Base editing of thyroxine transporter gene
Editing the TTR gene through the base editor system overcomes the limitations of existing treatments for thyroxine transporter amyloidosis, realizes gene editing treatment for polyneuropathy and cardiomyopathy, reduces amyloid fibril deposition, and provides a one-step gene editing treatment plan.
Patent Information
- Application Number
- CN202380090528.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-11
- Filing Date
- 2023-11-10
- Publication Date
- 2025-10-10
AI Technical Summary
Existing treatments for transthyretin amyloidosis (including polyneuropathy and cardiomyopathy) are limited and do not offer a one-step cure, and existing medical therapies such as liver transplantation, drug stabilizers, and gene silencing drugs have limitations.
A base editor system was used to edit the TTR gene using guide RNA and Cas9 protein encoding deaminase. A lipid nanoparticle delivery system was used to target the editing system to the liver, modifying the TTR gene to stabilize its tetrameric structure and avoid misfolding and aggregation.
Gene editing of thyroxine transporter amyloidosis has been achieved, reducing or preventing the extracellular deposition of amyloid fibrils, providing effective treatment for polyneuropathy and cardiomyopathy, and has the potential advantage of one-step gene editing treatment.
Smart Images

Figure BPA0000376588860000021 
Figure BPA0000376588860000031 
Figure BPA0000376588860000041
Abstract
Description
[0001] Related Applications
[0002] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 383,394, filed November 11, 2022, the entire contents of which are incorporated herein by reference.
[0003] SEQUENCE LISTING
[0004] The instant application contains a Sequence Listing which has been submitted electronically in XML format and which is hereby incorporated by reference in its entirety. The Sequence Listing XML file, created on November 10, 2023, is named 180802-046902PCT_SL.XML and is 5,147,724 bytes in size. BACKGROUND
[0005] Thyroxine transport protein (TTR) is a 55-kDa transporter of both thyroxine (T4) and retinol binding proteins that circulates in soluble form in the serum and cerebrospinal fluid (CSF) of healthy humans. Under normal circumstances, TTR protein circulates as a homotetramer. Hereditary transthyretin amyloidosis (hATTR) is a disease caused by mutations in the gene encoding TTR. Autosomal dominant mutations destabilize the TTR tetramer and enhance dissociation into monomers, leading to misfolding, aggregation, and subsequent extracellular deposition of TTR amyloid fibrils in different locations. This multisystem extracellular deposition of amyloid causes dysfunction of different organs and tissues. In particular, polyneuropathy (ATTR-PN) and cardiomyopathy (ATTR-CM) caused by transthyretin amyloidosis are serious conditions associated with significant morbidity and mortality.
[0006] Since TTR is primarily produced by the liver, an early treatment approach for treating hATTR amyloidosis is liver transplantation. Other therapies include administration of oral drugs that act as kinetic stabilizers of the TTR tetramer (such as tafamidis and diflunisal), as well as suppression of TTR protein synthesis using gene silencing drugs (such as small interfering RNA (siRNA) (patisiran) and antisense oligonucleotides (inotersen)).
[0007] The present invention recognizes that a gene editing approach for treating transthyretin amyloidosis, including both polyneuropathy and cardiomyopathy, has the potential to provide a one-step, cure-all treatment with superior outcomes over existing treatments. SUMMARY
[0008] Provided herein are compositions for genetic modification or editing, and methods of using the compositions to treat or prevent a disorder associated with extracellular deposition of amyloid fibrils formed from misfolded transthyretin (TTR) protein aggregates in various tissues. Such disorders include, but are not limited to, hereditary transthyretin amyloidosis with polyneuropathy (hATTR-PN) and hereditary cardiomyopathy with transthyretin amyloidosis (hATTR-CM), both of which are associated with autosomal dominant mutations in the TTR gene; and age-related cardiomyopathy associated with wild-type TTR protein (ATTRwt), which is also known as senile cardiac amyloidosis. Disclosed are compositions and methods involving editing the TTR gene using an editing system, such as an editing system comprising a base editor and a guide RNA.
[0009] In some aspects, provided herein is a base editor system for modifying a target transthyretin (TTR) gene, the base editor system comprising a guide RNA comprising a sequence defined by:
[0010]
[0011] wherein A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2'-O-methyladenosine, mC* is 2'-O-methylcytidine, mG* is 2'-O-methylguanosine, mU* is 2'-O-methyluridine, and wherein the nucleotides represented by bold are connected by phosphorothioate (PS) backbone linkages,
[0012] The guide RNA directs the base editor system to effect a nucleobase change in the TTR gene.
[0013] In some aspects, provided herein is a guide RNA comprising a sequence defined by:
[0014]
[0015] wherein A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2'-O-methyladenosine, mC* is 2'-O-methylcytidine, mG* is 2'-O-methylguanosine, mU* is 2'-O-methyluridine, and wherein the nucleotides represented by bold are connected by phosphorothioate (PS) backbone linkages,
[0016] The guide RNA directs the base editor system to effect a nucleobase change in the TTR gene.
[0017] An engineered, non-naturally occurring base editing system for modifying a target transthyretin (TTR) gene, the base editing system comprising (a) a guide RNA molecule having a sequence defined by
[0018] mG*mC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 11); and (b) a codon-optimized nucleic acid encoding a Cas9 protein fused to a deaminase, wherein the Cas9 protein fusion is capable of binding to the guide RNA and is capable of editing a target TTR sequence complementary to the guide RNA.
[0019] In some embodiments, the deaminase comprises a cytosine deaminase or an adenine deaminase.
[0020] In some embodiments, the Cas9 protein is a catalytically impaired Cas9 protein.
[0021] In some embodiments, the Cas9 protein is a dead Cas9 or a nickase Cas9.
[0022] In some embodiments, the cytosine or adenine deaminase is a deoxycytidine or deoxyadenosine deaminase.
[0023] In some embodiments, the Cas9 is fused to ABE8.8.
[0024] In some embodiments, provided herein is a lipid nanoparticle (LNP) comprising the system described herein.
[0025] In some embodiments, the LNP comprises an ionizable amino lipid, a neutral helper lipid, a PEG-lipid, a sterol lipid, and / or a GalNAc lipid.
[0026] In some embodiments, the ionizable amino lipid is VL422 or LP-01, the neutral helper lipid is DSPC, the PEG lipid is PEG 2000 -DMG, the sterol lipid is cholesterol, and the GalNAc lipid is DSG-PEG-Lys-tri(GalNAc).
[0027] In some embodiments, the ionizable lipid is LP-01 (or CIN16645) defined by the following structure,
[0028]
[0029] In some embodiments, the LNP comprises an N:P ratio of between about 1:40 and about 1:1.
[0030] In some embodiments, the LNP comprises an N:P ratio of about 1:6.
[0031] In some embodiments, provided is a pharmaceutical composition comprising the LNP as described herein.
[0032] In some aspects, provided herein is a method of editing a TTR gene in a cell, the method comprising contacting the cell with an LNP comprising (a) a guide RNA molecule having a sequence defined by mG*mC*mC*AUCCUCGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 11); and
[0033] (b) A base editor system comprising a codon-optimized nucleic acid encoding a Cas9 protein fused to a deaminase, wherein the Cas9 protein fusion is capable of binding to the guide RNA and is capable of editing a target nucleic acid sequence complementary to the guide RNA.
[0034] In some embodiments, provided herein is a method of treating a disease or condition comprising administering to a subject in need thereof a pharmaceutical composition described herein.
[0035] In some embodiments, the disease or condition is hereditary transthyretin amyloidosis, cardiomyopathy, polyneuropathy, or senile cardiac amyloidosis.
[0036] In some embodiments, the pharmaceutical composition is administered by a route selected from intravenous, intradermal, transdermal, intranasal, intramuscular, subcutaneous, transmucosal, or oral.
[0037] In some embodiments, the LNP is delivered to the liver. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1A 、 Figure 1B and Figure 1CGeneral schematic of a gene editor complexed with a gRNA targeting a gene of interest. The Cas9 protein, guide RNA, spacer sequence, protospacer sequence, and PAM (protospacer adjacent motif) are identified. Figure 1A ) are disclosed. Figure 1A SEQ ID NO: 5760 is disclosed. Additionally, a schematic diagram illustrating the general principle of base editing using a cytosine base editor (CBE) Figure 1B ) and an adenine base editor (ABE) Figure 1C ) is shown.
[0039] Figure 2 Changes to a splice donor site caused by base editing. The top panel represents normal splicing of RNA transcribed from a gene. The bottom panel represents splicing that can result from transcription of a gene that has a disrupted splice site due to editing.
[0040] Figure 3 A human TTR gene (hTTR gene) map showing various restriction enzyme recognition sites, exons 1-4, and the locations of single guide RNAs GA457, GA459, GA460, and GA461 specified in Table 1.
[0041] Figure 4 The nucleotide sequence of the human TTR gene (UniProtKB - P02766 (TTHY HUMAN)) from the human reference genome (GRCh38) is shown, and the region of the gene on which guides GA457, GA459, GA460, and GA461 reside is delineated. Figure 4 SEQ ID NO: 5761 is disclosed.
[0042] Figures 5A-5C A schematic diagram showing the TTR guide and editing positions for GA457 Figure 5A ), GA460 Figure 5B ), and GA461 Figure 5C ). The human genomic DNA (gDNA) sequence is labeled in black. The guide sequence is highlighted in gray above. The genomic exon sequence is represented in uppercase letters, and the intron sequence is represented in lowercase letters. The primary positions targeted for editing by ABE are labeled with black arrows. FIG. 5 discloses SEQ ID NOs 1, 5762, 4, 5763, 5, and 5764, respectively, in order of appearance.
[0043] Figure 6is a graph representing the percentage of splice editing performed in human liver cells using ABE editing with single guide RNAs GA457, GA459, GA460, and GA461 guide RNAs. The three TTR guide RNAs GA457, GA460, and GA461 show high activity in human liver cells. Each of the guides in this set employs the same tracr sequence, and differ only in their RNA spacer sequence, which corresponds to the specified DNA spacer sequence on the TTR gene targeted.
[0044] Figure 7 is a flowchart of the ONE-seq protocol for determining candidate off-target sites.
[0045] Figure 8 is a comparative schematic of GA519 and GA457 hybridization to NHP and human TTR exon 1. Figure 8 SEQ ID NOs 1, 5765, 2, and 5766 are disclosed in the order of appearance, respectively.
[0046] Figure 9 is a comparative schematic of GA520 and GA460 hybridization to NHP and human TTR exon 3. Figure 9 SEQ ID NOs 5767-5768 and 5767-5768 are disclosed in the order of appearance, respectively.
[0047] Figure 10 is a bar graph showing liver editing of the TTR gene in non-human primates (NHPs) by LNP1 and LNP2 as described in the Examples.
[0048] Figure 11 is a bar graph showing serum TTR protein changes as measured by ELISA in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0049] Figure 12 is a bar graph showing serum TTR protein changes as measured by mass spectrometry in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0050] Figures 13A-13B is a bar graph showing serum alanine transaminase (ALT) ( Figure 13A ) and serum aspartate transaminase (AST) ( Figure 13B ) concentrations in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0051] Figures 14A-14B is a bar graph showing serum lactate dehydrogenase (LDH) ( Figure 14A) and serum glutamate dehydrogenase (GDH) Figure 14B
[0052] Figures 15A-15B is a histogram showing serum gamma-glutamyl transferase (GGT) Figure 15A ) and serum alkaline phosphatase (AP) Figure 15B ) concentrations in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0053] Figure 16 is a histogram showing serum total bilirubin concentrations in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0054] Figure 17 is a histogram showing serum creatine kinase concentrations in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0055] Figure 18 showing serum cytokine concentrations (MCP-1, upper left panel; IL-6, upper right panel; IP-10, lower left panel; and IL-1RA, lower right panel) in NHPs treated with LNP1 and LNP2 as described in the Examples over time.
[0056] Figures 19A-19B is a plot of plasma pharmacokinetics of iLipid Figure 19A ) and PEG lipid Figure 19B ) in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0057] Figure 20 is a histogram showing liver editing of the TTR gene by LNP3 in NHPs as described in the Examples.
[0058] Figure 21 is a plot showing serum TTR protein changes measured by ELISA in NHPs treated with LNP3 as described in the Examples.
[0059] Figure 22 is a plot showing serum TTR protein changes measured by liquid chromatography-mass spectrometry in NHPs treated with LNP3 as described in the Examples.
[0060] Figures 23A-23B is a histogram showing serum alanine transaminase (ALT) Figure 23A ) and serum aspartate transaminase (AST) Figure 23B ) concentrations in NHPs treated with LNP3 as described in the Examples.
[0061] Figures 24A-24B is a bar graph showing serum lactate dehydrogenase (LDH) ( Figure 24A ) and serum glutamate dehydrogenase (GDH) ( Figure 24B ) concentrations in NHPs treated with LNP3 as described in the Examples.
[0062] Figures 25A-25B is a bar graph showing serum gamma-glutamyltransferase (GGT) ( Figure 25A ) and serum alkaline phosphatase (AP) ( Figure 25B ) concentrations in NHPs treated with LNP3 as described in the Examples.
[0063] Figure 26 is a bar graph showing serum total bilirubin concentrations in NHPs treated with LNP2 as described in the Examples.
[0064] Figure 27 is a bar graph showing serum creatine kinase concentrations in NHPs treated with LNP3 as described in the Examples.
[0065] Figures 28A-28B is a plot of plasma pharmacokinetics of iLipid ( Figure 28A ) and PEG lipid ( Figure 28B ) in NHPs treated with LNP1 and LNP2 as described in the Examples.
[0066] Figure 29 is a graph showing the percentage of base editing in primary human hepatocytes at various total RNA doses (ng / TA / ml), where GA521 was provided as a guide RNA. GA521 showed sustained base editing of over 40% in primary human hepatocytes. DETAILED DESCRIPTION
[0067] Provided herein are compositions for genetic modification or editing, and methods of using the compositions to treat or prevent a disorder associated with extracellular deposition of amyloid fibrils formed from misfolded transthyretin (TTR) protein in various tissues. Such disorders include, but are not limited to, polyneuropathy (hATTR-PN) caused by hereditary transthyretin amyloidosis and hereditary cardiomyopathy (hATTR-CM) caused by transthyretin amyloidosis, both of which are associated with autosomal dominant mutations in the TTR gene, and age-related cardiomyopathy (ATTRwt) associated with wild-type TTR protein, also known as senile cardiac amyloidosis. Disclosed are compositions and methods involving editing the TTR gene using an editing system, such as an editing system comprising a base editor and a guide RNA.
[0068] definition
[0069] The following are definitions of some terms used throughout this disclosure.In some cases, terms are defined in other areas of this specification outside of this "Definitions" section.
[0070] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. It should also be noted that the term "or / or" is generally used in its sense including "and / or" unless the context clearly dictates otherwise. As used herein, the terms "and / or" and "any combination thereof" and their grammatical equivalents are used interchangeably. These terms can convey that any combination is specifically contemplated. For illustrative purposes only, the following phrases "A, B, and / or C" or "A, B, C, or any combination thereof" may mean "A alone; B alone; C alone; A and B; B and C; A and C; and A, B, and C." Unless the context specifically indicates separate use, the term "or / or" may be used in conjunction or disjunction.
[0071] The term "about" or "approximately" can mean within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which error range will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to the practice in the art, "about" can mean within 1 or more than 1 standard deviation. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly for biological systems or processes, the term can mean within an order of magnitude, within 5 times, and more preferably within 2 times of a value. Where specific values are described in the application and claims, the term "about" means that it should be assumed to be within an acceptable error range for the specific value unless otherwise stated.
[0072] As used in the specification and in one or more claims, the word “comprising” (and any form of comprising, such as “comprise” and “comprises”) “having” (and any form of having, such as “have” and “has”) “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in the specification can be implemented with respect to any method or composition of the disclosure, and vice versa. Furthermore, compositions of the disclosure can be used to achieve methods of the disclosure.
[0073] An article, composition, method, etc. that comprises one or more components can consist of those components or can consist essentially of those components. As used in the specification and in one or more claims, “consisting of’ (and any form of “consisting of”, such as “consists of” and “consists of”) means including and limited to. As used in the specification and in one or more claims, an article, composition, method, etc. “consisting essentially of’ (and any form of “consisting essentially of”, such as “consists essentially of” and “consists essentially of”) means including the recited listed components; such as components, compounds, materials, steps, etc., and can include additional components that do not materially affect the basic and novel characteristics of the article, composition, method, etc.
[0074] References in the specification to “some embodiments”, “an embodiment”, “one embodiment”, “embodiment”, or “other embodiments” mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least some embodiments, but not necessarily all embodiments, of the disclosure.
[0075] The words "preferred" and "preferably" refer to embodiments of the invention that can provide certain benefits under certain circumstances. However, other embodiments can also be preferred, under the same or other circumstances. Additionally, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude those other embodiments from the scope of the invention.
[0076] The term "nucleic acid" as used herein refers to a polymer in either single or double stranded form containing at least two nucleotides (i.e., deoxyribonucleotides or ribonucleotides) and includes DNA and RNA. A "nucleotide" contains a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together by phosphate groups x "Base" includes purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, including but not limited to modifications that place new reactive groups, such as but not limited to amines, alcohols, thiols, carboxylates, and alkyl halides. Nucleic acids include those containing known nucleotide analogs or modified backbone residues or linkages or modified sugar residues, or non-classical / chemically modified nucleobases, and combinations thereof, which are synthetic, naturally occurring, and non-naturally occurring, and have similar binding properties to reference nucleic acids. Examples of such analogs and / or modified residues include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral-methyl phosphonates, 2'-O-methyl ribonucleotides, and peptide nucleic acids (PNAs).
