prepared as follows:

[0115] (1) PCR reaction: (total volume of PCR amplification reaction system: 5 μL).

[0116] According to the following Table 8, the PCR amplification reaction reagents were taken out, melted at room temperature, vortexed and mixed, and the corresponding volume of reaction solution was prepared according to the number of test samples. After the preparation of the PCR reaction mixture was completed, 4 μL of each reaction was transferred to different reaction wells, and 1 μL of the corresponding DNA sample was added, with a total volume of 5 μL. Among them, 1 μL of nuclease-free water was added to the NTC well, and the PCR amplification was labeled and performed. The PCR amplification program is shown in Table 9.

[0117] Table 8 PCR amplification reaction system

[0118]

[0119] Table 9 PCR amplification reaction program

[0120]

[0121] (2) SAP reaction: (total volume after adding digestion reaction mixture: 7 μL).

[0122] After the PCR amplification, the digestion system was configured according to Table 10, and after the preparation was completed, it was mixed uniformly, 2 μL of the digestion reaction mixture was added to each reaction well, and the digestion reaction was carried out. At this time, the total volume of the PCR reaction tube was 7 μL, and the SAP reaction program was shown in Table 11.

[0123] Table 10 Digestion system

[0124]

[0125] Table 11 SAP reaction program

[0126] SAP reaction steps temperature time Phase 1 37℃ 40 minutes Phase 2 85℃ 5 minutes Phase 3 4℃ Insulation

[0127] (3) Extension reaction: (total volume after adding extension reaction system: 9 μL).

[0128] After the digestion reaction was completed, the reagents required for single base extension reaction were taken out according to Table 12, and the extension reaction system was configured after being melted at room temperature. After the preparation was completed, it was mixed uniformly, 2 μL of the single base extension reaction mixture was added to each reaction well for extension reaction, and the extension reaction program was shown in Table 13. At this time, the total volume of the reaction tube was 9 μL.

[0129] Table 12 Extension reaction system

[0130]

[0131] Table 13 Extension reaction program

[0132]

[0133] Each large cycle contains 52°C, 5 seconds; 80°C, 5 seconds, 5 small cycles.

[0134] (4) The fourth step: 30 μL (96-well PCR plate) or 16 μL (384-well PCR plate) water was added to each sample-containing well of the sample plate, and then centrifuged. The instrument was used for sample desalting, sample spotting to the chip, and mass spectrometer data acquisition.

[0135] (5) Product loading and analysis

[0136] The time-of-flight mass spectrometry system was used for mass spectrometry detection, and the result analysis was carried out according to the operation instruction.

[0137] The result file analyzed by the mass spectrometer was imported into the sample result report system, and the sample result report was issued.

[0138] Example 5

[0139] Optimization of pediatric safe drug gene detection primers.

[0140] When using dried blood smears to collect samples from children, the sample extraction DNA concentration is often low (sample concentration <5 ng / μL), resulting in poor results at some detection sites, insufficient amplification, and fewer PCR products, which in turn leads to insufficient single-base extension. To address this situation, this example optimizes the amplification primers by adding a pair of amplification primers to each of the six gene loci with a higher frequency of the above situation (gene loci rs12248560, rs1801253, rs429358, rs1801133, rs12041331, and rs4961). That is, before the adjustment, the amplification primer sequences corresponding to the gene loci rs12248560, rs1801253, rs429358, rs1801133, rs12041331 and rs4961 are shown as SEQ ID NO.57-58, SEQ ID NO.173-174, SEQ ID NO.25-26, SEQ ID NO.71-72, SEQ ID NO.107-108 and SEQ ID NO.1-2, respectively (see Table 1 for specific sequences); after the adjustment, the amplification primer sequences corresponding to the gene loci rs12248560, rs1801253, rs429358, rs1801133, rs12041331 and rs4961 are shown as SEQ ID NO.57-60, SEQ ID NO.173-176, SEQ ID NO.25-28, SEQ ID NO.71-74, SEQ ID NO.107~110 and SEQ ID NO.1~4 (for specific sequences, see Table 1).

[0141] The amplification primer sequences before and after adjustment are used to detect the pediatric drug safety gene, respectively. For specific detection methods, see Example 4.

[0142] The adjusted amplification primer sequences are all the sequences in Table 1.

[0143] The amplification primer sequences before adjustment were the same as those in Table 1 except that rs12248560, rs1801253, rs429358, rs1801133, rs12041331, and rs4961 were the sequences shown in SEQ ID NOs. 57-58, SEQ ID NOs. 173-174, SEQ ID NOs. 25-26, SEQ ID NOs. 71-72, SEQ ID NOs. 107-108, and SEQ ID NOs. 1-2.

[0144] Figures 1 to 6The results showed that compared with the sequence before adjustment, when the template was amplified at a lower concentration (sample concentration <5 ng / μL) using the adjusted amplification primer sequence (i.e., the primer set for amplifying the pediatric safe drug use gene as described in Example 1), the gene sites with poor effects were improved, and no nonspecific amplification and nonspecific extension occurred.

