A SNP molecular marker for regulating sheep horn length and its application
By detecting specific SNP molecular markers in the sheep genome, the problem of horn length selection in sheep breeding has been solved, enabling early genotyping, optimizing breeding results and breeding management, and improving the survival adaptability and economic benefits of sheep.
Patent Information
- Application Number
- CN202511281592.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-09-09
AI Technical Summary
The lack of SNP molecular markers directly related to sheep horn length in existing technologies makes it difficult to accurately select individuals with ideal horn lengths in sheep breeding, affecting their survival adaptability and breeding management efficiency.
The SNP molecular marker at position 35071069 on chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0 is provided. By detecting the T/C mutation type, PCR amplification is performed using a specific primer set, and the genotype is distinguished by fluorescence signal, thus achieving accurate identification of sheep horn length.
It enables early and accurate identification of sheep horn length genotypes, breaks through the phenotypic measurement bottleneck of traditional breeding, optimizes the adaptability of breeding models, reduces ineffective feeding costs, and enhances the population's resilience and economic benefits.
Smart Images

Figure CN120758645B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to an SNP molecular marker for regulating sheep horn length and its application. Background Technology
[0002] In the field of animal morphology, the study of horn length has not received sufficient attention compared to other physiological characteristics, and research reports on this topic both domestically and internationally are relatively limited. As a prominent external feature, animal horns, besides serving as weapons in combat, may also be closely related to many factors such as sexual selection and environmental adaptation. In nature, most animals have moderately long or small horns; however, some special animal species, such as certain wild animal species and some ruminants in high-altitude environments, possess unusually long horns. Long horns may help gain an advantage in territorial disputes or intraspecific competition, especially in relatively vast and fiercely competitive environments. Long-horned animals can use the prominence of their horns to intimidate opponents and attract mates, thus gaining more opportunities in reproduction and survival competition. Simultaneously, the specificity of horn length and structure may also have a potential connection to an animal's perception of its surroundings and its regulation of its own balance.
[0003] In the specific species of sheep, differences in horn length are also a product of adaptive evolution. Traditionally, sheep horns were considered to be of moderate length, but in-depth observation of different breeds has revealed significant differences in horn length. These differences are likely influenced by a combination of factors, including the sheep's living environment, genetic makeup, and long-term human breeding selection. Sheep with moderately long horns may have achieved a relative balance in survival and reproduction, while sheep with excessively long or short horns may exhibit unique advantages and disadvantages under specific environmental conditions. For example, in complex and varied terrain, excessively long horns may hinder a sheep's movement, affecting its efficiency in avoiding predators and foraging for food; while in scenarios where horn display is necessary to compete for mates or territory, moderate horn length may be insufficient to meet the demands of survival competition.
[0004] With the rapid development of molecular biology and genomics technologies, marker-assisted animal breeding has become a reality. In-depth research into the genetic mechanisms of sheep horn length can not only reveal the genetic mysteries behind horn length variations but also play a crucial role in sheep breeding practices, namely, precisely selecting sheep individuals with ideal horn length characteristics to better adapt to specific ecological environments and meet the production and management requirements of animal husbandry. Therefore, genetic research on sheep horn length has significant practical application value and potential scientific research significance; however, detailed reports on this topic remain relatively scarce. Summary of the Invention
[0005] The main objective of this invention is to provide a SNP molecular marker related to sheep horn length. Using this SNP molecular marker, gene selection can be performed precisely, thereby efficiently breeding sheep with ideal horn lengths, thus overcoming the technical deficiency of the prior art in lacking SNP molecular markers directly related to sheep horn length.
[0006] The present invention employs the following technical solutions to achieve the above objectives:
[0007] The first aspect of this invention provides an SNP molecular marker that affects sheep horn length. The SNP molecular marker is a T / C mutation at locus 35071069 on chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0. When the genotype of the polymorphic site of the SNP molecular marker is TT or CC, the sheep horn length is large; when the genotype is TC, the sheep horn length is small.
[0008] A second aspect of the present invention provides a primer set for detecting SNP molecular markers associated with sheep horn length, the primer set comprising: a forward primer F1 with the nucleotide sequence shown in SEQ ID NO. 1, a forward primer F2 with the nucleotide sequence shown in SEQ ID NO. 2, and a reverse primer R with the nucleotide sequence shown in SEQ ID NO. 3.
[0009] Furthermore, the physical location of the SNP molecular marker is based on the 35071069th site on chromosome 17 of the sheep reference genome version ARS-UI_Ramb_v2.0, and the polymorphism of this site is T / C.
[0010] Furthermore, the 5' end of the forward primer F1 is linked to the FAM-tail universal fluorescent tag sequence, and the 5' end of the forward primer F2 is linked to the HEX-tail universal fluorescent tag sequence.
[0011] A third aspect of the present invention provides a detection kit containing the above-described primer set for detecting SNP molecular markers related to sheep horn length.
[0012] The fourth aspect of the present invention provides any of the following applications of the above-described primer set and the above-described detection kit:
[0013] (1) Application in sheep horn length determination;
[0014] (2) Application in molecular marker-assisted breeding of sheep.
[0015] The fifth aspect of the present invention provides a method for identifying sheep horn length, the method comprising: using the DNA of the sheep to be tested as a template, performing PCR amplification on it using the above-mentioned primer set; directly distinguishing genotypes and the correlation between the genotypes and sheep horn length by fluorescence signals, thereby identifying sheep horn length.
[0016] Furthermore, the genotypes include TT genotype, CC genotype and TC genotype, wherein when the genotype is TT or CC, the sheep horn length is large horn type; when the genotype is TC, the sheep horn length is small horn type.