[0077] The term "nucleic acid" includes any oligonucleotide or polynucleotide, having fragments containing up to 60 nucleotides, commonly referred to as oligonucleotides, as well as longer fragments, referred to as polynucleotides. Deoxyribo-oligonucleotides are composed of 5-carbon sugars called deoxyribose, which are covalently linked to phosphate on the 5' and 3' carbons of the sugar to form an alternating unbranched polymer. DNA can be in the form of, for example, an antisense molecule, plasmid DNA, preconcentrated DNA, PCR product, vector, expression cassette, chimeric sequence, chromosomal DNA, or derivatives and combinations of these groups. Ribo-oligonucleotides are composed of similar repeating structures in which the 5-carbon sugar is ribose. Thus, the terms "polynucleotide" and "oligonucleotide" can refer to a polymer or oligomer of nucleotide or nucleoside monomers consisting of naturally occurring bases, sugars, and intemucleosidic (backbone) linkages. The terms "polynucleotide" and "oligonucleotide" can also include polymers or oligomers comprising functionally similar non-naturally occurring monomers or portions thereof. Such modified or substituted oligonucleotides are often preferred over native forms because of characteristics such as, for example, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases. It is understood that the terms "polynucleotide" and "oligonucleotide" can also include polymers or oligomers comprising combinations of deoxy and ribonucleotides or variants thereof in combination with backbone modifications such as those described herein.
[0078] "Nucleic acid" as described herein may include one or more nucleotide variants, including one or more non-standard nucleotides, one or more non-natural nucleotides, one or more nucleotide analogs and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-ausouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 1-methylinos ...1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylinosine, 1-methylin
[0014] In some cases, the nucleotides may comprise modifications in their phosphate moieties, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications with thiol moieties (e.g., α-thiotriphosphate and β-thiotriphosphate).
[0079] Nucleic acid as described herein can be modified at base moiety (for example, at one or more atoms that can form hydrogen bond with complementary nucleotide usually and / or at one or more atoms that can not form hydrogen bond with complementary nucleotide usually), sugar moiety or phosphate backbone.Backbone modification can include but is not limited to phosphorothioate, phosphorodithioate, selenophosphate, diselenide, aniline thiophosphate (phosphoroanilothioate), aniline phosphate (phosphoraniladate), phosphoramidate and diaminophosphoroate linkage.Phosphorothioate linkage replaces the non-bridging oxygen in phosphate backbone with sulphur atom, and delays the nuclease degradation of oligonucleotide.Diaminophosphoroate linkage (N3'→P5') prevents nuclease recognition and degraded.Backbone modification can also include that peptide bond replaces the phosphorus (for example, the N-(2-aminoethyl)-glycine unit that is connected by the peptide bond in peptide nucleic acid) in backbone structure, or the linking group including carbamate, amides and straight chain and cyclic alkyl. Oligonucleotides with modified backbones are reviewed in Micklefield, Curr. Med. Chem., 8(10): 1157-79, 2001 and Lyer et al., Curr. Opin. Mol. Ther., 1(3): 344-358, 1999. The nucleic acid molecules described herein can contain sugar moieties comprising ribose or deoxyribose as found in naturally occurring nucleotides, or modified sugar moieties or sugar analogs. Modified sugar moieties include, but are not limited to, 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminoethyl, 2'-fluoro, N3'→P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'2'dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidiniumethyl, carbamate-modified sugars, and bicyclic-modified sugars. 2'-O-methyl or 2'-O-methoxyethyl modifications promote A-type or RNA-like conformations in oligonucleotides, increase binding affinity to RNA, and have enhanced nuclease resistance. Modified sugar moieties can also include those with additional bridges (e.g., a methylene bridge connecting the 2'-O and 4'-C atoms of the ribose in locked nucleic acids) or sugar analogs such as morpholine rings (e.g., as in diaminophosphoryl morpholinos).
[0080] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixed-base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)).
[0081] The present disclosure encompasses isolated or substantially purified nucleic acid molecules and compositions containing those molecules. As used herein, an "isolated" or "purified" DNA molecule or RNA molecule is a DNA molecule or RNA molecule that exists apart from its native environment. An isolated DNA molecule or RNA molecule can exist in purified form or can exist in a non-native environment, such as, for example, a transgenic host cell. For example, an "isolated" or "purified" nucleic acid molecule, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or is substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (i.e., sequences located at the 5' and 3' ends of the nucleic acid).
[0082] As used herein, the terms “protein,” “polypeptide,” and “peptide” are used interchangeably and refer to a polymer of amino acid residues connected via peptide bonds and can consist of two or more polypeptide chains. The terms “polypeptide,” “protein,” and “peptide” refer to a polymer of at least two amino acid monomers linked together by amide bonds. The amino acids can be L-optical isomers or D-optical isomers. More specifically, the terms “polypeptide,” “protein,” and “peptide” refer to a molecule composed of two or more amino acids in a specific order (e.g., as determined by the base sequence of nucleotides in a gene or RNA that encodes the protein). Proteins are essential for the structure, function, and regulation of the body’s cells, tissues, and organs, and each protein has a unique function. Examples are hormones, enzymes, antibodies, and any fragments thereof. In some cases, a protein can be a portion of a protein, such as a domain, subdomain, or motif of a protein. In some cases, a protein can be a variant (or mutation) of a protein, in which one or more amino acid residues are inserted into, deleted from, and / or substituted into the naturally occurring (or at least known) amino acid sequence of the protein. A protein or variant thereof can be naturally occurring or recombinant. Methods for detecting and / or measuring polypeptides in biological materials are well known in the art and include, but are not limited to, Western blots, flow cytometry, ELISA, RIA, and various proteomic techniques. An exemplary method of measuring or detecting a polypeptide is an immunoassay, such as an ELISA. Protein quantitation of this type can be based on antibodies capable of capturing a specific antigen and a secondary antibody capable of detecting the captured antigen.
[0083] The term “subject” or “patient” encompasses a mammal. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates (such as chimpanzees, and other apes and monkey species); farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
[0084] A "subject in need thereof" is an individual having a disease, symptom of a disease, or predisposition to a disease for the purpose of curing, healing, alleviating, alleviating, altering, remedying, improving, modifying, or influencing the disease, symptom of a disease, or predisposition to a disease. In some embodiments, the subject has hereditary transthyretin amyloidosis (hATTR). In some embodiments, the subject has cardiomyopathy caused by transthyretin amyloidosis (ATTR-CM). In some embodiments, the subject has polyneuropathy caused by transthyretin amyloidosis (ATTR-PN). In some embodiments, the subject has wild-type ATTR (ATTRwt), i.e., age-related deposition of wild-type TTR protein (formerly known as senile amyloidosis).
[0085] As used herein, "administering" and its grammatical equivalents can refer to providing one or more replication-competent recombinant adenoviruses or pharmaceutical compositions described herein to a subject or patient. By way of example and not limitation, "administering" can be by intravenous (iv) injection, subcutaneous (sc) injection, intradermal (id) injection, intraperitoneal (ip) injection, intramuscular (im) injection, intravascular injection, intracerebroventricular (icv) injection, intrathecal (it) injection, infusion (inf.), oral route (po), topical (top.) administration, or rectal (pr) administration. One or more such routes can be used.
[0086] The term "parenteral" as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intraventricular, intrathecal, intralesional and intracranial injection or infusion techniques. Parenteral administration can be, for example, by bolus injection or by gradual perfusion over time. In addition, it can be administered to a subject by an injectable depot route of administration (such as using a 1, 3 or 6 month injectable depot or biodegradable materials and methods).
[0087] The terms "treat," "treating," or "treatment," and grammatical equivalents thereof, as used herein, can include prophylactically and / or therapeutically alleviating, reducing, or ameliorating at least one symptom of a disease or condition, preventing additional symptoms, inhibiting the disease or condition (e.g., arresting the development of the disease or condition, relieving the disease or condition, causing the regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition. "Treatment" can refer to administration of a composition comprising nanoparticles, such as lipid nanoparticles (LNPs), to a subject after the onset or suspected onset of a disease or condition. "Treatment" includes the concept of "palliation," which refers to reducing the frequency or severity of any symptoms or other adverse effects associated with a disease or condition or side effects associated with the disease or condition. The term "treatment" also encompasses the concept of "management," which refers to reducing the severity of a particular disease or condition in a patient or delaying its recurrence, for example, lengthening the remission period of a patient already suffering from the disease. The term "treatment" further encompasses the concepts of "prevent," "preventing," and "prevention." It is to be appreciated that while not precluded, treating a condition or disease does not require complete ablation of the condition, disease, or symptoms associated therewith.
[0088] As used herein, the terms "prevent," "preventing," "prevention," and the like refer to reducing the probability of onset of a disease or condition in a subject who does not have, but is at risk of or susceptible to, the disease or condition.
[0089] The term "ameliorating" as used herein can mean reducing, suppressing, attenuating, lessening, preventing, or stabilizing the development or progression of a disease.
[0090] "Delaying" the development of a disease, as used herein, means to defer, hinder, slow, retard, stabilize, and / or postpone the progression of a disease. The length of time for such delay can vary, depending on the history of the disease and / or the individual to be treated. A method that "delays" or palliates the development of a disease, or delays the onset of a disease, is a method that, when compared to not using the method, reduces the probability of occurrence of one or more symptoms of the disease within a given timeframe and / or reduces the extent of the symptoms within a given timeframe. Such comparisons are typically based on clinical studies using a large number of subjects sufficient to give a statistically significant result.
[0091] The "development" or "progression" of a disease refers to the initial manifestation and / or subsequent progression of the disease. The progression of a disease can be detected and assessed using standard clinical techniques well known in the art. However, progression also refers to progression that may not be detectable. For the purposes of this disclosure, development or progression refers to the biological course of symptoms. "Progression" includes onset, recurrence, and onset.
[0092] As used herein, "onset" or "occurrence" of a disease includes initial onset and / or recurrence.
[0093] The term "therapeutic agent" may refer to any agent that has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect when administered to a subject. Therapeutic agents may also be referred to as "active substances" or "active agents." Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.
[0094] As used herein, the term "pharmaceutical composition" and its grammatical equivalents may refer to a mixture or solution containing a therapeutically effective amount of an active pharmaceutical ingredient and one or more pharmaceutically acceptable excipients, carriers and / or therapeutic agents to be administered to a subject (e.g., a human in need thereof).
[0095] As used herein, the term "pharmaceutically acceptable" and its grammatical equivalents may refer to the properties of materials that can be used to prepare pharmaceutical compositions, which materials are generally safe, non-toxic, and neither biologically nor otherwise undesirable and are acceptable for veterinary as well as human pharmaceutical uses. "Pharmaceutically acceptable" may refer to a material (such as a carrier or diluent) that does not abrogate the biological activity or properties of a compound and is relatively non-toxic, i.e., the material can be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any component of a pharmaceutical composition containing the material.
[0096] A "pharmaceutically acceptable excipient, carrier, or diluent" refers to an excipient, carrier, or diluent that can be administered to a subject with an agent and that does not destroy the pharmacological activity of the agent and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the agent.
[0097] "Pharmaceutically acceptable salts" may be acid or base salts that are generally recognized in the art as being suitable for use in contact with human or animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications. Those of ordinary skill in the art will recognize from this disclosure and knowledge in the art that further pharmaceutically acceptable salts include those listed in Remington's Pharmaceutical Sciences, 17th edition, ed., Mack Publishing Company, Easton, PA, p. 1418 (1985).
[0098] As used herein, the term "therapeutically effective amount" means an amount of an agent (e.g., a nucleic acid, a drug, a payload, a composition, a therapeutic agent, a diagnostic agent, a prophylactic agent, etc.) to be delivered that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, ameliorate, diagnose, prevent, and / or delay the onset of the symptoms of the infection, disease, disorder, and / or condition.
[0099] Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination, or sub-range of numbers from the group consisting of the integers from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, and all intervening fractional values between the aforementioned integers (such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9). With regard to sub-ranges, "nested sub-ranges" extending from either end of the range are specifically contemplated. For example, exemplary nested sub-ranges of the range 1 to 50 can include 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.
[0100] Numerical values expressed in the specification and claims to indicate components, molecular weights, etc. are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, numerical parameters listed in the specification and claims are approximations. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0101] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
[0102] As used herein, a spacer sequence of a guide nucleic acid is considered "homologous" to a protospacer sequence of a target nucleic acid if a base editor of a base editor system comprising the spacer sequence is capable of modifying a base within the target nucleic acid. A spacer sequence homologous to a protospacer sequence can be identical or substantially identical to the protospacer sequence.
[0103] As used herein, a nucleic acid sequence that is "substantially identical" to another nucleic acid sequence is a nucleotide sequence that has 70% or more sequence identity with the other nucleic acid sequence.
[0104] For purposes of percent sequence identity between an RNA sequence (eg, a spacer) and a DNA sequence (eg, a target gene protospacer), uracil bases in the RNA are considered identical to thymine bases in the DNA sequence.
[0105] As used herein, "sequence identity" refers to the degree to which two optimally aligned nucleic acid sequences are invariant over the entire component (e.g., nucleotide) comparison window. "Identity" can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM and Griffin, HG, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).
[0106] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a test ("subject") nucleic acid (or the complementary strand thereof) as compared to a linear polynucleotide sequence of a reference ("query") nucleic acid (or the complementary strand thereof) when the sequences of the test ("subject") and reference ("query") nucleic acids (or the complementary strands thereof) are optimally aligned. The percent sequence identity can be determined when the sequences being compared are aligned for maximum correspondence, as measured using the sequence comparison algorithms described below and known in the art, or by visual inspection.
[0107] For sequence comparison, typically one sequence acts as the reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the program parameters. Optimal alignment of sequences for comparison is well known in the art and can be performed using tools such as GAP, BESTFIT, FASTA, and TFASTA, available as part of the GCG Wisconsin Wisconsin (Accelrys Inc., San Diego, CA). The "identity fraction" of aligned segments of the test and reference sequences is the number of identical components common to both aligned sequences divided by the total number of components in the reference sequence segment (i.e., the entire reference sequence or a smaller defined portion of the reference sequence). The percent sequence identity is expressed as the identity fraction multiplied by 100.
[0108] "Percentage identity" can also be determined using BLASTX version 2.0 (for translated nucleotide sequences) and BLASTN version 2.0 (for polynucleotide sequences). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) that score above a certain threshold score T when aligned. The threshold score T is based on the length of the query sequence, but can be set to balance the sensitivity and speed of the alignment. T is referred to as the neighborhood word score threshold (Altschul et al., 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value by the addition of a single residue to either sequence; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as default a wordlength (W) of 11, an expectation value (E) of 10, a cutoff value of 100, M=5, N=-4, and a comparison to the entire
[0109] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference sequence is less than about 0.1 to less than about 0.001.
[0110] In some embodiments, the first nucleotide sequence homologous to the second nucleotide sequence can hybridize to the complement of the second nucleotide sequence under stringent conditions or highly stringent conditions. "Stringent hybridization conditions" and "stringent hybridization wash conditions" are sequence dependent and vary depending on different environmental parameters. A broad guide to conditions for nucleic acid hybridization is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes Part I Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993). Typically, highly stringent hybridization and wash conditions are chosen to be about 5°C lower than the thermal melting point (Tm) for a specific sequence under defined ionic strength and pH. The Tm is the temperature (at a defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences of more than 100 residues on a filter in Southern or Northern blots is 50% formamide and 1 mg of heparin at 42°C, with hybridization occurring overnight. An example of highly stringent wash conditions is 0.15 M NaCl for about 15 minutes at 72°C. An example of stringent wash conditions is 0.2x SSC at 65°C washing for 15 minutes (for a description of the SSC buffer see Sambrook and Russel, Molecular Cloning: A laboratory Manual, 3rded., Cold Spring Harbor Laboratory Press, 2001). Typically, a low stringent wash is performed before the highly stringent wash to remove background probe signal. An example of a moderately stringent wash is 1x SSC at 45°C for 15 minutes for duplexes of, for example, more than 100 nucleotides. An example of a low stringent wash is 4-6x SSC at 40°C for 15 minutes for duplexes of, for example, more than 100 nucleotides. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions usually involve a salt concentration of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salt) at pH 7.0 to 8.3, and the temperature is usually at least about 30°C. Stringent conditions can also be achieved with the addition of destabilizing agents, such as formamide.
[0111] In several places throughout this application, guidance is provided by way of examples, which examples (including specific aspects thereof) can be used in various combinations and are the subject of the claims. In each case, the enumerated list serves only as a representative group and should not be construed as an exclusive list. It should be understood that the specific examples, materials, amounts, and procedures should be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
[0112] For any method disclosed herein comprising discrete steps, the steps may be performed in any practicable order. Also, any combination of two or more steps may be performed simultaneously, where appropriate.
[0113] All headings throughout are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
[0114] First Tau translocator and gene
[0115] Transthyretin (TTR), originally known as prealbumin, is a 55-kDa transporter of both thyroxine (T4) and retinol-binding protein that circulates in soluble form in the serum and cerebrospinal fluid (CSF) of healthy humans. TTR is thought to be primarily synthesized in the liver. Under normal circumstances, TTR circulates as a homotetramer with a central channel. The wild-type TTR monomer is 147 amino acids in length and has the following amino acid sequence:
[0116]
[0117]
[0118] The TTR gene consists of four exons and is located on chromosome 18, 18q12.1. The complete sequence of the human TTR gene is Figure 4 2766 (TTHY_HUMAN). To date, over 120 TTR variants have been identified, the vast majority of which are pathogenic. The most common pathogenic variant consists of a point mutation that results in a methionine replacement of the valine at position 30 of the mature protein. This Val30Met mutation is the primary cause of hATTR amyloidosis and is the most common amyloidogenic mutation worldwide, accounting for approximately 50% of TTR variants.
[0119] Hereditary transthyretin amyloidosis (hATTR) is a disease caused by mutations in the TTR gene. Autosomal dominant mutations destabilize the TTR tetramer and enhance dissociation into monomers, leading to misfolding, aggregation, and subsequent extracellular deposition of TTR amyloid fibrils in different tissue sites. The multi-system extracellular deposition of this amyloid (amyloidosis) causes dysfunction of different organs and tissues. In particular, polyneuropathy (ATTR-PN) caused by transthyretin amyloidosis and cardiomyopathy (ATTR-CM) caused by transthyretin amyloidosis are serious conditions associated with significant morbidity and mortality.
[0120] When hATTR-PN is clinically suspected, the diagnosis is usually made through tissue biopsy using amyloid staining, amyloid typing (using immunohistochemistry or mass spectrometry), and / or TTR gene sequencing. When ATTR-CM is clinically suspected, the key diagnostic tools are endomyocardial biopsy (using tissue staining and amyloid typing by immunohistochemistry or mass spectrometry) or 99m technetium pyrophosphate scanning. Both methods can provide a diagnosis of ATTR-CM. TTR gene sequencing can be used to distinguish hATTR-CM (mutation-positive) from ATTRwt-CM (mutation-negative).