[0145] Example 6

[0146] Accuracy test of genetic testing for safe medication use in children using the kit described in Example 3

[0147] Two control samples (human genomic DNA samples with a measured concentration of 0.005 ng / μL) included in the kit were obtained; the accuracy of the method described in Example 4 of the present invention for detecting pediatric drug safety gene loci was verified using Sanger sequencing, a gold standard for sequencing, and the results were compared with the mass spectrometry results. Control sample S1 was obtained from a healthy one-day-old boy. Genomic DNA was extracted from the boy's whole blood using a nucleic acid extraction reagent purchased from Jifan Biotechnology (Beijing) Co., Ltd., catalog number M202, as specified in the instructions.

[0148] The control substance S2 was a healthy girl aged 2 years old, and the genomic DNA in the girl's whole blood was extracted according to the instructions of the nucleic acid extraction reagent with the product number M202 purchased from Jifan Biotechnology (Beijing) Co., Ltd.

[0149] The comparison results are as follows:

[0150] Table 14 Mass spectrometry results and Sanger sequencing results of nucleic acid samples from well 1 S1-S2

[0151]

[0152] Table 15 Mass spectrometry results and Sanger sequencing results of nucleic acid samples from well 2 S1-S2

[0153]

[0154]

[0155] Table 16 Mass spectrometry results and Sanger sequencing results of nucleic acid samples from well 3 S1-S2

[0156]

[0157]

[0158] Table 17 Mass spectrometry results and Sanger sequencing results of nucleic acid samples at well 4 S1-S2

[0159]

[0160] At the same time, due to space limitations, some S1~S2 gene loci rs1042713, rs11568482, rs78489254, rs137852340, rs10929303 and rs8099917 time-of-flight mass spectrometry detection images and Sanger sequencing images are attached.

[0161] The results in Tables 14 to 17 show that the results of the two reference substances in detecting genes for safe medication use in children are completely consistent with the expected results, with an accuracy of 100%, indicating that the accuracy of the results of the kit and detection system of the present invention in detecting genes for safe medication use in children is 100%.

[0162] In summary, the present invention provides a primer combination and detection kit for detecting genes for safe drug use in children. The detection has high sensitivity, strong specificity, and high accuracy. It can detect human gDNA nucleic acid samples as low as 0.005 ng / μL, which can save precious blood samples from children and newborns; 93 sites can achieve 4-well detection with an accuracy of 100%; pre-mixing of multiple components greatly simplifies the system preparation and operation difficulty of detection personnel during clinical application, is easy to operate, and effectively reduces the usage threshold and difficulty of getting started; an integrated detection platform is equipped with the function of simple and fast operation, automatic detection and analysis of results, and issuance of personalized medication reports. The result analysis and publication are simple and objective, and not prone to errors; the system has high throughput, low cost, outstanding practicality, and broad clinical application prospects. It is particularly suitable for large-scale promotion and application nationwide, meeting the needs of hospitals at all levels with different economic levels to conveniently carry out gene mutation detection for children's drug use, covering as many children or newborns as possible for screening and diagnosis, thereby guiding clinicians to give reasonable suggestions, avoid drugs that may cause serious side effects, and minimize the harm of taking medicines.

[0163] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer set for amplifying a gene for safe drug use in children, characterized in that: The primer set includes amplification primer gene site arrangement groups 1 to 4, the nucleotide sequence of the amplification primer gene site arrangement group 1 is shown as SEQ ID NOs. 1 to 54; the nucleotide sequence of the amplification primer gene site arrangement group 2 is shown as SEQ ID NOs. 55 to 102; the nucleotide sequence of the amplification primer gene site arrangement group 3 is shown as SEQ ID NOs. 103 to 146; and the nucleotide sequence of the amplification primer gene site arrangement group 4 is shown as SEQ ID NOs. 147 to 198.

2. A primer combination for genetic testing of safe drug use in children, characterized in that: The primer combination includes a single-base extension primer for genetic testing of safe drug use in children and an amplification primer for genetic testing of safe drug use in children according to claim 1; the single-base extension primer includes single-base extension primer gene site arrangement groups 1 to 4; the nucleotide sequence of the single-base extension primer gene site arrangement group 1 is shown as SEQ ID NOs.199 to 273; the nucleotide sequence of the single-base extension primer gene site arrangement group 2 is shown as SEQ ID NOs.274 to 339; the nucleotide sequence of the single-base extension primer gene site arrangement group 3 is shown as SEQ ID NOs.340 to 402; and the nucleotide sequence of the single-base extension primer gene site arrangement group 4 is shown as SEQ ID NOs.403 to 478.

3. A kit for detecting genes for safe drug use in children, characterized in that: The kit comprises the primer set for amplifying a gene for safe medication for children according to claim 1 or the primer combination for detecting a gene for safe medication for children according to claim 2.