[0017] The beneficial effects of this invention are:
[0018] Sheep horn length is closely related to their survival adaptability and husbandry management: large-horned individuals in free-range environments can effectively resist predator attacks through horn defense, reducing the risk of lambs being preyed upon, while the small-horned phenotype significantly reduces the mortality rate caused by fighting in intensive farming, while also optimizing the utilization of pen space. Using the SNP molecular markers provided by this invention, horn length-related genotypes (TT / TC / CC) can be accurately identified during the lambing stage, overcoming the technical bottleneck of traditional breeding methods that rely on post-maturity phenotypic measurements. These markers support early selection of breeding sheep with target horn length characteristics, enabling targeted breeding of adaptable strains for different farming models (such as highland grazing and factory farming), and reducing ineffective feeding costs through genotyping. Furthermore, the marker data can deeply analyze the molecular regulatory network of horn development, providing cross-dimensional genetic information for sheep disease resistance breeding and behavioral characteristic research, ultimately achieving synergistic optimization of population resilience and livestock economic benefits. Attached Figure Description
[0019] Figure 1 This is the genotyping diagram from Example 1;
[0020] Figure 2 Box plot showing the association between SNPs and sheep horn length phenotype in Example 1. Detailed Implementation
[0021] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0022] Example 1: Identification of sheep horn length using the SNP molecular marker chr17: 35071069
[0023] 1. Experimental subjects: A total of 35 small-tailed Han sheep were selected (Table 3).
[0024] 2. SNP molecular marker detection:
[0025] (1) Collect 5 mL of sheep venous blood and extract DNA using the traditional CTAB method. Calculate the DNA stock solution based on the concentration and mix it evenly with nuclease-free water to a concentration of 20 ng / ul. Dilute the primer powder to 100 uM with nuclease-free water, and then prepare the primer mixture according to the ratio of F1:F2:R:water = 24:24:48:100.
[0026] Forward primer F1 (SEQ ID NO. 1):
[0027] GAAGGTCGGAGTCAACGGATTCGGCTATCTGTTGCCTCTAGGT;
[0028] Forward primer F2 (SEQ ID NO. 2):
[0029] GAAGGTGACCAAGTTCATGCTGGCTATCTGTTGCCTCTAGGC;
[0030] Reverse primer R (SEQ ID NO. 3):
[0031] GAAACTGGATTAGTCCCATTCTAAA.
[0032] (2) Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using specific primers for SNP molecular markers. The amplification system is shown in Table 1, and the amplification program is shown in Table 2. The PCR products were obtained.
[0033] Table 1 PCR amplification system
[0034]
[0035] Table 2 PCR amplification program
[0036]
[0037] (3) After the PCR amplification cycle, under an environment below 40℃, the fluorescence value was read using a real-time PCR instrument, and the PCR products were sequenced. Then, the sequencing results were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller). Based on the sample cluster and fluorescence type, the genotypes were divided into three types: TT, TC, and CC. Figure 1 As shown.
[0038] (4) Result determination: After removing the three samples with the genotype CC that lacked horn length data and the Unused sample, the sheep horn length was determined to be either large-horned or small-horned based on the different genotypes; sheep with the genotype TT or CC were large-horned; and sheep with the genotype TC were small-horned.
[0039] Table 3. Marking and identification of 35 Small-tailed Han sheep
[0040]
[0041] SNP correlation analysis of sheep horn length as follows Figure 2 As shown in the figure, sheep with the TT or CC gene at locus 35071069 on chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0 are large-horned, with an average horn length of 40.1 cm for sheep with the TT gene and 28.3 cm for sheep with the CC gene. Sheep with the TC gene at locus 35071069 on chromosome 17 of the sheep reference genome ARS-UI_Ramb_v2.0 are small-horned, with an average horn length of 9.7 cm. The differences in horn length based on gene distribution are significant.
Claims
1. The application of a primer set for detecting SNP molecular markers related to sheep horn length in the identification of sheep horn length, characterized in that, The primer set includes: forward primer F1 with nucleotide sequence SEQ ID NO. 1, forward primer F2 with nucleotide sequence SEQ ID NO. 2, and reverse primer R with nucleotide sequence SEQ ID NO. 3; the sheep is a small-tailed Han sheep.
2. The application according to claim 1, characterized in that, The physical location of the SNP molecular marker is based on the locus at position 35071069 on chromosome 17 of the sheep reference genome version ARS-UI_Ramb_v2.0, where the polymorphism is T / C.
3. The application according to claim 1, characterized in that, The 5' end of the forward primer F1 is linked to the FAM-tail universal fluorescent tag sequence, and the 5' end of the forward primer F2 is linked to the HEX-tail universal fluorescent tag sequence.
4. The application of a detection kit containing the primer set described in claim 1 for detecting SNP molecular markers related to sheep horn length in sheep horn length identification, characterized in that, The sheep in question are small-tailed Han sheep.
5. A method for determining the length of sheep horns, characterized in that, The method includes: using the DNA of the sheep to be tested as a template, performing PCR amplification on it using the primer set described in claim 1; directly distinguishing genotypes and the correlation between the genotypes and sheep horn length by fluorescence signals, and identifying sheep horn length.
6. The method according to claim 5, characterized in that, The genotypes include TT, CC, and TC. When the genotype is TT or CC, the sheep horn length is large; when the genotype is TC, the sheep horn length is small.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to size of sheep horn and application of SNP molecular marker
CN118547079A
SNP (Single Nucleotide Polymorphism) molecular marker related to sheep horn length character and application thereof
CN119320831A