[0121] The compositions described herein comprise a spacer having a nucleotide sequence that acts as a guide to direct a gene editing protein (e.g., a base editor) to alter a TTR gene (e.g., by introducing one or more nucleobase changes in the TTR gene). These point mutations can be used to disrupt gene function by introducing one or more missense mutations that result in the production of a less functional protein or a non-functional protein, thereby silencing the TTR gene. Alternatively, it is contemplated herein that a gene editing protein can be used to alter a mutated gene to correct a potential mutation that causes TTR gene dysfunction or otherwise alleviate the dysfunction of the gene, thereby correcting one or more point mutations.
[0122] Gene editing / gene modification
[0123] As used herein, the term "gene editing" or "gene modification" and its grammatical equivalents refer to genetic engineering in which one or more nucleotides are inserted, replaced, or removed from a genome. Gene editing can be performed using nucleases (e.g., naturally occurring nucleases or artificially engineered nucleases). Gene modification can include the introduction of double-strand breaks, nonsense mutations, frameshift mutations, splice site changes, or inversions into a polynucleotide sequence (e.g., a target polynucleotide sequence). Figure 1ADepicted is the crispr Cas9 protein, an RNA-guided endonuclease that can be used to impart double-strand breaks at site-specific locations in DNA or genes. Gene modification can also be accomplished using other editors, such as base editors.
[0124] base editors
[0125] A base editor (BE) or nucleobase editor (NBE) refers to an agent comprising a polypeptide capable of modifying a base (e.g., A, T, C, G, or U) within a nucleic acid sequence (e.g., DNA or RNA). A base editor may comprise a macromolecule or a macromolecular complex that is capable of converting a nucleobase in a polynucleic acid sequence to another nucleobase (e.g., conversion or transversion) at one position or two or more positions within a base editing window. A base editor may comprise a combination of (a) a nucleotide convertase, a nucleoside convertase, or a nucleobase convertase and (b) a nucleic acid binding protein that can be programmed to bind to a specific nucleic acid sequence. The nucleic acid binding protein may be catalytically inactivated or damaged so that it does not cut a single-stranded nucleic acid target or so that it nicks or cuts at most one chain of a double-stranded nucleic acid target.
[0126] The base editor may comprise a polynucleotide programmable DNA binding domain fused or connected to a domain having base editing activity to produce a base editor fusion protein. The base editor fusion protein may comprise one or more linkers, such as a peptide linker between domains. In some embodiments, the domain having base editing activity is connected to a guide RNA (e.g., via an RNA binding motif on a guide RNA and an RNA binding domain fused to a deaminase).
[0127] In some embodiments, base editors are a class of modular programmable proteins that comprise a deaminase domain fused to a catalytically impaired CRISPR-Cas enzyme. Through hydrolytic deamination and subsequent cellular processing without generating double-stranded DNA breaks, adenine base editors (ABEs) convert A:T base pairs to G:C base pairs and cytosine base editors (CBEs) convert C:G base pairs to T:A base pairs. The corresponding deaminase of the base editor is guided to the target site by a guide RNA (gRNA) within the D10A nickase Cas9 (nCas9). The cytidine deaminase of the CBE guides the conversion of cytosine to uridine, thereby achieving a C→T (or G→A) substitution (see Figure 1B"Cytidine deaminase" is used herein to refer to a deaminase that acts on deoxy cytidine, cytidine, or both deoxy cytidine and cytidine to convert cytosine to uridine. Cytidine deaminase and cytosine deaminase are used interchangeably herein. In cases where the goal is to destroy a gene in vivo for therapeutic purposes, a cytosine base editor (CBE) can potentially introduce a stop codon directly into the coding sequence of the gene (nonsense mutation) by changing specific codons for glutamine (CAG→TAG, CAA→TAA), arginine (CGA→TGA), and tryptophan (TGG→TAG / TAA / TGA, where a cytosine on the antisense strand is edited).
[0128] In contrast, the adenosine deaminase of an ABE directs the conversion of adenosine to inosine, thereby effecting an A→G (or T→C) substitution (see Figure 1B "Adenosine deaminase" is used herein to refer to a deaminase that acts on deoxyadenosine, adenosine, or both deoxyadenosine and adenosine to convert adenine to inosine or, alternatively, adenosine to inosine. Because the structure of inosine is similar to guanosine (inosine does not contain the exocyclic amino group of guanosine), inosine tends to behave like guanosine. Through subsequent cellular processing, inosine is ultimately replaced by guanosine. Thus, an adenosine deaminase effects an A→G (or T→C) substitution. Adenosine deaminase and adenine deaminase are used interchangeably herein. An adenine base editor (ABE) cannot directly introduce a stop codon because there is no A→G change that leads to a nonsense mutation.
[0129] For example, an adenine base editor can be used to destroy gene function by editing the start codon (ATG→GTG or ATG→ACG). A second strategy by which an adenine base editor can destroy gene function is by editing a splice site, whether a splice donor at the 5' end of an intron or a splice acceptor at the 3' end of an intron. Splice site destruction can result in a messenger RNA (mRNA) that contains an intron sequence (potentially introducing a nonsense, frameshift, or in-frame indel mutation that leads to a premature stop codon or an amino acid that disrupts protein activity), or that does not contain an exon sequence (potentially introducing a nonsense, frameshift, or in-frame indel mutation).
[0130] As shown in Figure 2 A classic splice donor contains the DNA sequence GT on the sense strand, and a classic splice acceptor contains the DNA sequence AG. Alteration of the sequence disrupts normal splicing. A splice donor can be destroyed by adenine base editing of the complementary base at the second position of the antisense strand (GT→GC), and a splice acceptor can be destroyed by adenine base editing of the first position of the sense strand (AG→GG).
[0131] An adenine base editor (ABE) includes, but is not limited to, ABE8.8 (Gaudelli et al., Nat Biotechnol. 2020 Jul;38(7):892-900. doi: 10.1038 / s41587-020-0491-6. Epub 2020 Apr 13.).
[0132] In embodiments, the adenine base editor is encoded by an mRNA comprising the MA004 mRNA sequence set forth in Table 11. In embodiments, the adenine base editor is encoded by an mRNA comprising a sequence having 50% or more sequence identity to the MA004 mRNA set forth in Table 11, 60% or more sequence identity to the MA004 mRNA set forth in Table 11, 70% or more sequence identity to the MA004 mRNA set forth in Table 11, 75% or more sequence identity to the MA004 mRNA set forth in Table 11, 80% or more sequence identity to the MA004 mRNA set forth in Table 11, 85% or more sequence identity to the MA004 mRNA set forth in Table 11, 90% or more sequence identity to the MA004 mRNA set forth in Table 11, 95% or more sequence identity to the MA004 mRNA set forth in Table 11, 96% or more sequence identity to the MA004 mRNA set forth in Table 11, 97% or more sequence identity to the MA004 mRNA set forth in Table 11, 98% or more sequence identity to the MA004 mRNA set forth in Table 11, or 99% or more sequence identity to the MA004 mRNA set forth in Table 11.
[0133] ABE7.10 (Gaudelli et al., Nature. 2017 Nov 23;551(7681):464-471. doi: 10.1038 / nature24644) and other ABE variants contain a Streptococcus pyogenes Cas9. The CRISPR Journal, Volume 4, Issue 2, Pages 169-177, and Supplemental Figures S1-s9, Supplemental Data S4-S6, and Supplemental Tables S1-S2 disclose additional inlaid base editor (IBE) variants.
[0134] In some embodiments, a base editor can convert a C:G base pair to a G:C base pair. Examples of such base editors are disclosed in (a) Chen et al. Programmable C:G to G:C genome editing with CRISPR-Cas9-directed base excision repair proteins. Nat Commun 12, 1384 (2021). doi: 10.1038 / s41467-021-21559-9. Epub 2021 Mar 2; (b) Kurt, I. C., Zhou, R., Iyer, S., et al. CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Nat Biotechnol 39, 41-46 (2021). doi: 10.1038 / s41587-020-0609-x. Epub 2020 Jul 20; and (c) Zhao, D., Li, J., Li, S., et al. Glycosylase base editors enable C-to-A and C-to-G base changes. Nat Biotechnol 39, 35-40 (2021). doi: 10.1038 / s41587-020-0592-2. Epub 2020 Jul 20. Such base editors can comprise a Cas9 nickase and a cytidine deaminase. Such base editors can further comprise a uracil-DNA glycosylase, a DNA repair protein such as XRCC1, a DNA ligase S, or a DNA binding and ligase domain of DNA polymerase beta.
[0135] In some embodiments, a base editor can convert a C:G base pair to an A:T base pair. Examples of such base editors are disclosed in Zhao, D., Li, J., Li, S., et al. Glycosylase base editors enable C-to-A and C-to-G base changes. Nat Biotechnol 39, 35-40 (2021). doi: 10.1038 / s41587-020-0592-2. Epub 2020 Jul 20. Such base editors can comprise a Cas9 nickase and a cytidine deaminase. Such base editors can further comprise a uracil-DNA glycosylase.
[0136] The term“base editor system” refers to a system for editing a nucleobase of a target nucleotide sequence. In various embodiments, a base editor system comprises (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9); (2) a deaminase domain for deaminating the nucleobase (e.g., an adenosine deaminase or a cytidine deaminase); and (3) one or more guide polynucleotides (e.g., guide RNAs). In some embodiments, a base editor system comprises a base editor fusion protein comprising (1) and (2), or a polynucleotide (e.g., mRNA) encoding a base editor fusion protein comprising (1) and (2). In some embodiments, the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable DNA binding domain. In some embodiments, the base editor is an adenine or adenosine base editor (ABE). In some embodiments, the base editor is a cytosine base editor (CBE).
[0137] Genome editing systems include clustered regularly interspaced short palindromic repeat (CRISPR) / Cas systems. Exemplary guide nucleotide sequence-programmable DNA-binding proteins include, but are not limited to, Cas9 (e.g., dCas9 and nCas9), saCas9 (e.g., saCas9d, saCas9d, saKKH Cas9) CasX, CasY, Cpfl, C2cl, C2c2, C2c3, Argonaute, and any other suitable protein described herein, or suitable variants thereof.
[0138] By using a guide RNA (gRNA) with a sequence homologous to a sequence in the DNA of a target genome (referred to as a protospacer) adjacent to a specific protospacer adjacent motif (PAM) containing the sequence NGG (N is any standard base) in that DNA, Cas9 can be used to create a double-strand break (DSB) at the targeted sequence. Non-homologous end joining (NHEJ) at the DSB is capable of creating an indel, and can knock out a gene at a genetic locus; likewise, homology directed repair (HDR) using an introduced template DNA can insert a gene or modify the targeted sequence.
[0139] A variety of Cas9-based tools have been developed in recent years. Methods for using guide nucleotide sequence-programmable DNA-binding proteins, such as Cas9, for site-specific cleavage (e.g., to modify the genome) have been described in (see, e.g., Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013); Hwang et al., Nature Biotechnology 31, 227-229 (2013); Jinek et al., eLife 2, e00471 (2013); Dicarlo et al., Nucleic Acids Research (2013); and Jiang et al., Nature Biotechnology 31, 233-239 (2013).
[0140] In 2016, Komor et al. described using CRISPR-Cas9 to convert cytosine bases to thymine bases without the need to introduce a template DNA strand and without the need for a DSB (Komor et al., Nature, 2016, 533:420-4). After fusing the cytidine deaminase domain of rat APOBEC1 to the N-terminus of catalytically dead Cas9 (dCas9) using a linker XTEN (yielding a fusion protein known as base editor 1 or BE1), cytosine conversion to uracil was observed between positions 4 and 8 within the 20-nt protospacer region of the DNA (or, to express it differently, the 13th to 17th nucleotides upstream of the PAM). Notably, any cytosine base within this "window" is susceptible to editing, resulting in different outcomes depending on how many and which cytosines are edited. After DNA replication or repair, each uracil is replaced by a thymine, completing the C to T base editing.
[0141] The next version of the base editor (BE2) incorporates a uracil glycosylase inhibitor (UGI) fused to the C-terminus of dCas9 to help inhibit base excision repair of uracil bases resulting from cytidine deaminase activity (otherwise this would act to restore the original cytosine base); this improves the efficiency of C to T base editing.
[0142] The next version of the base editor (BE3) uses a Cas9 nickase instead of dCas9; the nickase cleaves the unedited strand opposite the edited C to T base, thereby stimulating removal of the opposite guanine through eukaryotic mismatch repair. BE2 and BE3 base editing was observed in both human and murine cell lines. Figure 1Bis a schematic of BE3. By adding mutations to the Cas9 nickase, the specificity of base editing has been further improved; in a similar manner, Cas9 has been mutated to narrow the width of the editing window from about 5 nucleotides to as little as 1 to 2 nucleotides (Rees et al., Nat Commun, 2017, 8: 15790, Kim et al., Nat Biotechnol, 2017, 35: 371-6).
[0143] By fusing the Escherichia coli adenine tTNA deaminase TadA (ecTadA) to dCas9 and mutagenizing the ecTadA domain and combining with selection for editing activity, A106V and D108N mutations were found to yield a base editor called ABE7.10 that is capable of editing adenine in DNA to guanine (Gaudelli et al. Nature, 2017, 551: 464-71).
[0144] Adenine 8.8-m (also referred to herein as ABE8.8) uses its core Streptococcus pyogenes nickase Cas9 (nSpCas9) protein and guide RNA (gRNA) to engage a double-stranded protospacer DNA sequence flanked at its 3’ end by an NGG protospacer adjacent motif (PAM) sequence. The protospacer sequence is specified via the first 20 bases of the gRNA hybridizing to a complementary sequence on the “target” DNA strand, leaving a portion of the other (“non-target”) strand in an exposed single-stranded form structure known as the R-loop. Unlike Cas9 and Cas12, ABE8.8 does not cause a double-strand break in the targeted DNA sequence. Rather, as Figure 1C illustrated, ABE8.8 uses an evolved deoxyadenosine deaminase domain (fused to nSpCas9) to chemically modify an adenosine nucleoside contained in the single-stranded DNA portion of the R-loop to an inosine, and to nick the target DNA strand within the DNA:RNA heteroduplex of the R-loop. This nicking biases the DNA repair machinery to use the newly deaminated strand as a template, thereby effecting a very efficient conversion mutation at the targeted site. The window of activity of ABE8.8 typically ranges from 3 to 9 positions in the protospacer DNA sequence specified by the gRNA, 12 to 18 base pairs 5’ of the NGG PAM (positions 21 to 23), with an editing peak observed at position 6 of the protospacer (Gaudelli et al., Nat Biotechnol. 2020 Jul; 38(7): 892-900).
[0145] In some embodiments, the nucleic acid encoding the base editor fusion protein is an mRNA. In some embodiments, upon administration, the mRNA generates the base editor fusion protein upon translation in the targeted cell or subject. In some embodiments, the base editor fusion protein forms a ribonucleoprotein (RNP) complex in the targeted cell or subject.
[0146] It will be appreciated that the fusion proteins of the present disclosure can comprise one or more additional features. For example, in some embodiments, the fusion proteins can comprise a cytoplasmic localization sequence, an export sequence such as a nuclear export sequence, or other localization sequence, as well as a sequence tag that can be used to solubilize, purify, or detect the fusion protein. Suitable protein tags provided herein include, but are not limited to, a biotin carboxylase carrier protein (BCCP) tag, a myc tag, a calmodulin tag, a FLAG tag, a hemagglutinin (HA) tag, a polyhistidine tag (also referred to as a histidine tag or His tag), a maltose binding protein (MBP) tag, a nus tag, a glutathione-S-transferase (GST) tag, a green fluorescent protein (GFP) tag, a thioredoxin tag, an S tag, a Softag (e.g., Softag 1, Softag 3), a strep tag, a biotin ligase tag, a FlAsH tag, a V5 tag, and an SBP tag. Additional suitable sequences will be apparent to those of skill in the art. In some embodiments, the fusion protein comprises one or more His tags.
[0147] protospacer
[0148] The term “protospacer” or “target sequence” and grammatical equivalents thereof as used herein can refer to a PAM-adjacent nucleic acid sequence. The protospacer can be a nucleotide sequence within a gene, genome, or chromosome that is targeted by a gRNA. In its native state, the protospacer is adjacent to a PAM (protospacer adjacent motif). The cleavage site of the RNA-guided nuclease is within the protospacer sequence. For example, as illustrated, when a gRNA targets a specific protospacer, the Cas protein generates a double-stranded break within the protospacer sequence, thereby cleaving the protospacer. Upon cleavage, the protospacer can be caused to be destroyed by non-homologous end joining or homology directed repair. The destruction of the protospacer can result in a deletion of the protospacer. Additionally or alternatively, the destruction of the protospacer can result in an exogenous nucleic acid sequence being inserted into or replacing the protospacer. Figure 1A
[0149] Through the present disclosure, protospacer sequences within the nucleotide sequence of the human TTR gene were identified for use as such guide sequences that allow ABE8.8 (as well as other ABE variants containing S. pyogenes Cas9, such as ABE7.10, or other ABE variants containing another Cas protein that can use NGGPAM) to disrupt start codons or disrupt splice sites (whether donor or acceptor) through A→G edits within its editing window (about 4 to 7 of the 20-nt protospacer region of the DNA). The four sequences shown in Table 1 were identified within the human TTR gene. An alignment of the four protospacer sequences on the human TTR gene map is shown in Figure 3
[0150] The protospacer corresponding to guide RNA GA457 has the sequence 5'-GCCATCCTGCCAAGAATGAG-3' (SEQ ID NO: 24) and is located at 34,879 to 34,898 bp of the human TTR gene.
[0151] The protospacer corresponding to guide RNA GA459 has the sequence 5'-GCAACTTACCCAGAGGCAAA-3' (SEQ ID NO: 25) and is located at 36,007 to 36,026 bp of the human TTR gene.
[0152] The protospacer corresponding to guide RNA GA460 has the sequence 5'-TATAGGAAAACCAGTGAGTC-3' (SEQ ID NO: 26) and is located at 38,106 to 38,125 bp of the human TTR gene.