4. The kit according to claim 3, wherein The concentration of each primer in the primer set for amplifying the gene for safe medication for children is 0.3 to 3 μM; the concentration of each primer in the primer combination for detecting the gene for safe medication for children is 5 to 20 μM.

5. The kit according to claim 3, characterized in that The kit also includes a PCR reaction mixture, a digestion reaction mixture and a single base extension reaction mixture.

6. The kit according to claim 5, characterized in that The PCR reaction mixture includes 10×PCR buffer containing MgCl2, dNTP Mix and PCR enzyme; the digestion reaction mixture includes SAP buffer and SAP enzyme; the single base extension reaction mixture includes iPLEX Buffer Plus, iPLEX Termination mix and iPLEX ProEnzyme.

7. Use of the primer set for amplifying a gene for safe medication for children according to claim 1, the primer combination for detecting a gene for safe medication for children according to claim 2, or the kit according to any one of claims 3 to 6 in the preparation of a product for detecting gene polymorphisms for safe medication for children.

8. The use according to claim 7, characterized in that The SNP sites of the said gene include ADD1 rs4961 G>T, VKORC1 rs9923231 C>T, CYP2C19 rs4986893 G>A, AGTR1 rs5186 A>C, ALDH2 rs671 G>A, IFNL4 rs11881222 A>G, CYP2D6 rs28371725 C>T, CYP3A4 rs4646437 G>A, G6PD rs398123546 G>A, SCN1A rs3812718 C>T, HTR1A rs6295 C>G, APOE rs429358 T>C, ABCB1 rs1045642 G>A, CYP4F2 rs2108622 C>T, UGT2B15 rs1902023 A>C, GLCCI1 rs37973 G>A, GCLC rs761142 A>C, LTC4S rs730012 A>C, DRD2 rs1799978 T>C, NAT2 rs1799930 G>A, TPMT rs1142345 T>C, HLA-B5801 rs78489254 C>T, UGT1A rs10929303 C>T, CRHR1 rs1876828 C>T, NAT2 rs1799931 G>A, HLA-A1502 rs3909184 T>C, CYP2C19 rs12248560 C>T, G6PD rs137852327 C>T, CYP3A5 rs776746 G>A, CYP2D6 rs5030865 C>T, MT-RNR1 rs267606618 T>C, MTHFR rs1801133 C>T, CYP2D6 rs16947 G>A, ADORA2A rs2298383 C>T, NUDT15 rs116855232 C>T, G6PD rs72554665 C>A, ACE rs4343 A>G, G6PD rs1050828 C>T, UGT1A4 rs2011425 T>G, UGT1A rs1042640 G>C, G6PD rs137852342 G>A, CYP2D6 rs1058164 G>C, MT-RNR1 rs267606617 A>G, G6PD rs137852314 C>T, G6PD rs137852340 T>C, SLC22A8 rs11568482 T>A, IFNL4 rs12979860 C>T, KCNJ11 rs5219 C>T, MT-RNR1 rs267606619 C>T, PEAR1 rs12041331 G>A, CYP2D6 rs1065852One or more of G>A, G6PD rs72554664 C>T, GRIK4 rs1954787 C>T, INFL3 rs8099917 T>G, ABCC2 rs717620 C>T, ITPA rs1127354 C>A, NAT2 rs1801280 T>C, FKBP5 rs4713916 G>A, SCN2A rs2304016 A>G, MC4R rs489693 C>A, salbutamol rs6988229 C>T, CRHR2 rs7793837 A>T, CYP1A1 rs2606345 C>A, HLA-A3101 rs17179220 G>A, CYP3A4 rs2242480 C>T, PPARG rs1801282 C>G, EPHX1 rs2234922 A>G, CYP2B6 rs3745274 G>T, CYP2D6 rs3892097 C>T, CYP2C9 rs1799853 C>T, NOSIA rs10919035 C>T, LTA4H rs2660845 G>A, CYP2C19 rs4244285 G>A, CYP2D6 rs1135840 G>C, C11orf65 rs11212617 C>A, MTHFR rs1801131 A>C, NAT2 rs1041983 C>T, ADRB2 rs1042713 G>A, APOE rs7412 C>T, ANKK1 rs1800497 G>A, SLCO1B1 rs4149056 T>C, ADRB1 rs1801253 C>G, ABCB1 rs2032582 A>T / C, EPHX1 rs1051740 T>C, SCN1A rs2298771 T>C, ALOX5 rs2115819 G>A, CYP2C9 rs1057910 A>C, COMT rs4680 G>A, NUDT15 rs186364861 G>A, GP1BA rs6065 C>T, VKORC1 rs9934438 A>G, G6PD rs137852331 T>C, and OPRM1 rs1799971 A>G.

9. The use according to claim 7, characterized in that The test sample includes whole blood, oral swab or dried blood spot.