[0153] The protospacer corresponding to guide RNA GA461 has the sequence 5'-TACTCACCTCTGCATGCTCA-3' (SEQ ID NO: 27) and is located at 38,234 to 38253 of the human TTR gene.
[0154] The protospacer corresponding to guide RNA GA458 has the sequence 5'-GCCATCCTGCCAAGAACGAG-3' (SEQ ID NO: 28), representing the sequence within the cynomolgus monkey TTR gene corresponding to the human protospacer sequence corresponding to guide RNA GA459.
[0155] A guide nucleic acid (e.g., guide RNA) is about 15 to 100 nucleotides in length and comprises a sequence of at least 10 contiguous nucleotides that is complementary to a target protospacer sequence. In some embodiments, the 3’ end of the target sequence is immediately adjacent to a canonical PAM sequence (NGG). In some embodiments, the 3’ end of the target sequence is not immediately adjacent to a canonical PAM sequence (NGG). In some embodiments, the 3’ end of the target sequence is immediately adjacent to an AGC, GAG, TTT, GTG, or CAA sequence.
[0156] In some embodiments, the guide polynucleotide is DNA. In some embodiments, the guide polynucleotide is RNA, which is also referred to herein as a guide RNA or gRNA. In some embodiments, the guide polynucleotide is a modified artificial polynucleotide.
[0157] In some embodiments, guide polynucleotides, including but not limited to gRNAs, can be synthesized. A guide polynucleotide can comprise a spacer sequence configured to hybridize to a complement of a protospacer sequence as shown in Table 1 under conditions, e.g., within a cell. A guide polynucleotide can comprise a spacer sequence that is homologous to a protospacer sequence as shown in Table 1. In some embodiments, a guide polynucleotide comprises a guide RNA comprising a spacer having a sequence homologous to a protospacer listed in Table 1. In some embodiments, a guide RNA can have a sequence comprising a guide RNA (gRNA) sequence listed in Table 1.
[0158] The present disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5’-GCCAUCCUGCCAAGAAUGAG-3’ (SEQ ID NO: 1) (GA457). The present disclosure includes a guide polynucleotide having the sequence 5’-GCCAUCCUGCCAAGAAUGAG-3’ (SEQ ID NO: 1) (GA457).
[0159] The present disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5'-GCCAUCCUGCCAAGAAUGAG-3' (SEQ ID NO: 1), wherein GCC is methyl-modified (GA521) (C modified to 2'-0-methylcytidine, G modified to 2'-0-methylguanosine). The present disclosure includes a guide polynucleotide having the sequence 5'-mGsmCsmCAUCCUGCCAAGAAUGAG-3' (SEQ ID NO: 1) (GA521), wherein mC: 2'-0-methylcytidine, mG: 2'-0-methylguanosine and s: phosphorothioate (PS) backbone linkage.
[0160] The present disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5'-GCCAUCCUGCCAAGAACGAG-3' (SEQ ID NO: 2) (GA458). The present disclosure includes a guide polynucleotide having the sequence 5'-GCCAUCCUGCCAAGAACGAG-3' (SEQ ID NO: 2) (GA458).
[0161] The present disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5'-GCAACUUACCCAGAGGCAAA-3' (SEQ ID NO: 3) (GA459). The present disclosure includes a guide polynucleotide having the sequence 5'-GCAACUUACCCAGAGGCAAA-3' (SEQ ID NO: 3) (GA459).
[0162] The present disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5'-UAUAGGAAAACCAGUGAGUC-3' (SEQ ID NO: 4) (GA460). The present disclosure includes a guide polynucleotide having the sequence 5'-UAUAGGAAAACCAGUGAGUC-3' (SEQ ID NO: 4) (GA460).
[0163] The disclosure includes a guide polynucleotide having a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to the sequence 5'-UACUCACCUCUGCAUGCUCA-3' (SEQ ID NO: 5) (GA461). The disclosure includes a guide polynucleotide having the sequence 5'-UACUCACCUCUGCAUGCUCA-3' (SEQ ID NO: 5) (GA461).
[0164] In some aspects, provided herein is a guide RNA comprising a sequence defined by mG*mC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (GA521, (SEQ ID NO: 11) wherein A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2'-O-methyladenosine, mC* is 2'-O-methylcytidine, mG* is 2'-O-methylguanosine, mU* is 2'-O-methyluridine, and wherein nucleotides represented in bold are connected by phosphorothioate (PS) backbone linkages.
[0165] Alternatively, GA521 is represented as
[0166] mG*smC*smC*AUCCUGCCAAGAAUGAGmGsUsUsUsUsAsGsmAsmsGsmCsmUsmAsGsmAsmAsmAsmUsmAsmGsmCssmAsmAsGsUsUsmAsAsmAsAsmUsAsmAsmGsmGsmCsmUsmAsGsUsmCsmCsGsUsUsAsmUsmCsAsAsmCsmUsmUsGsmAsmAsmAsmAsmAsmGsmUsmGsGsmCsmAsmCsmCsmGsmAsmGsmUsmCsmGsmGsmUsmGsmCsmU*smU*smU*smU (GA521) (SEQ ID NO: 11), wherein A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2'-O-methyladenosine, mC* is 2'-O-methylcytidine, mG* is 2'-O-methylguanosine, mU* is 2'-O-methyluridine, and wherein nucleotides represented by the letter's' are connected by phosphorothioate (PS) backbone linkages.
[0167] In some embodiments,
[0168] mG*mC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (GA521, SEQ ID NO: 11), where A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2’-O-methyladenosine, mC* is 2’-O-methylcytidine, mG* is 2’-O-methylguanosine, mU* is 2’-O-methyluridine, and where the nucleotides denoted in bold are connected by phosphorothioate (PS) backbone linkages.
[0169] Alternatively, GA521 is represented as
[0170] mG*mC*mC*AUCCUGCCAAGAAUGAGmGsUsUsUsUsAsGsmAsmsGsmCsmUsmAsGsmAsmAsmAsmUsmAsmGsmCssmAsmAsGsUsUsmAsAsmAsAsmUsAsmAsmGsmGsmCsmUsmAsGsUsmCsmCsGsUsUsAsmUsmCsAsAsmCsmUsmUsGsmAsmAsmAsmAsmAsmGsmUsmGsGsmCsmAsmCsmCsmGsmAsmGsmUsmCsmGsmGsmUsmGsmCsmU*mU*mU*mU (GA521) (SEQ ID NO: 11), where A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2’-O-methyladenosine, mC* is 2’-O-methylcytidine, mG* is 2’-O-methylguanosine, mU* is 2’-O-methyluridine, and where the nucleotides denoted in bold are connected by phosphorothioate (PS) backbone linkages denoted by the letter ‘s’.
[0171] In some embodiments, at least two or more of the tracrRNA nucleotides are connected by phosphorothioate (PS) backbone linkages. In some embodiments, all of the tracrRNA nucleotides are connected by phosphorothioate (PS) backbone linkages. In some embodiments, only some of the tracrRNA nucleotides are connected by phosphorothioate (PS) backbone linkages.
[0172] In some embodiments, only the methyl-modified nucleotides are connected by phosphorothioate (PS) backbone linkages.
[0173] The guide polynucleotide can comprise at least three regions: a first region at the 5’ end that can be homologous to a target site in a chromosomal sequence (spacer region), a second internal region that can form a stem-loop structure, and a third 3’ region that can be single-stranded. The second and third regions are considered tracr sequences or regions of the guide RNA and serve as binding scaffolds for the base editor or CRISPR / Cas protein, while the spacer region serves to guide the protein to the specific target site. The acronym tract refers to trans-activated crispr.
[0174] The second region of the gRNA can form a secondary structure. In some embodiments, the secondary structure formed by the gRNA can comprise a stem (or hairpin) and a loop. The length of the loop and stem can vary. In some embodiments, the length of the loop can range from about 3 to about 10 nucleotides. In some embodiments, the length of the stem can range from about 6 to about 20 nucleotides. The stem can comprise one or more bulges of 1 to 10 nucleotides or about 10 nucleotides. In some embodiments, the total length of the second region can range from about 16 to 60 nucleotides. In some embodiments, the length of the loop can be about 4 nucleotides. In some embodiments, the length of the stem can be about 12.
[0175] The third region of the gRNA at the 3’ end can be single-stranded. In some embodiments, the third region is not complementary to any chromosomal sequence in the target cell and is not complementary to the rest of the gRNA. The third region can have any suitable length. For example, the length of the third region can be three or more, or four or more nucleotides. In some embodiments, the length of the third region can vary, ranging in length from about 5 to about 60 nucleotides.
[0176] In some embodiments, the guide polynucleotide comprises a spacer sequence that is homologous to a protospacer sequence of the TTR gene as shown in Table 1 with 0, 1, 2, 3, 4, or 5 mismatches. In some embodiments, the guide polynucleotide comprises a spacer sequence that is homologous to a protospacer sequence of the TTR gene as shown in Table 1 with no mismatches.
[0177] In some embodiments, the length of the guide polynucleotide depends on the CRISPR / Cas components of the base editor system and the components used. For example, different Cas proteins from different bacterial species have different optimal targeting sequence lengths. Thus, the targeting sequence can comprise a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more than 50 nucleotides. In some embodiments, the targeting sequence comprises a length of 18 to 24 nucleotides. In some embodiments, the targeting sequence comprises a length of 19 to 21 nucleotides. In some embodiments, such as those described in Table 1, the targeting sequence comprises a length of 20 nucleotides.
[0178] In some embodiments, the guide polynucleotide comprises a spacer sequence and otherwise conforms to the standard 100-nt S. pyogenes CRISPR gRNA sequence.
[0179] In some embodiments, the guide RNA is chemically modified. Chemically modified gRNAs can have increased stability when transfected into mammalian cells. For example, the gRNA can be chemically modified to comprise a combination of 2'-O-methyl ribose and phosphorothioate backbone modifications on at least one 5' nucleotide and at least one 3' nucleotide of each gRNA. In some cases, the three terminal 5' nucleotides and the three terminal 3' nucleotides are chemically modified to comprise a combination of 2'-O-methyl ribose and phosphorothioate modifications.
[0180] The gRNAs described herein can be synthesized chemically, enzymatically, or by a combination of the two. For example, the gRNAs can be synthesized using standard phosphoramidite-based solid-phase synthesis methods. Alternatively, the gRNAs can be synthesized in vitro by operably linking DNA encoding the gRNA to a promoter control sequence recognized by a bacteriophage RNA polymerase. Examples of suitable bacteriophage promoter sequences include, but are not limited to, T7, T3, SP6 promoter sequences, or variants thereof. In some embodiments, the gRNA comprises two separate molecules (e.g., a crRNA, which comprises a spacer, and a tracrRNA). One molecule (e.g., the crRNA) can be synthesized chemically, and the other molecule (e.g., the tracrRNA) can be synthesized enzymatically.
[0181] Therapeutic applications
[0182] The guide polynucleotides and compositions described herein can be administered to target cells or a subject in need thereof in a therapeutically effective amount to prevent or treat a disorder associated with transthyretin amyloidosis. In some embodiments, the subject has hereditary transthyretin amyloidosis (hATTR). In some embodiments, the subject has cardiomyopathy caused by transthyretin amyloidosis (ATTR-CM). In some embodiments, the subject has polyneuropathy caused by transthyretin amyloidosis (ATTR-PN). In some embodiments, the subject has wild-type ATTR (ATTRwt), i.e., age-related deposition of wild-type TTR protein (previously known as senile amyloidosis).
[0183] By such administration, the guide polynucleotide directs the editor system (e.g., an ABE editor system) to effect a nucleobase alteration in the TTR gene of the subject, editing the TTR gene to reduce or eliminate the amount of full-length functional protein produced, thereby treating the disorder. In some embodiments, the base alteration occurs in a cell of the subject’s liver (hepatocyte).
[0184] For example, a gRNA and an adenosine base editor protein, which can be expressed in a cell in which target gene editing is desired, such as, for example, a hepatocyte, thereby allowing the target gene to come into contact with the gRNA and the adenosine base editor protein. In some embodiments, the binding of the adenosine base editor protein to the target polynucleotide sequence in the target gene is guided by a guide RNA, where the spacer sequence of the gRNA hybridizes to the target polynucleotide sequence in the target gene (e.g., the complement of the protospacer). Thus, the guide RNA directs the adenosine base editor protein to edit the target polynucleotide sequence (e.g., the protospacer sequence) in the target gene. In some embodiments, the guide RNA is co-introduced into the cell in which editing is desired with the adenosine base editor protein or with a nucleic acid encoding the adenosine base editor protein.
[0185] In certain embodiments, an adenine base editor can be used to disrupt gene function and / or expression by modifying a nucleobase at a splice junction of a target gene. In some embodiments, an adenosine nucleobase editor as described herein can be used to disrupt a splice donor site at the 5’ end of an intron or a splice acceptor site at the 3’ end of an intron. In some embodiments, the splice junction disruption results in a messenger RNA (mRNA) that contains an intronic sequence— potentially introducing a nonsense, frameshift, or in-frame indel mutation that results in a premature stop codon or an amino acid that disrupts protein activity— or results in a mRNA that does not contain an exonic sequence (which also potentially introduces a nonsense, frameshift, or in-frame indel mutation).
[0186] A canonical splice donor comprises the DNA sequence GT on the sense strand, while a canonical splice acceptor comprises the DNA sequence AG. In some embodiments, a base editor, such as an adenosine nucleobase editor as described herein, can be used to generate sequence alterations that disrupt normal splicing. In some embodiments, an adenosine base editor disrupts the complementary A on the antisense strand of a splice donor, resulting in an edit of GT GC. In some embodiments, an adenosine base editor disrupts the A on the sense strand of a splice acceptor site, resulting in an edit of AG GG.
[0187] In some embodiments, the methods and compositions disclosed herein reduce or eliminate expression and / or function of a transthyretin encoded by a TTR gene. For example, the methods and compositions disclosed herein can reduce expression and / or function of a transthyretin by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold relative to a control.
[0188] In some embodiments, a method for treating or preventing a condition in a subject in need thereof as described herein comprises administering to the subject (i) a guide polynucleotide and (ii) a nucleic acid encoding a base editor fusion protein.
[0189] In some embodiments, a method for treating or preventing a condition in a subject in need thereof as described herein comprises administering a lipid nanoparticle (LNP) encapsulating (i) a guide polynucleotide or a nucleic acid encoding a guide polynucleotide and / or (ii) a base editor fusion protein comprising a programmable DNA binding domain and a deaminase or a nucleic acid encoding a base editor fusion protein. In some aspects, the (i) guide polynucleotide or nucleic acid encoding a guide polynucleotide and (ii) base editor fusion protein comprising a programmable DNA binding domain and a deaminase or nucleic acid encoding a base editor fusion protein are encapsulated in the same LNP. In some aspects, they are encapsulated in separate LNPs.
[0190] Pharmaceutical composition
[0191] In some aspects, provided herein are pharmaceutical compositions comprising a base editor system as provided herein and a pharmaceutically acceptable carrier or excipient. In some aspects, provided herein are pharmaceutical compositions for genetic modification comprising a guide RNA and a base editor fusion protein or a nucleic acid sequence encoding a base editor fusion protein as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions are formulated in a conventional manner using one or more pharmaceutically acceptable inactive ingredients that facilitate processing of the active compounds into preparations that are pharmaceutically useful. Suitable formulations and methods of delivery for use in the present disclosure are generally well known in the art. The appropriate formulation depends on the chosen route of administration. An overview of pharmaceutical compositions described herein can be found in, for example, Remington: The Science and Practice of Pharmacy, Nineteenth Ed. (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, L, eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).
[0192] The pharmaceutical composition can be a mixture of a guide RNA or a nucleic acid sequence encoding the guide RNA and a base editor fusion protein or a nucleic acid sequence encoding a base editor fusion protein as described herein and one or more other chemical components (i.e., pharmaceutically acceptable ingredients) such as carriers, excipients, binders, fillers, suspending agents, flavoring agents, sweetening agents, disintegrants, dispersing agents, surfactants, lubricants, colorants, diluents, solubilizers, wetting agents, plasticizers, stabilizers, penetration enhancers, humectants, antifoaming agents, antioxidants, preservatives, or one or more combinations thereof. The pharmaceutical composition facilitates administration to an organism or subject in need.
[0193] The pharmaceutical compositions of the present disclosure can be administered to a subject using any suitable method known in the art. The pharmaceutical compositions described herein can be administered to a subject in a variety of ways including parenterally, intravenously, intradermally, intramuscularly, transcolony, transrectally, or intraperitoneally. In some embodiments, the pharmaceutical compositions can be administered to a subject by intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection. In some embodiments, the pharmaceutical compositions can be administered parenterally, intravenously, intramuscularly, or orally.
[0194] In some embodiments, the pharmaceutical composition for genetic modification comprises an additional therapeutic agent. The additional therapeutic agent can modulate a different aspect of the disease, disorder, or condition to be treated and provide a greater overall benefit than administration of the therapeutic agent alone. Therapeutic agents include, but are not limited to, chemotherapeutic agents, radiotherapeutic agents, hormonal therapeutic agents, and / or immunotherapeutic agents. In some embodiments, the therapeutic agent can be a radiotherapeutic agent. In some embodiments, the therapeutic agent can be a hormonal therapeutic agent. In some embodiments, the therapeutic agent can be an immunotherapeutic agent. In some embodiments, the therapeutic agent is a chemotherapeutic agent. The preparation and dosing schedule of the additional therapeutic agent can be used according to the manufacturer’s instructions or as empirically determined by the skilled artisan.
[0195] Lipid nanoparticle (LNP) compositions
[0196] The pharmaceutical compositions described herein for gene modification can be encapsulated in a lipid nanoparticle (LNP). As used herein, a “lipid nanoparticle (LNP) composition” or “nanoparticle composition” is a composition comprising one or more of the described lipids. The size of an LNP composition or formulation as contemplated herein is typically on the order of microns or less, and can comprise a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition or formulation as contemplated herein can be a liposome having a lipid bilayer with a diameter of 500 nm or less. The average diameter of an LNP as described herein can be from about 1 nm to about 2500 nm, from about 10 nm to about 1500 nm, from about 20 nm to about 1000 nm, from about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 50 nm to 90 nm, from about 55 nm to 85 nm, from about 55 nm to 75 nm, from about 50 nm to about 80 nm, from about 60 nm to about 80 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, or from about 70 nm to about 80 nm. The average diameter of an LNP described herein can be about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, or greater. In one embodiment, the average diameter of an LNP is about 70 nm + / - 20 nm, 70 nm + / - 10 nm, 70 nm + / - 5 nm. The LNPs described herein can be substantially non-toxic.
[0197] Lipid nanoparticles (LNPs) use a non-viral drug delivery mechanism that can pass through blood vessels and reach liver cells [Am.J.Pathol.2010, 176, 14-21]. Apolipoprotein E (ApoE) protein can bind to LNP after PEG-lipids diffuse from the LNP surface with a near-neutral charge in the bloodstream, thereby acting as an endogenous ligand for liver cells expressing low-density lipoprotein receptors (LDLr) [Mol.Ther., 2010, 18, 1357-1364.]. Controlling the efficient liver delivery of LNPs includes: 1) effective PEG-lipid shedding from the LNP surface in serum, 2) the binding of ApoE to LNPs. The LDLr-dependent LNP delivery pathway mediated by endogenous ApoE is an unavailable or less effective path for realizing liver gene delivery based on LNPs in patient populations lacking LDLr.
[0198] Efficient delivery to cells requires specific targeting and substantial protection from the extracellular environment (particularly serum proteins). A method for achieving specific targeting is to conjugate a targeting moiety with an active agent or drug effector (such as a nucleic acid agent), thereby directing the active agent or drug effector to a specific cell or tissue according to the specificity of the targeting moiety. A way in which the targeting moiety can improve delivery is by receptor-mediated endocytosis activity. This uptake mechanism involves moving the nucleic acid agent bound to the membrane receptor into the interior of the region surrounded by the membrane by the invagination of the membrane structure or by the fusion of the delivery system with the cell membrane. This process begins by the activation of the cell surface or membrane receptor after specific ligands are bound to the receptor. Receptor-mediated endocytosis systems include those systems that recognize sugars (such as galactose, mannose, mannose-6-phosphate), peptides, and proteins (such as transferrin, asialoglycoprotein, vitamin B12, insulin, and epidermal growth factor (EGF)). Lipophilic moieties (such as cholesterol or fatty acids) can significantly enhance plasma protein binding when attached to highly hydrophilic molecules (such as nucleic acids), and thus enhance circulation half-life. Lipophilic conjugates can also be used in combination with targeting ligands to improve intracellular trafficking for targeted delivery approaches.
[0199] The asialoglycoprotein receptor (ASGP-R) is a high capacity receptor that is abundant on hepatocytes. The ASGP-R has a 50-fold higher affinity for N-acetyl-D-galactosamine (GalNAc) than for D-Gal. LNP comprising receptor-targeting conjugates can be used to facilitate targeted delivery of the drug substances described herein. The LNP can comprise one or more receptor-targeting moieties at a specified or engineered surface density (ranging from a relatively low to a relatively high surface density) on the surface of or surrounding the particle. The receptor-targeting conjugate can comprise a targeting moiety (or ligand), a linker, and a lipophilic moiety linked to the targeting moiety. In some embodiments, the receptor-targeting moiety (or ligand) targets a lectin receptor. In some embodiments, the lectin receptor is the asialoglycoprotein receptor (ASGPR). In some embodiments, the receptor-targeting moiety is GalNAc or a derivative GalNAc that targets the ASGPR. In one aspect, the receptor-targeting conjugate comprises one GalNAc moiety or derivative thereof. In another aspect, the receptor-targeting conjugate comprises two different GalNAc moieties or derivatives thereof. In another aspect, the receptor-targeting conjugate comprises three different GalNAc moieties or derivatives thereof. In another aspect, the receptor-targeting conjugate is lipophilic. In some embodiments, the receptor-targeting conjugate comprises one or more GalNAc moieties and one or more lipid moieties, i.e., GalNAc-lipid. In some embodiments, the receptor-targeting conjugate is GalNAc-lipid.
[0200] Described herein are (i) LNP compositions comprising an amino lipid, a phospholipid, a PEG-lipid, a cholesterol or derivative thereof, a payload, or any combination thereof, and (ii) LNP compositions comprising an amino lipid, a phospholipid, a PEG-lipid, a cholesterol, a GalNAc-lipid or derivative thereof, a payload, or any combination thereof. Each component is described in more detail below.
[0201] In the preparation of LNP compositions comprising the excipients amino lipid, phospholipid, PEG-lipid, and cholesterol, the desired molar ratios of the four excipients are dissolved in a water-miscible organic solvent (e.g., ethanol). The homogenous lipid solution is then rapidly mixed in-line with an aqueous buffer containing a nucleic acid payload at an acidic pH ranging from 4 to 6.5 to form lipid nanoparticles (LNPs) encapsulating the nucleic acid payload(s). Following the rapid in-line mixing, the thus-formed LNPs undergo further downstream processing including concentration and buffer exchange to arrive at a final LNP drug composition at near neutral pH for administration into a cell line or animal disease model for evaluation or for administration into a human subject.
[0202] To prepare the GalNAc-LNP pharmaceutical composition, the GalNAc-lipid is mixed with the four lipid excipients in a water-miscible organic solvent prior to preparation of the GalNAc-LNP. The GalNAc-LNP pharmaceutical composition is then prepared following the same procedure as described for the LNP pharmaceutical composition. The mol% of GalNAc-lipid in the GalNAc-LNP formulation ranges from 0.001 to 2.0 of the total excipients.
[0203] For both LNP and GalNAc-LNP formulations, the payload comprises a guide RNA targeting the TTR gene and an mRNA encoding a base editor protein. In some embodiments, the ratio of guide RNA to mRNA in the acidic aqueous buffer and in the final formulation is 6:1, 5:1, 4:1, 3:1, 2.5:1, 2:1, 1.5:1, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:5, or 1:6 by weight. In some embodiments, the mRNA encodes an adenosine base editor protein. In some other embodiments, the mRNA encodes a cytosine or cytidine base editor protein.
[0204] In some embodiments, the LNP composition can be prepared as described in U.S. Patent Application No. 17 / 192,709, entitled “COMPOSITIONS AND METHODS FOR TARGETED RNA DELIVERY,” filed March 4, 2021, which claims the benefit of U.S. Provisional Patent Application Nos. 62 / 984,866 (filed March 4, 2020) and 63 / 078,982 (filed September 16, 2020), naming Kallanthottathil G. Rajeev as inventor and Verve Therapeutics, Inc. as applicant, which are hereby incorporated by reference in their entirety.
[0205] amino lipids
[0206] In some embodiments, the LNP composition comprises an amino lipid. In some embodiments, the cationic lipid is an ionizable lipid. In some embodiments, the amino lipid (e.g., ionizable lipid) is a cationic lipid. In some embodiments, the amino lipid (e.g., ionizable and / or cationic lipid) comprises one or more nitrogen atoms. Exemplary, non-limiting amino lipids suitable for use in the compositions described herein include those described herein.
[0207] Formula (I)
[0208] In one aspect, disclosed herein is an amino lipid having the structure of Formula (I), or a pharmaceutically acceptable salt or solvate thereof,
[0209]
[0210] in
[0211] R 1 and R 2 Each of which is independently C3-C 22 Alkyl, C3-C 22 alkenyl, C3-C8 cycloalkyl, -C2-C 10 Alkylene-LR 6 ,or wherein each of alkyl, alkylene, alkenyl, and cycloalkyl is independently substituted or unsubstituted;
[0212] Each of X, Y and Z is independently -C(=O)NR 4 -、-NR 4 C(=O)-, -C(=O)O-, -OC(=O)-, -OC(=O)O-, -NR 4 C(=O)O-, -OC(=O)NR 4 -、-NR 4 C(=O)NR 4 -、-NR 4 C(=NR 4 )NR 4 -、-C(=S)NR 4 -、-NR 4 C(=S)-, -C(=O)O-, -OC(=S)-, OC(=S)O-, -NR 4 C(=S)O-、-OC(=S)NR 4 -、-NR 4 C(=S)NR 4 -, -C(=O)S-, -SC(=O)-, -OC(=O)S-, -NR 4 C(=O)S-、-SC(=O)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR 4 C(=S)S-、-SC(=S)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR 4 C(=S)S-、-SC(=S)NR 4 -O, S, or key;
[0213] Each of L is independently -C(=O)NR 4 -、-NR 4C(=O)-, -C(=O)O-, -OC(=O)O-, -NR 4 C(=O)O-, -OC(=O)NR 4 -, -NR 4 C(=O)NR 4 -, -NR 4 C(=NR 4 )NR 4 -, -C(=S)NR 4 -, -NR 4 C(=S)-, -C(=O)O-, -OC(=S)-, OC(=S)O-, -NR 4 C(=S)O-, -OC(=S)NR 4 -, -NR 4 C(=S)NR 4 -, -C(=O)S-, SC(=O)-, -OC(=O)S-, -NR 4 C(=O)S-, -SC(=O)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR 4 C(=S)S-, -SC(=S)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR 4 C(=S)S-, -SC(=S)NR 4 -, O, S, -C1-C 10 alkylene-O-, -C1-C 10 alkylene-C(=O)O-, -C1-C 10 alkylene-OC(=O)-, or a bond, wherein alkylene is substituted or unsubstituted;
[0214] R 3 is -C0-C 10 alkylene-NR 7 R 8 , -C0-C 10 alkylene-heterocycloalkyl, or -C0-C 10 alkylene-heterocycloaryl, wherein alkylene, heterocycloalkyl, and heterocycloaryl are independently substituted or unsubstituted; R 4 each of R
[0215] R 5 is hydrogen or substituted or unsubstituted C1-C6 alkyl;
[0216] R 6Each of which is independently substituted or unsubstituted C3-C 22 Alkyl or substituted or unsubstituted C3-C 22 alkenyl;
[0217] R 7 and R 8 Each of R is independently hydrogen or a substituted or unsubstituted C1-C6 alkyl group, or R 7 and R 8 Together with the nitrogen to which they are attached, they form a substituted or unsubstituted C2-C6 heterocyclyl;
[0218] p is an integer selected from 1 to 10; and
[0219] Each of n, m and q is independently 0, 1, 2, 3, 4 or 5.
[0220] In some embodiments of Formula (I), if the structure carries more than one asymmetric C atom, each asymmetric C atom independently represents a racemic, chirally pure R and / or chirally pure S isomer, or a combination thereof.
[0221] In some embodiments, each of n, m, and q in Formula (I) is independently 0, 1, 2, or 3. In some embodiments, each of n, m, and q in Formula (I) is 1.
[0222] Formula (Ia)
[0223] In some embodiments, the compound of Formula (I) has the structure of Formula (Ia) or a pharmaceutically acceptable salt or a pharmaceutically acceptable solvate thereof:
[0224]
[0225] in
[0226] R 1 and R 2 Each of which is independently C3-C 22 Alkyl, C3-C 22 alkenyl, C3-C8 cycloalkyl, -C2-C 10 Alkylene-LR 6 ,or wherein each of alkyl, alkylene, alkenyl, and cycloalkyl is independently substituted or unsubstituted;
[0227] Each of X, Y and Z is independently C(=O)NR 4 -、-NR 4 C(D)-, -C(=O)O-, -OC(=O)-, -OC(=O)O-, -NR4 C(=O)O-, -OC(=O)NR 4 -, -NR 4 C=O)NR 4 -, -NR 4 C(=NR 4 )NR 4 -, -C(=S)NR 4 -, -NR 4 C(=S)-, -C(=O)O-, -OC(=S)-, OC(=S)O-, -NR 4 C(=S)O-, -OC(=S)NR 4 -, -NR 4 C(=S)NR 4 -, -C(=O)S-, -SC(=O)-, -OC(=O)S-, -NR 4 C(=O)S-, -SC(=O)NR 4 -C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR 4 C(=S)S-, -SC(=S)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR 4 C(=S)S-, -SC(=S)NR 4 -, O, S, -C1-C 10 alkylene-O-, or a bond, wherein alkylene is substituted or unsubstituted;
[0228] each of L is independently -C(=O)NR 4 -, -NR 4 C(=O)-, -C(=O)O-, -OC(=O)-, -OC(=O)O-, -NR 4 C(=O)O-, -OC(=O)NR 4 -, -NR 4 C(=O)NR 4 -, -NR 4 C(=NR 4 )NR 4 -, -C(=S)NR 4 -, -NR 4 C(=S)-, -C(=O)O-, -OC(=S)-, OC(=S)O-, -NR 4 C(=S)O-, -OC(=S)NR 4 -, -NR 4 C(=S)NR 4-, -C(=O)S-, -SC(=O)-, -OC(=O)S-, -NR 4 c(=O)S-、-SC(=O)NR 4 --C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR 4 C(=S)S-、-SC(=S)NR 4 -, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR 4 C(=S)S-、-SC(=S)NR 4 -、O、S、-C1-C 10 Alkylene-O-, -C1-C 10 Alkylene-C(=O)O-, -C1-C 10 Alkylene-OC(=O)-, or a bond, wherein the alkylene is substituted or unsubstituted;
[0229] R 3 Yes-C0-C 10 Alkylene-NR 7 R 8 、-C0-C 10 Alkylene-heterocycloalkyl, or -C0-C 10 Alkylene-heterocyclowyl, wherein alkylene, heterocycloalkyl, and heterocyclowyl are independently substituted or unsubstituted;
[0230] R 4 Each of them is independently hydrogen or a substituted or unsubstituted C1-C6 alkyl group;
[0231] R 5 is hydrogen or substituted or unsubstituted C1-C6 alkyl;
[0232] R 6 Each of which is independently substituted or unsubstituted C3-C 22 Alkyl or substituted or unsubstituted C3-C 22 alkenyl;
[0233] R 7 and R 8 Each of R is independently hydrogen or a substituted or unsubstituted C1-C6 alkyl group, or R 7 and R 8 Together with the nitrogen to which they are attached, they form a substituted or unsubstituted C2-C6 heterocyclyl; and
[0234] p is an integer selected from 1 to 10.
[0235] In some embodiments of formula (la), if the structure bears more than one asymmetric C atom, each asymmetric C atom independently represents a racemic, chirally pure R and / or chirally pure S isomer, or a combination thereof.
[0236] Variants of formula (I) and (la)
[0237] In some embodiments, R 1 and R 2 independently are C3-C 22 alkyl, C3-C 22 alkenyl, -C2-C 10 alkylene-L-R6, or wherein each of alkyl, alkylene, alkenyl and cycloalkyl is independently substituted or unsubstituted. In some embodiments, R 1 and R 2 independently are C 10 -C 20 alkyl, C 10 -C 20 alkenyl, -C8-C7alkylene-L-R6, or wherein each of alkyl, alkylene, alkenyl and cycloalkyl is independently substituted or unsubstituted. In some embodiments, R 1 in formula (I) and (la) is
[0238] In some embodiments, each of L in formula (I) and (la) independently is O, S, -C1-C 10 alkylene-O-, -C1-C 10 alkylene-C(=O)O-, -C1-C 10 alkylene-OC(=O)-, or a bond, wherein alkylene is substituted or unsubstituted. In some embodiments, each of L in formula (I) and (la) independently is O, S, -C1-C3alkylene-O-, -C 1- alkylene-C(=O)O-, -C1-C3alkylene-OC(=O)-, or a bond, wherein alkylene is substituted or unsubstituted. In some embodiments, each of L in formula (I) and (la) independently is O, S, -C1-C3alkylene-O-, -C1-C3alkylene-C(=O)O-, -C1-C3alkylene-OC(=O)-, or a bond, wherein alkylene is linear or branched unsubstituted alkylene.
[0239] In some embodiments, R 6each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 22 alkyl or substituted or unsubstituted straight chain C3-C 22 alkenyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 20 alkyl or substituted or unsubstituted C3-C 20 alkenyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 6 each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 10 alkyl or substituted or unsubstituted C3-C 10 alkenyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 6 each of R6in formula (I) and formula (la) is independently substituted or unsubstituted C3-C 10 alkyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted straight chain C3-C 6 alkyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted straight chain C3-C 10 alkyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted straight chain C3-C 6 each of R6in formula (I) and formula (la) is independently substituted or unsubstituted n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, or n-dodecyl. In some embodiments, each of R6in formula (I) and formula (la) is independently substituted or unsubstituted n-octyl. In some embodiments, each of R6in formula (I) and formula (la) is independently n-octyl. 6 each of R6in formula (I) and formula (la) is independently substituted or unsubstituted n-octyl. In some embodiments, each of R6in formula (I) and formula (la) is independently n-octyl. 6 each of R6in formula (I) and formula (la) is independently n-octyl.
[0240] In some embodiments, each of L in formula (I) and formula (la) is independently -C(=O)O-, -OC(=O)-, -C1-C 10 alkylene-O-, or O. In some embodiments, each of L in formula (I) and formula (la) is O. In some embodiments, each of L in formula (I) and formula (la) is -C1-C3 alkylene-O-. In some embodiments, p in formula (I) and formula (la) is 1, 2, 3, 4, or 5. In some embodiments, p in formula (I) and formula (la) is 2.
[0241] In some embodiments, each of R 1 is
[0242]
[0243] In some embodiments, each of R1 R is R 2 .
[0244] In some embodiments, each R 4 is independently H or substituted or unsubstituted C1-C4 alkyl. In some embodiments, each R 4 is independently substituted or unsubstituted linear C1-C4 alkyl. In some embodiments, each R 4 is H. In some embodiments, each R 4 is independently H, -CH3, -CH2CH3, -CH2CH2CH3, or -CH(CH3)2. In some embodiments, each R 4 is independently H or -CH3. In some embodiments, each R 4 is -CH3.
[0245] In some embodiments, X in formula (I) and formula (la) is -C(=O)O- or -OC(=O))- In some embodiments, X in formula (I) and formula (la) is -C(=O)NR 4 - or -NR 4 C(=O)-. In some embodiments, X in formula (I) and formula (la) is -C(=O)N(CH3)-, -N(CH3)C(=O)-, -C(=O)NH-, or -NHC(=O)-. In some embodiments, X in formula (I) and formula (la) is -C(=O)NH-, -C(=O)N(CH3)-, -OC(=O))-, -NHC(=O)-, -N(CH3)C(=O))- -C(=O)O-, -OC(=O)O-, -NHC(=O)O-, -N(CH3)C(=O)O-, -OC(=O))NH-, -OC(=O)N(CH3)-, -NHC(=O)NH-, -N(CH3)C(=O))NH-, -NHC(=O)N(CH3)-, -N(CH3)C(=O)N(CH3)-, NHC(=NH)NH-, -N(CH3)C(=NH)NH-, -NHC(=NH)N(CH3)-, -N(CH3)C(=NH)N(CH3)-, NHC(=NMe)NH-, -N(CH3)C(=NMe)NH-, -NHC(=NMe)N(CH3)-, or -N(CH3)C(=NMe)N(CH3)-.
[0246] In some embodiments, R in Formula (I) and Formula (Ia) 2 It is C3-C 22 Alkyl, C3-C 22 Alkenyl, -C2-C 10 Alkylene-LR 6 ,or wherein each of alkyl, alkylene, alkenyl, or cycloalkyl is independently substituted or unsubstituted. In some embodiments, R in Formula (I) and Formula (Ia) 2 is substituted or unsubstituted C7-C 22 Alkyl or substituted or unsubstituted C3-C 22 In some embodiments, R in formula (I) and formula (Ia) 2 is a substituted or unsubstituted straight chain C7-C 22 Alkyl or substituted or unsubstituted straight chain C3-C 22 In some embodiments, R in Formula (I) and Formula (Ia) 2 is substituted or unsubstituted C 10 -C 20 Alkyl or substituted or unsubstituted C 10 -C 20 In some embodiments, R in Formula (I) and Formula (Ia) 2 is unsubstituted C 10 -C 20 In some embodiments, R in Formula (I) and Formula (Ia) 2 is unsubstituted C 10 -C 20 In some embodiments, R in Formula (I) and Formula (Ia) 2 Yes-C2-C 10 Alkylene-LR 6 In some embodiments, R in Formula (I) and Formula (Ia) 2 Yes-C2-C 10 Alkylene-C(=O)OR 6 or -C2-C 10 Alkylene-OC(=O)-R 6 .
[0247] In some embodiments, R in Formula (I) and Formula (Ia) 2 yes
[0248]
[0249] In some embodiments, R in Formula (I) and Formula (Ia) 1 It is R 1 .
[0250] In some embodiments, Y in formula (I) and formula (la) is -C(=0)0- or -OC(=0)-. In some embodiments, Y in formula (I) and formula (la) is -C(=0)NR 4 - or -NRC(=0)- 4 In some embodiments, Y in formula (I) and formula (la) is -C(=0)N(CH3)-, -N(CH3)C(=0)-, -C(=0)NH-, or -NHC(=0)-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, -NHC(=0)NH-, -N(CH3)C(=0)0-, -OC(=0)N(CH3)-, -N(CH3)C(=0)N(CH3)-, or -N(CH3)C(=0)NH-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, or -NHC(=0)NH-. 4 - or -NRC(=0)- 4 In some embodiments, Y in formula (I) and formula (la) is -C(=0)N(CH3)-, -N(CH3)C(=0)-, -C(=0)NH-, or -NHC(=0)-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, -NHC(=0)NH-, -N(CH3)C(=0)0-, -OC(=0)N(CH3)-, -N(CH3)C(=0)N(CH3)-, or -N(CH3)C(=0)NH-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, or -NHC(=0)NH-. 4 - or -NRC(=0)- 4 In some embodiments, Y in formula (I) and formula (la) is -C(=0)N(CH3)-, -N(CH3)C(=0)-, -C(=0)NH-, or -NHC(=0)-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, -NHC(=0)NH-, -N(CH3)C(=0)0-, -OC(=0)N(CH3)-, -N(CH3)C(=0)N(CH3)-, or -N(CH3)C(=0)NH-. In some embodiments, Y in formula (I) and formula (la) is -OC(=0)0-, -NHC(=0)0-, -OC(=0)NH-, or -NHC(=0)NH-.
[0251] In some embodiments, R 3 in formula (I) and formula (la) is -Co-C 10 alkylene-NR 7 R 8 or -Co-C 10 alkylene-heterocycloalkyl, wherein alkylene and heterocycloalkyl are independently substituted or unsubstituted. In some embodiments, R 3 in formula (I) and formula (la) is -Co-C 10 alkylene-NR 7 R 8 In some embodiments, R 3 in formula (I) and formula (la) is -Ci-C6alkylene-NR 7 R 8 In some embodiments, R 3 in formula (I) and formula (la) is -Ci-C4alkylene-NR 7 R 8 In some embodiments, R 3 in formula (I) and formula (la) is -Ci-alkylene-NR 7 R8 In some embodiments, R in Formula (I) and Formula (Ia) 3 It is -C2--alkylene-NR 7 R 8 In some embodiments, R in Formula (I) and Formula (Ia) 3 is -C3-alkylene-NR 7 R 8 In some embodiments, R in Formula (I) and Formula (Ia) 3 is -C4-alkylene-NR 7 R 8 In some embodiments, R in Formula (I) and Formula (Ia) 3 is -C5-alkylene-NR 7 R 8 In some embodiments, R in Formula (I) and Formula (Ia) 3 Yes-C 0- C 10 In some embodiments, R in Formula (I) and Formula (Ia) 3 Is -C1-C6 alkylene-heterocycloalkyl, wherein the heterocycloalkyl contains 1 to 3 nitrogen and 0 to 2 oxygen. In some embodiments, R in formula (I) and formula (Ia) 3 It is -C1-C6 alkylene-heterocyclic aryl.
[0252] In some embodiments, R in Formula (I) and Formula (Ia) 7 and R 8 Each of R is independently hydrogen or substituted or unsubstituted C1-C6 alkyl. 7 and R 8 Each of R is independently hydrogen or substituted or unsubstituted C1-C3 alkyl. 7 and R 8 Each of R is independently a substituted or unsubstituted C1-C3 alkyl. 7 and R 8 Each of R and R is independently -CH3, -CH2CH3, -CH2CH2CH3, or -CH(CH3)2. 8 Each of is CH3. In some embodiments, R 7 and R 8 Each of them is -CH2CH3.
[0253] In some embodiments, R in Formula (I) and Formula (Ia) 7 and R 8together with the nitrogen to which they are attached form substituted or unsubstituted C2-C6heterocycloalkyl. In some embodiments, R 7 together with the nitrogen to which they are attached form substituted or unsubstituted C2-C6heterocycloalkyl. In some embodiments, R 8 together with the nitrogen to which they are attached form substituted or unsubstituted C2-C6heterocycloalkyl. In some embodiments, R 7 together with the nitrogen to which they are attached form substituted or unsubstituted C2-C6heterocycloalkyl. In some embodiments, R 8 together with the nitrogen to which they are attached form substituted or unsubstituted 3- to 7-membered heterocycloalkyl.
[0254] In some embodiments, R 3 is
[0255]
[0256] In some embodiments, R 3 is
[0257]
[0258] In some embodiments, R 3 is
[0259]
[0260] In some embodiments, Z in formula (I) and formula (la) is -C(=0)0- or -OC(=0)-.
[0261] In some embodiments, Z in formula (I) and formula (la) is -C(=0)NR 4 - or -NR 4 C(=0)-.
[0262] In some embodiments, Z in formula (I) and formula (la) is -C(=0)N(CH3)-, -N(CH3)C(=0)-, -C(=0)NH-, or -NHC(=0)-.
[0263] In some embodiments, Z in formula (I) and formula (la) is -OC(=0)0-, -NR 4 C(=0)0-, -OC(=0)NR 4 -, or -NR 4 C(=0)NR 4 -.
[0264] In some embodiments, Z in Formula (I) and Formula (Ia) is -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, -N(CH3)C(=O)O-, -OC(=O)N(CH3)-, -N(CH3)C(=O)N(CH3)-, -NHC(=O)N(CH3)-, or -N(CH3)C(=O)NH-.
[0265] In some embodiments, Y in Formula (I) and Formula (Ia) is -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, or -NHC(=O)NH-.
[0266] In some embodiments, R in Formula (I) and Formula (Ia) 5 is hydrogen or a substituted or unsubstituted C1-C3 alkyl group.
[0267] In some embodiments, R in Formula (I) and Formula (Ia) 5 It is H, -CH3, -CH-)CH3, -CH2CH2CH3, or -CH(CH3)2.
[0268] In some embodiments, R in Formula (I) and Formula (Ia) 5 It’s H.
[0269] Exemplary lipids of WO2022140252
[0270] On the other hand, the amino lipid is according to any formula or structure as described in International Publication No. WO2022140252, or a pharmaceutically acceptable salt or solvate thereof, which is hereby incorporated by reference in its entirety. In some embodiments, the amino lipid has a structure according to any of Formulas A', A, I", I', I, II", II', II, III', III, I"-a, I'-a, Ia, I"-ai, I"-a-ii, I"-a-iii, I"-b, I'-b, Ib, I"-bi, I"-b-ii, I"-b-iii, I"-c, I'-c, Ic, I"-ci, I"-c-ii, I"-c-iii, I'-d, Id, I'-di, II-a, II-ai, III-a and III-ai of WO2022140252, or a pharmaceutically acceptable salt or solvate thereof. Exemplary amino lipids also include any of the lipids in Table 1 of WO2022140252, including any of the lipids represented by Examples 7-1 to 7-253 and Examples 8-1 to 8-106, or a pharmaceutically acceptable salt or solvate thereof.
[0271] In some embodiments, the amino lipid is according to formula A′ of WO2022140252:
[0272]
[0273] or its N-oxide or a pharmaceutically acceptable salt thereof, wherein
[0274] L 1 Does not exist, C 1-6 Alkylene or C 2-6 heteroalkylene;
[0275] Each L 2 are independently optionally substituted C 2-15 Alkylene, or optionally substituted C 3-15 heteroalkylene;
[0276] L is C 1-10 Alkylene, or C 2-10 heteroalkylene;
[0277] X 2 is -OC(O)-, -C(O)O- or -OC(O)O-;
[0278] X is absent, -OC(O)-, -C(O)O-, or -OC(O)O-;
[0279] R" is hydrogen, or an optionally substituted group selected from: C 6-20 aliphatic, 3- to 12-membered cycloaliphatic, 7- to 12-membered bridged bicyclic radical containing 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, 1-adamantyl, 2-adamantyl, sterol, and phenyl;
[0280] R and R a Each of which is independently hydrogen, or an optionally substituted group selected from the following: C 6-20 aliphatic, 3- to 12-membered cycloaliphatic, 7- to 12-membered bridged bicyclic radical containing 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, 1-adamantyl, 2-adamantyl, sterol, and phenyl;
[0281] L 3 and L 3a Each of which is independently absent, optionally substituted C 1-10 Alkylene, or optionally substituted C 2-10 heteroalkylene;
[0282] R 1hydrogen, optionally substituted phenyl, optionally substituted 3- to 7-membered cycloaliphatic, optionally substituted 3- to 7-membered heterocyclyl containing 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, optionally substituted 5- to 6-membered monocyclic heteroaryl containing 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, optionally substituted 8- to 10-membered bicyclic heteroaryl containing 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, -OR 2 , -C(O)OR 2 , -C(O)SR 2 , -OC(O)R 2 , -OC(O)OR 2 , -CN, -N(R 2 )2, -C(O)N(R 2 )2, -S(O)2N(R 2 )2, -NR 2 C(O)R 2 , -OC(O)N(R 2 )2, -N(R 2 )C(O)OR 2 , -NR 2 S(O)2R 2 , -NR 2 C(O)N(R 2 )2, -NR 2 C(S)N(R 2 )2, -NR 2 C(NR 2 )N(R 2 )2, -NR 2 C(CHR 2 )N(R 2 )2, -N(OR 2 )C(O)R 2 , -N(OR 2 )S(O)2R 2 , -N(OR 2 )C(O)OR 2 , -N(OR 2 )C(O)N(R 2 )2, -N(OR 2 )C(S)N(R 2 )2, -N(OR 2 )C(NR 2 )N(R 2 )2, -N(OR 2 )C(CHR 2 )N(R 2 )2, -C(NR 2 )N(R 2 )2, -C(NR2 )R 2 ,-C(O)N(R 2 )OR 2 ,-C(R 2 )N(R 2 )2C(O)OR 2 , -CR 2 (R 3 )2,-OP(O)(OR 2 )2, or -P(O)(OR 2 )2; or
[0283] R 1 for or a ring selected from 3 to 7 membered cycloaliphatic and 3 to 7 membered heterocyclyl containing 1 to 3 heteroatoms independently selected from nitrogen, oxygen and sulfur, wherein the cycloaliphatic ring or heterocyclyl ring is optionally substituted by 1 to 4 R 2 or R 3 group substitution;
[0284] Each R 2 are independently hydrogen, oxo, -CN, -NO2, -OR 4 、-S(O)2R 4 、-S(O)2N(R 4 )2、-(CH2) n -R 4 or an optionally substituted group selected from: C 1-6 aliphatic, phenyl, 3- to 7-membered cycloaliphatic, 5- to 6-membered monocyclic heteroaryl containing 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, and 3- to 7-membered heterocyclyl containing 1-3 heteroatoms independently selected from nitrogen, oxygen and sulfur; or
[0285] Two occurrences of R 2 together with the atom or atoms to which they are attached form an optionally substituted 4- to 7-membered heterocyclyl containing 0-1 additional heteroatoms selected from nitrogen, oxygen and sulfur;
[0286] Each R 3 are independently -(CH2) n -R 4 ;or
[0287] Two occurrences of R 3 together with the atom or atoms to which they are attached form an optionally substituted 5- to 6-membered heterocyclyl containing 0-1 additional heteroatoms selected from nitrogen, oxygen and sulfur;
[0288] Each R 4 are independently hydrogen, -OR 5 、-N(R 5)2, -OC(O)R 5 , -OC(O)OR 5 , -CN, -C(O)N(R 5 )2, -NR 5 C(O)R 5 , -OC(O)N(R 5 )2, -N(R 5 )C(O)OR 5 , -NR 5 S(O)2R 5 , -NR 5 C(O)N(R 5 )2, -NR 5 C(S)N(R 5 )2, -NR 5 C(NR 5 )N(R 5 )2or
[0289] each R 5 is independently hydrogen or optionally substituted C 1-6 aliphatic; or
[0290] two occurrences of R 5 , together with the atom or atoms to which they are attached, form an optionally substituted 4- to 7-membered heterocyclyl comprising 0-1 additional heteroatom selected from nitrogen, oxygen, and sulfur;
[0291] each R 6 is independently C 4-12 aliphatic; and
[0292] each n is independently 0 to 4.
[0293] In some embodiments, the aminolipid is according to Formula III-a of WO2022140252:
[0294]
[0295] or an N-oxide thereof, or a pharmaceutically acceptable salt thereof, wherein each of R, R 1 , L, L 1 , L 2 , L 3 is as defined in this patent application for any of Formulae A', A, III', and III, and is described individually and in combination in the classes and subclasses above and herein. In embodiments of Formula III-a, each of R, R 1 , L, L 1 , L 2 , L 3each of which is as defined herein above for Formula A’.
[0296] In some embodiments, the aminolipid is according to Formula III-a-i of WO2022140252:
[0297]
[0298] or an N-oxide thereof, or a pharmaceutically acceptable salt thereof, wherein R, R 1 , L, L 1 , and L 2 each of which is as defined in this patent application for any of Formulae A’, A, III’, and III, and is described in the classes and subclasses above and herein, both singly and in combination. In embodiments of Formula III-a-i, each of R, R 1 , L, L 1 , and L 2 is as defined herein above for Formula A’.
[0299] In some embodiments, the aminolipid is selected from any of the lipids described in Table 1 of WO2022140252, or an N-oxide thereof, or a pharmaceutically acceptable salt thereof. In embodiments, the aminolipid is selected from the group consisting of:
[0300]
[0301]
[0302]
[0303]
[0304] In some embodiments, the amino lipid is Example 7-1, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-2, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-19, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-20, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-22, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-24, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-25, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-1, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-2, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-3, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-4, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-5, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-13, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-14, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-17, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-18, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-19, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-20, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-55, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-57, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-58, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-59, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-60, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-61, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-62, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-63, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-232, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-233, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-234, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-235, or a pharmaceutically acceptable salt thereof.In some embodiments, the amino lipid is Example 7-236, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-237, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-238, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-239, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-67, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-68, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-69, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-70, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-71, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 8-72, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-243, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-244, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-245, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 7-246, or a pharmaceutically acceptable salt thereof.
[0305] Exemplary lipids of WO2022159472
[0306] On the other hand, amino lipid is according to any formula or structure as described in International Publication No. WO2022159472, or its pharmaceutically acceptable salt or solvate, and this international publication is hereby incorporated by reference as a whole.In some embodiments, amino lipid has the structure according to any one of Formula I, II, III, IIIA, IIIB, IIIC, IV, V, VA, VI, VIA, VII and VIIA of WO2022159472, or its pharmaceutically acceptable salt or solvate.Exemplary amino lipid also includes any lipid in the lipid in the table 1 of WO2022159472, including any lipid in the lipid represented by embodiment 4-1 to 4-86, or its pharmaceutically acceptable salt or solvate.
[0307] In some embodiments, the amino lipid is according to Formula I of WO2022159472:
[0308]
[0309] or a pharmaceutically acceptable salt thereof, wherein:
[0310] L 1 is a covalent bond, -C(O)- or -OC(O)-;
[0311] L 2 is a covalent bond, an optionally substituted divalent saturated or unsaturated linear or branched C1-C 12 hydrocarbon chain, or
[0312] Cy A is an optionally substituted ring selected from phenylene and a 3- to 7-membered saturated or partially unsaturated carbocyclic ring;
[0313] Each m is independently 0, 1 or 2;
[0314] L 3 is a covalent bond, -C(O)-, -C(O)O-, -OC(O)-, -O- or -OC(O)O-;
[0315] R 1 for Optionally substituted saturated or unsaturated linear or branched C1-C 20 A hydrocarbon chain in which 1 to 3 methylene units are optionally and independently replaced by -O- or -NR-, or
[0316] Cy B is an optionally substituted ring selected from a 3- to 12-membered saturated or partially unsaturated carbocyclyl, 1-adamantyl, 2-adamantyl, sterol groups and phenyl groups;
[0317] p is 0, 1, 2, or 3;
[0318] Each L 4 are independently divalent saturated or unsaturated linear or branched C1-C6 hydrocarbon chains;
[0319] Each A 1 and A 2 are independently optionally substituted C1-C 20 Aliphatic or -L 5 -R 5 ;
[0320] or A 1 and A 2 Together with their intervening atoms, they may form an optionally substituted ring:
[0321] in
[0322] x is selected from 1 or 2; and
[0323] # indicates that the 4 attachment points;
[0324] Each L 5 are independently divalent saturated or unsaturated straight chain or branched C1-C 20 A hydrocarbon chain in which 1 to 3 methylene units are optionally and independently replaced by -O- or -NR-;
[0325] Each R 5 are each independently an optionally substituted group selected from a 5- to 10-membered aryl ring or a 3- to 8-membered carbocyclic ring;
[0326] X 1 is a covalent bond, -O- or -NR-;
[0327] X 2 is a covalent bond or an optionally substituted divalent saturated or unsaturated linear or branched C1-C 12 A hydrocarbon chain wherein 1 to 3 methylene units are optionally and independently replaced by -O-, -NR- or -Cy C - Substitution;
[0328] Cy C is an optionally substituted ring selected from a 3- to 7-membered saturated or partially unsaturated carbocyclic ring, a phenylene group, a 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen and sulfur, and a 5- to 6-membered heteroarylene group having 1-3 heteroatoms independently selected from nitrogen, oxygen and sulfur;
[0329] X 3 is hydrogen or an optionally substituted ring selected from a 3- to 7-membered saturated or partially unsaturated carbocyclic ring, phenyl, a 3- to 7-membered saturated or partially unsaturated heterocyclic group having 1-3 heteroatoms independently selected from nitrogen, oxygen and sulfur, or a 5- to 6-membered heteroaryl group having 1-3 heteroatoms independently selected from nitrogen, oxygen and sulfur; and
[0330] Each R is independently hydrogen or an optionally substituted C1-C6 aliphatic group;
[0331] The condition is that when L 3 When it is a covalent bond, R 1 Must be
[0332] In some embodiments, the amino lipid is according to Formula VI of WO2022159472:
[0333]
[0334] or a pharmaceutically acceptable salt thereof, wherein n is 1, 2, 3 or 4, and L 2 、R 1 、A 1 、A 2 、X 1、X 2 and X 3 As defined in that patent application for Formula I, and also described individually and in combination in classes and subclasses in that patent application. In an embodiment, L 2 、R 1 、A 1 、A 2 、X 1 、X 2 and X 3 As defined herein above for Formula I.
[0335] In some embodiments, the amino lipid is according to Formula VIA of WO2022159472:
[0336]
[0337] or a pharmaceutically acceptable salt thereof, wherein n is 1, 2, 3 or 4, and L 2 、R 1 、A 1 、A 2 、X 2 and X 3 As defined in that patent application for Formula I, and also described individually and in combination in classes and subclasses in that patent application. In an embodiment, L 2 、R 1 、A 1 、A 2 、X 2 and X 3 As defined herein above for Formula I.
[0338] In some embodiments, the amino lipid is selected from any of the lipids described in Table 1 of WO2022159472, or a pharmaceutically acceptable salt thereof. In embodiments, the amino lipid is selected from the group consisting of:
[0339]
[0340] Example 4-62
[0341]
[0342] Example 4-63
[0343]
[0344] Example 4-64
[0345]
[0346] Example 4-65
[0347]
[0348] Example 4-66
[0349]
[0350] Example 4-67
[0351]
[0352] Example 4-68
[0353]
[0354] Example 4-69
[0355]
[0356] Example 4-70
[0357]
[0358] Example 4-71
[0359]
[0360] Example 4-72
[0361]
[0362] Example 4-73
[0363]
[0364] Example 4-74
[0365]
[0366] Example 4-75
[0367]
[0368] Example 4-76
[0369]
[0370] Example 4-77
[0371]
[0372] Example 4-78
[0373]
[0374] Example 4-79
[0375]
[0376] Example 4-80
[0377]
[0378] Example 4-81
[0379]
[0380] Example 4-82
[0381]
[0382] Example 4-83
[0383]
[0384] Example 4-84
[0385]
[0386] Example 4-85
[0387]
[0388] Example 4-86
[0389] In some embodiments, the amino lipid is Example 4-62, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-63, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-64, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-65, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-66, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-67, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-68, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-69, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-70, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-71, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-72, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-73, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-74, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-75, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-76, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-77, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-78, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-79, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-80, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-81, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-82, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-83, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-84, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-85, or a pharmaceutically acceptable salt thereof. In some embodiments, the amino lipid is Example 4-86, or a pharmaceutically acceptable salt thereof.
[0390] LNP compositions containing different amino lipids
[0391] In some embodiments, the LNP comprises a plurality of amino lipids having different formulas. For example, the LNP composition can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino lipids. For another example, the LNP composition can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 9, at least 10, or at least 20 amino lipids. For yet another example, the LNP composition can comprise at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 9, at most 10, at most 20, or at most 30 amino lipids.
[0392] In some embodiments, the LNP composition comprises a first amino lipid. In some embodiments, the LNP composition comprises a first amino lipid and a second amino lipid. In some embodiments, the LNP composition comprises a first amino lipid, a second amino lipid, and a third amino lipid. In some embodiments, the LNP composition comprises a first amino lipid, a second amino lipid, a third amino lipid, and a fourth amino lipid. In some embodiments, the LNP composition does not comprise a fourth amino lipid. In some embodiments, the LNP composition does not comprise a third amino lipid. In some embodiments, the molar ratio of the first amino lipid to the second amino lipid is about 0.1 to about 10. In some embodiments, the molar ratio of the first amino lipid to the second amino lipid is about 0.20 to about 5. In some embodiments, the molar ratio of the first amino lipid to the second amino lipid is about 0.25 to about 4. In some embodiments, the molar ratio of the first amino lipid to the second amino lipid is about 0.25, about 0.33, about 0.5, about 1, about 2, about 3, or about 4.
[0393] In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 4:1:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 1:1:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 2:1:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 2:2:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 3:2:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 3:1:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 5:1:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 3:3:1. In some embodiments, the molar ratio of the first amino lipid:second amino lipid:third amino lipid is about 4:4:1 。
[0394] Additional Amino Lipid Embodiments
[0395] In some embodiments, the LNP composition comprises one or more amino lipids. In some embodiments, the one or more amino lipids comprise about 40 mol% to about 65 mol% of the total lipids present in the particle. In some embodiments, the one or more amino lipids comprise about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, about 49 mol%, about 50 mol%, about 51 mol%, about 52 mol%, about 53 mol%, about 54 mol%, about 55 mol%, about 56 mol%, about 57 mol%, about 58 mol%, about 59 mol%, about 60 mol%, about 61 mol%, about 62 mol%, about 63 mol%, about 64 mol%, or about 65 mol% of the total lipids present in the particle. In some embodiments, the first amino lipid comprises about 1 mol% to about 99 mol% of the total amino lipids present in the particle. In some embodiments, the first amino lipid comprises about 16.7 mol% to about 66.7 mol% of the total amino lipids present in the particle. In some embodiments, the first amino lipid comprises about 20 mol% to about 60 mol% of the total amino lipids present in the particle.
[0396] In some embodiments, the amino lipid is an ionizable lipid. The ionizable lipid can comprise one or more ionizable nitrogen atoms. In some embodiments, at least one of the one or more ionizable nitrogen atoms is positively charged. In some embodiments, at least 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, 95 mol%, or 99 mol% of the ionizable nitrogen atoms in the LNP composition are positively charged. In some embodiments, the amino lipid comprises a primary amine, a secondary amine, a tertiary amine, an imine, an amide, a guanidine moiety, a histidine residue, a lysine residue, an arginine residue, or any combination thereof. In some embodiments, the amino lipid comprises a primary amine, a secondary amine, a tertiary amine, a guanidine moiety, or any combination thereof. In some embodiments, the amino lipid comprises a tertiary amine.
[0397] In some embodiments, the amino lipid (e.g., ionizable lipid) is a cationic lipid. In some embodiments, the cationic lipid is an ionizable lipid. In some embodiments, the amino lipid comprises one or more nitrogen atoms. In some embodiments, the amino lipid comprises one or more ionizable nitrogen atoms. Exemplary cationic and / or ionizable lipids include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tris(dodecyl)-1-piperazinethanamine (KL10), N142-(didodecylamino)ethyl]-N1,N4,N4-tris(dodecyl)-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-triacontane (KL25), 1,2-dilinoleyl- N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]- dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl 4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleoyl-N,N-dimethylaminopropane (DODMA), 2-({8-[(3ß)-cholest-5-en-3- yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3ß)-cholest-5-en-3-yl oxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)- octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA(2R)), and (2S)-2-({8-[(3ß)-cholest-5-en-3- yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA(2S)).
[0398] In some embodiments, the amino lipids described herein can take the form of a salt, e.g., a pharmaceutically acceptable salt. The present disclosure encompasses all pharmaceutically acceptable salts of the amino lipids. As used herein, the term “amino lipid” also includes its pharmaceutically acceptable salts and its diastereomeric, enantiomeric, and epimeric forms.
[0399] In some embodiments, the aminolipids described herein have one or more stereocenters and each stereocenter is independently present in the R or S configuration. The lipids presented herein include all diastereomeric, enantiomeric, and epimeric forms as well as their appropriate mixtures. The lipids provided herein include all cis, trans, syn, anti, entgegen (E) and zusammen (Z) isomers and their appropriate mixtures. In certain embodiments, the lipids described herein are prepared into their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereomeric compounds / salts which are separated and the optically pure enantiomers are recovered. In some embodiments, resolution of the enantiomers is carried out using covalent diastereomeric derivatives of the compounds described herein. In another embodiment, the diastereomers are separated by separation / resolution techniques based on differences in solubility. In other embodiments, the separation of stereoisomers is carried out by chromatography or by forming diastereomeric salts and separating by recrystallization or chromatography or any combination thereof. Jean Jacques, Andre Collet, Samuel H. Wilen, "Enantiomers, Racemates and Resolutions", John Wiley and Sons, Inc., 1981. In one aspect, the stereoisomers are obtained by stereoselective synthesis.
[0400] In some embodiments, the lipids (such as aminolipids) are substituted based on the structures disclosed herein. In some embodiments, the lipids (such as aminolipids) are unsubstituted. In another embodiment, the lipids described herein are isotopically-labeled (e.g., with radioisotopes) or labeled by another other means including, but not limited to, using a chromophoric or fluorescent moiety, a bioluminescent label, or a chemiluminescent label.
[0401] The lipids described herein include isotopically-labeled compounds, which are identical to those recited in the various formulae and structures presented herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into lipids of the application include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, and chlorine, such as, for example 2 H, 3 H, 13 C, 14 C, 15 N, 18 O, 17 O, 35 S, 18F、 36 Cl. In one aspect, isotopically labeled lipids described herein, e.g., those incorporating a radioisotope such as 3 H and 14 C) can be used in drug and / or substrate tissue distribution assays. In one aspect, substitution with isotopes such as deuterium provide certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements.
[0402] In some embodiments, the asymmetric carbon atom of the amino lipid is present in an enantiomerically enriched form. In certain embodiments, the asymmetric carbon atom of the amino lipid has at least a 50% enantiomeric excess in the (S)- or (R)-configuration, at least a 60% enantiomeric excess, at least a 70% enantiomeric excess, at least a 80% enantiomeric excess, at least a 90% enantiomeric excess, at least a 95% enantiomeric excess, or at least a 99% enantiomeric excess.
[0403] In some embodiments, the disclosed amino lipids can be converted to N-oxides. In some embodiments, the N-oxides are formed by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid and / or hydrogen peroxide). Accordingly, disclosed herein are N-oxide compounds of the described amino lipids, which can be designated as NO or N + -O - In some embodiments, the nitrogen in the compounds of the present disclosure can be converted to an N-hydroxy or N-alkoxy group. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine with an oxidizing agent such as ra-CPBA. All of the illustrated nitrogen-containing compounds are also contemplated. Accordingly, also disclosed herein are N-hydroxy and N-alkoxy (e.g., N-OR, where R is a substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3- to 14-membered carbocyclic ring, or 3- to 14-membered heterocyclic ring) derivatives of the described amino lipids.
[0404] In some embodiments, the one or more amino lipids comprise about 40 mol% to about 65 mol% of the total lipids present in the particle.
[0405] PEG-lipid
[0406] In some embodiments, the LNP composition comprises one or more PEG-lipids. As used herein, "PEG lipid" or "PEG-lipid" refers to a lipid comprising a polyethylene glycol component. Examples of suitable PEG-lipids also include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the one or more PEG-lipids can include PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE lipids, or combinations thereof.
[0407] In some embodiments, the PEG-lipid comprises from about 0.1 mol% to about 10 mol% of the total lipid present in the particle.
[0408] phospholipids
[0409] In some embodiments, the described LNP compositions comprise one or more phospholipids.
[0410] In some embodiments, the phospholipids comprise from about 5 mol% to about 15 mol% of the total lipids present in the particle.
[0411] cholesterol
[0412] In some embodiments, the LNP composition comprises cholesterol or a derivative thereof.
[0413] GalNAc-lipid
[0414] In some embodiments, the LNP composition comprises a receptor-targeted conjugate comprising a compound of formula (V),
[0415]
[0416] in,
[0417] The plurality of A groups collectively comprise a receptor targeting ligand;
[0418] Each L 1 、L 2 、L 3 、L 4 、L 5 、L 6 、L 7 、L 8 、L 9 、L 10 and L 12each independently substituted or unsubstituted C1-C 12 alkylene, substituted or unsubstituted C1-C 12 heteroalkylene, substituted or unsubstituted C2-C 12 alkenylene, substituted or unsubstituted C2-C 12 alkynylene, -(CH2CH2O) m -, m -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -, 1 -,
[0419] L 11 is substituted or unsubstituted -(CH2CH2O) n -, n -, n -;
[0420] each R 1 is independently H or substituted or unsubstituted C1-C6alkyl;
[0421] R is a lipid, a nucleic acid, an amino acid, a protein, or a lipid nanoparticle;
[0422] m is an integer selected from 1 to 10; and
[0423] n is an integer selected from 1 to 200.
[0424] In some embodiments, each L 1 , L 4 , and L 7 is independently substituted or unsubstituted C1-C 12 alkylene. In some embodiments, each L1 、L 4 and L 7 are independently substituted or unsubstituted C2-C6 alkylene. 1 、L 4 and L 7 In some embodiments, each L is C4 alkylene. 2 、L 5 and L 8 are independently -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR1C(=O)NR 1 , or -C(=O)NR 1 C(=O)-. In some embodiments, each L 2 、L 5 and L 8 are independently -C(=O)NR 1 -or-NR 1 C(=O)-. In some embodiments, each L 2 、L 5 and L 8 are -C(=O)NH-. In some embodiments, each L 3 、L 6 and L 9 are independently substituted or unsubstituted C 1- C 12 In some embodiments, each L 3 are substituted or unsubstituted C2-C6 alkylene. 3 is C4 alkylene. In some embodiments, each L 6 and L 9 are independently substituted or unsubstituted C2-C 10 In some embodiments, each L 6 and L 9 are independently substituted or unsubstituted C2-C6 alkylene. 6 and L 9 In some embodiments, A binds to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, A is N-acetylgalactosamine (GalNAc) or Derivatives. A is N-acetylgalactosamine (GalNAc) or its derivatives.
[0425] In some embodiments, the receptor-targeting conjugate comprises about 0.001 mol% to about 20 mol% of the total lipid content present in the nanoparticle composition.
[0426] Phosphate charge neutralizer
[0427] In some embodiments, the LNP described herein comprises a phosphate charge neutralizer. In some embodiments, the phosphate charge neutralizer comprises arginine, asparagine, glutamine, lysine, histidine, a cationic dendrimer, a polyamine, or a combination thereof. In some embodiments, the phosphate charge neutralizer comprises one or more nitrogen atoms. In some embodiments, the phosphate charge neutralizer comprises a polyamine.
[0428] Suitable phosphate charge neutralizers to be used in the LNP formulations set forth below include, for example, but are not limited to, spermidine and 1,3-propanediamine.
[0429] antioxidants
[0430] In some embodiments, the LNP described herein comprises one or more antioxidants. In some embodiments, the one or more antioxidants function to reduce degradation of the cationic lipid, the payload, or both. In some embodiments, the one or more antioxidants comprise a hydrophilic antioxidant. In some embodiments, the one or more antioxidants are chelators, such as ethylenediaminetetraacetic acid (EDTA) and citrate. In some embodiments, the one or more antioxidants comprise a lipophilic antioxidant. In some embodiments, the lipophilic antioxidant comprises a vitamin E isomer or a polyphenol. In some embodiments, the one or more antioxidants are present in the LNP composition at a concentration of at least 1 mM, at least 10 mM, at least 20 mM, at least 50 mM, or at least 100 mM. In some embodiments, the one or more antioxidants are present in the particle at a concentration of about 20 mM.
[0431] Other lipids
[0432] In some embodiments, the disclosed LNP compositions can comprise a helper lipid. In some embodiments, the disclosed LNP compositions comprise a neutral lipid. In some embodiments, the disclosed LNP compositions comprise a stealth lipid. In some embodiments, the disclosed LNP compositions comprise an additional lipid. The neutral lipid can function to stabilize and improve LNP processing.
[0433] "Helper lipid" can refer to a lipid that enhances transfection (e.g., transfection of nanoparticles (LNPs) comprising a composition as provided herein (including a bioactive agent). The mechanism by which the helper lipid enhances transfection includes enhancing particle stability. In some embodiments, the helper lipid enhances the fusogenicity of the membrane. The helper lipid can include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure can include, but are not limited to, cholesterol, 5-heptadecanylresorcinol, and cholesterol hemisuccinate. In some embodiments, the helper lipid is cholesterol. In some embodiments, the helper lipid can be cholesterol hemisuccinate.
[0434] " Stealth lipid " can refer to the lipid that changes the time length that nanoparticle can exist in vivo (for example, in blood). Stealth lipid can assist formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipid used herein can regulate the pharmacokinetic properties of LNP. Stealth lipid suitable for lipid composition of the present disclosure can include but is not limited to the stealth lipid with the hydrophilic head group connected to the lipid moiety. Stealth lipid suitable for lipid composition of the present disclosure and the biochemical information about this type of lipid can be found in Romberg et al., Pharmaceutical Research, Vol. 25, No. 1, 2008, pp. 55-71 and I-Toekstra et al., Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed in, for example, WO 2006 / 007712.
[0435] In some embodiments, the stealth lipid is a PEG-lipid. In one embodiment, the hydrophilic head group of the stealth lipid comprises a polymer portion selected from a polymer based on PEG (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinyl pyrrolidone), polyamino acids, and poly-N-(2-hydroxypropyl) methacrylamide. The stealth lipid may comprise a lipid portion. In some embodiments, the lipid portion of the stealth lipid may be derived from diacylglycerols or diacylglycerol amides, including those comprising dialkylglycerols or dialkylglycerolamide groups having an alkyl chain length independently comprising about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups, such as, for example, amides or esters. The dialkylglycerols or dialkylglycerolamide groups may further comprise one or more substituted alkyls.
[0436] The structure and properties of helper lipids, neutral lipids, stealth lipids, and / or other lipids are further described in WO2017173054A1, WO2019067999A1, US20180290965A1, US20180147298A1, US20160375134A1, US8236770, US8021686, US8236770B2, US7371404B2, US7780983B2, US7858117B2, US20180200186A1, US20070087045A1, WO2018119514A1, and WO20190679992A1, all of which are hereby incorporated by reference in their entirety.
[0437] LNP formulations
[0438] Described herein are particular formulations of nanoparticle compositions comprising one or more of the described lipids.
[0439] The described nanoparticle compositions are capable of delivering a therapeutic agent, such as an RNA, to a particular cell, tissue, organ, or system of the mammalian body, or a group thereof. The physicochemical properties of the nanoparticle composition can be varied to increase selectivity for a particular body target. For example, the particle size can be adjusted based on the fenestration size of different organs. The therapeutic agent included in the nanoparticle composition can also be selected based on one or more desired delivery targets. For example, the therapeutic agent can be selected for a particular indication, condition, disease, or disorder and / or for delivery to a particular cell, tissue, organ, or system, or a group thereof (e.g., local or specific delivery). In certain embodiments, the nanoparticle composition can comprise an mRNA encoding a polypeptide of interest that is capable of being translated within a cell to produce the polypeptide of interest (e.g., a base editor). Such a composition can have specificity or affinity for a particular organ or cell type to facilitate delivery of the drug substance to that particular organ or cell type, e.g., the liver or liver cells.
[0440] The amount of therapeutic agent or drug substance (e.g., mRNA and guide RNA encoding base editors) in the LNP composition can depend on the size, composition, desired target and / or application, or other characteristics of the nanoparticle composition. For example, the amount of RNA contained in the nanoparticle composition can depend on the size, sequence and other characteristics of the RNA. The relative amounts of therapeutic agent and other components (e.g., lipids) in the nanoparticle composition can also vary. In some embodiments, the wt / wt ratio of the lipid component to the therapeutic agent in the nanoparticle composition can be about 5:1 to about 60:1, such as about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic agent can be about 10: 1 to about 40: 1. In certain embodiments, the wt / wt ratio is about 20: 1. The amount of therapeutic agent in the nanoparticle composition can be measured using absorption spectroscopy (e.g., UV-visible spectroscopy).
[0441] In some embodiments, the LNP formulation comprises one or more nucleic acids, such as RNA. In some embodiments, one or more RNAs, lipids, and their amounts can be selected to provide a specific N / P ratio. The N / P ratio can be selected from about 1 to about 30. The N / P ratio can be selected from about 2 to about 12. In some embodiments, the N / P ratio is about 0.1 to about 50. In some embodiments, the N / P ratio is about 2 to about 8. In some embodiments, the N / P ratio is about 2 to about 15, about 2 to about 10, about 2 to about 8, about 2 to about 6, about 3 to about 15, about 3 to about 10, about 3 to about 8, about 3 to about 6, about 4 to about 15, about 4 to about 10, about 4 to about 8, or about 4 to about 6. In some embodiments, the N / P ratio is about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 9, or about 10. In some embodiments, the N / P ratio is about 4 to about 6. In some embodiments, the N / P ratio is about 4, about 4.5, about 5, about 5.5, or about 6.
[0442] As used herein, "N / P ratio" is, for example, the molar ratio of ionizable (e.g., within the physiological pH range) nitrogen atoms in a lipid (or multiple lipids) to a phosphate group in a nucleic acid molecule entity (or multiple nucleic acid molecule entities) in a nanoparticle composition comprising a lipid component and RNA. Ionizable nitrogen atoms can include, for example, nitrogen atoms that can be protonated at about pH 1, about pH 2, about pH 3, about pH 4, about pH 4.5, about pH 5, about pH 5.5, about pH 6, about pH 6.5, about pH 7, about pH 7.5, or about pH 8 or higher. Physiological pH ranges can include, for example, the pH ranges of different cellular compartments (such as organs, tissues, and cells) and body fluids (such as blood, CSF, gastric juice, milk, bile, saliva, tears, and urine). In some specific embodiments, physiological pH ranges refer to the pH range of mammalian blood, for example, from about 7.35 to about 7.45. Similarly, for phosphate charge neutralizers having one or more ionizable nitrogen atoms, the N / P ratio can refer to the molar ratio of ionizable nitrogen atoms in the phosphate charge neutralizer to phosphate groups in the nucleic acid. In some embodiments, ionizable nitrogen atoms refer to those nitrogen atoms that are ionizable within a pH range of 5 to 14.
[0443] For payloads that do not contain phosphate groups, the N / P ratio can refer to the molar ratio of ionizable nitrogen atoms in the lipid to the total negative charge in the payload. For example, the N / P ratio of an LNP composition can refer to the molar ratio of the total ionizable nitrogen atoms in the LNP composition to the total negative charge in the payload present in the composition.
[0444] In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 70%, about 70% to about 90%, or about 90% to about 100%. In some embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 75% to about 98%.
[0445] On the other hand, provided herein are lipid nanoparticles (LNPs) comprising compositions as provided herein. As used herein, "lipid nanoparticle (LNP) compositions" or "nanoparticle compositions" are compositions comprising one or more described lipids. The size of the LNP compositions is typically micrometers or smaller orders of magnitude and can comprise a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipid complexes. In some embodiments, LNPs refer to any particles having a diameter less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. In some embodiments, the size range of the nanoparticles can be 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 40-100 nm, 50-100 nm, 50-90 nm, 50-80 nm, 50-70 nm, 55-95 nm, 55-80 nm, 55-75 nm, 60-100 nm, 60-90 nm, 60-80 nm, 60-70 nm, 25-100 nm, 25-80 nm, or 40-80 nm.
[0446] In some embodiments, LNP can be made up of cation, anion or neutral lipid.In some embodiments, LNP can comprise neutral lipid (such as phospholipid 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE) or membrane component cholesterol of promoting fusion) as auxiliary lipid to enhance transfection activity and nanoparticle stability.In some embodiments, LNP can comprise hydrophobic lipid, hydrophilic lipid, or hydrophobic lipid and hydrophilic lipid.Any lipid known in the art or lipid combination all can be used for producing LNP. Examples of lipids used to generate LNPs include, but are not limited to, DOTMA (N[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DOSPA (N,N-dimethyl-N-([2-sperminecarboxamido]ethyl)-2,3-bis(dioleoyloxy)-1-propanium pentahydrochloride), DOTAP (1,2-dioleoyl-3-trimethylpropanium), DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy-1-bromopropanium), DC-cholesterol (3β-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol), DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE (2-bis(dimethylphosphino)ethane)-polyethylene glycol (PEG). In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.In some embodiments, the present invention provides the lipid of the present invention.
[0447] The definitions of terms in the following eight paragraphs apply only to the compounds of formula (I), (Ia) and (V) above.
[0448] Unless otherwise indicated, the term "substituted" means that one or more hydrogen radicals in a given structure are replaced with the radical of a specified substituent, including, but not limited to, halogen, alkyl, alkenyl, alkynyl, aryl, heterocyclyl, thiol, alkylthio, oxo, thioxy, arylthio, alkylthioalkyl, arylthioallcyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkyloxy, aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl, carboxyalkyl, alkoxycarbonylalkyl, aminocarbonylalkyl, acyl, aralkyloxycarbonyl, carboxylic acid, sulfonic acid, sulfonyl, phosphonic acid, aryl, heteroaryl, heterocyclic, and aliphatic groups. It should be understood that the substituents may be further substituted. Exemplary substituents include amino, alkylamino, and the like.
[0449] As used herein, the term "substituent" means a positional variable (positional variables) on the atom of the core molecule substituted at a designated atomic position, which replaces one or more hydrogens on the designated atom, provided that the normal valence of the designated atom is not exceeded and the substitution produces a stable compound. Such combinations are permitted only when the combination of substituents and / or variables produces a stable compound. Those of ordinary skill in the art should note that any carbon and heteroatom with seemingly unsatisfied valence as described or shown herein is assumed to have a sufficient number of hydrogen atoms to satisfy the valence described or shown. In some cases, one or more substituents with a double bond (e.g., "oxo" or "=O") as a point of attachment may be described, shown, or listed in a substituent group herein, wherein the structure can only show a single bond as a point of attachment to the core structure of formula (I). Those of ordinary skill in the art will understand that, although only a single bond is shown, a double bond is also intended for those substituents.
[0450] The term "alkyl" refers to a straight or branched hydrocarbon chain radical having from one to twenty carbon atoms, which is attached to the rest of the molecule by a single bond. Alkyl groups containing up to 10 carbon atoms are referred to as C1-C 10 Alkyl groups, for example, those containing up to 6 carbon atoms are C1-C6 alkyl groups. Alkyl groups containing other numbers of carbon atoms (and other moieties defined herein) are similarly represented. Alkyl groups include, but are not limited to, C1-C6 alkyl groups. 10 Alkyl, C1-C9 alkyl, C1-C8 alkyl, C1-C7 alkyl, C1-C6 alkyl, C 1-C5 alkyl, C1-C4 alkyl, C1-C3 alkyl, C1-C2 alkyl, C2-C8 alkyl, C3-C8 alkyl and C4-C8 alkyl.Representative alkyl includes but is not limited to methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, isobutyl, sec-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, 1-ethyl-propyl group etc.In some embodiments, alkyl is methyl or ethyl.In some embodiments, alkyl is-CH (CH3) 2 or-C (CH3) 3.Unless otherwise specifically stated in the specification, alkyl can be optionally substituted as described below." alkylene group" or "alkylene chain" refers to the straight or branched divalent hydrocarbon chain connecting the rest of the molecule to a group.In some embodiments, alkylene group is-CI-12-,-CH2CH2- or-CH2CH2CH2-.In some embodiments, alkylene group is-CH2-. In some embodiments, alkylene is -CH2CH2-. In some embodiments, alkylene is -CH2CH2CH2-.
[0451] The term "alkenyl" refers to a type of alkyl group in which at least one carbon-carbon double bond is present. In one embodiment, the alkenyl group has the formula -C(R)=CR 2 , wherein R refers to the remaining portion of the alkenyl group, which can be the same or different. In some embodiments, R is H or an alkyl group. In some embodiments, the alkenyl group is selected from ethenyl (i.e., vinyl), propenyl (i.e., allyl), butenyl, pentenyl, pentadienyl, etc. Non-limiting examples of alkenyl groups include -CH=CH2, -C(CH3)=CH2, -CH=CHCH3, -C(CH3)=CHCH3, and -CH2CH=CH2.
[0452] The term "cycloalkyl" refers to monocyclic or polycyclic non-aromatic groups in which each atom (i.e., backbone atom) that forms a ring is a carbon atom. In some embodiments, the cycloalkyl is saturated or partially unsaturated. In some embodiments, the cycloalkyl is a spirocyclic or bridged compound. In some embodiments, the cycloalkyl is fused with an aromatic ring (in which case the cycloalkyl is bonded through a non-aromatic ring carbon atom). Cycloalkyl groups include groups having from 3 to 10 ring atoms. Representative cycloalkyl groups include, but are not limited to, cycloalkyl groups having from three to ten carbon atoms, from three to eight carbon atoms, from three to six carbon atoms, or from three to five carbon atoms. Monocyclic cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In some embodiments, the monocyclic cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. In some embodiments, the monocyclic cycloalkyl is cyclopentenyl or cyclohexenyl. In some embodiments, the monocyclic cycloalkyl is cyclopentenyl. Polycyclic groups include, for example, adamantyl, 1,2-dihydronaphthyl, 1,4-dihydronaphthyl, tetrahydronaphthyl, decahydronaphthyl, 3,4-dihydronaphthene-1(2H)-one, spiro[2.2]pentyl, norbomyl, and bicyclo[l. l. l]pentyl. Unless otherwise specifically indicated herein, a cycloalkyl group can be optionally substituted. Depending on the structure, a cycloalkyl group can be monovalent or divalent (i.e., a cycloalkylene group).
[0453] The term "heterocycle" or "heterocyclyl" refers to heteroaromatic rings (also referred to as heteroaryl) and heterocycloalkyl groups (also referred to as heteroalicyclyl) that contain at least one heteroatom selected from nitrogen, oxygen, and sulfur, wherein each heterocyclyl group has from 3 to 12 atoms in its ring system, with the proviso that no ring contains two adjacent O or S atoms. "Heterocyclyl" is a monovalent radical formed by the removal of a hydrogen atom from any ring atom of a heterocyclic compound. In some embodiments, the heterocycle is a monocyclic, bicyclic, polycyclic, spirocyclic, or bridged compound. Non-aromatic heterocyclyl groups (also referred to as heterocycloalkyl) include rings having from 3 to 12 atoms in their ring system, and aromatic heterocyclyl groups include rings having from 5 to 12 atoms in their ring system. Heterocyclyl groups include benzo-fused ring systems. Examples of non-aromatic heterocyclyl groups are pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, oxazolidinonyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, aziridinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 1,2,3,6-tetrahydropyridinyl, pyrrolin-2-yl, pyrrolin-3-yl, indolinyl, 2H-furanyl, 4H-pyranyl, dioxanyl, 1,3-dioxolanyl, pyrazolinyl, dithiolanyl, dihydropyranyl, dihydrothienyl, dihydrofuranyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, 3-azabicyclo[3.1.0]hexyl 1,3-azabicyclo[4.1.0]heptyl, 3h-indolyl, dihydroindole-2-onyl, isoindoline-1-onyl, isoindoline-1,3-dionyl, 3,4-dihydroisoquinoline-1(2H)-onyl, 3,4-dihydroquinoline-2(1H)-onyl, isoindoline-1,3-dithionyl, benzo[d]oxazole-2(3H)-onyl, 1H-benzo[d]imidazole-2(3H)-onyl, benzo[d]thiazole-2(3H)-onyl, and quinolizinyl.Examples of aromatic heterocyclic groups are pyridyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furanyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, quinolinyl, isoquinolinyl, indolyl, benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, pyridazinyl, triazinyl, isoindolyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, benzofurazanyl, benzothiophenyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinoxalinyl, naphthyridinyl, and furopyridinyl. Where possible, the foregoing groups are C-attached (or C-linked) or N-attached. For example, groups derived from pyrrole include pyrrol-1-yl (N-attached) or pyrrol-3-yl (C-attached). Also, groups derived from imidazole include imidazol-1-yl or imidazol-3-yl (both N-attached) or imidazol-2-yl, imidazol-4-yl, or imidazol-5-yl (all C-attached). Heterocyclyl groups include benzo-fused ring systems. Non-aromatic heterocycles are optionally substituted with one or two oxo (=0) moieties, such as pyrrolidin-2-one. In some embodiments, at least one of the two rings of a bicyclic heterocycle is aromatic. In some embodiments, both rings of a bicyclic heterocycle are aromatic.
[0454] The term "heterocycloalkyl" refers to a cycloalkyl group comprising at least one heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specifically noted in the specification, a heterocycloalkyl group can be a monocyclic or bicyclic ring system, which can include fused (when fused to an aryl or heteroaryl ring, the heterocycloalkyl is bonded through a non-aromatic ring atom) or bridged ring systems. The nitrogen, carbon, or sulfur atoms in a heterocyclyl group can optionally be oxidized. The nitrogen atoms can optionally be quaternized. Heterocycloalkyl groups are partially or fully saturated. Examples of heterocycloalkyl groups include, but are not limited to, dioxolanyl, thienyl[l,3]dithianyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl, tetrahydropyranyl, thiamorpholinyl, thiamorpholinyl, 1-oxothiamorpholinyl, 1,1-dioxothiamorpholinyl. The term heterocycloalkyl also includes all ring forms of carbohydrates, including but not limited to monosaccharides, disaccharides, and oligosaccharides. Unless otherwise specified, a heterocycloalkyl group has from 2 to 12 carbons located in the ring. In some embodiments, a heterocycloalkyl group has from 2 to 10 carbons located in the ring. In some embodiments, a heterocycloalkyl group has from 2 to 10 carbons located in the ring and has 1 or 2 N atoms. In some embodiments, a heterocycloalkyl group has from 2 to 10 carbons located in the ring and has 3 or 4 N atoms. In some embodiments, a heterocycloalkyl group has from 2 to 12 carbons located in the ring, 0-2 N atoms, 0-2 O atoms, 0-2 P atoms, and 0-1 S atoms. In some embodiments, a heterocycloalkyl group has from 2 to 12 carbons located in the ring, 1-3 N atoms, 0-1 O atoms, and 0-1 S atoms. It should be understood that when referring to the number of carbon atoms in a heterocycloalkyl group, the number of carbon atoms in the heterocycloalkyl group is different from the total number of atoms (including heteroatoms) that make up the heterocycloalkyl group (i.e., the backbone atoms of the heterocycloalkyl ring). Unless otherwise specifically noted in the specification, a heterocycloalkyl group can be optionally substituted. As used herein, the term "tetracycloalkylene" can refer to a divalent heterocycloalkyl group.
[0455] The term "heteroaryl" refers to an aryl group containing one or more ring heteroatoms selected from nitrogen, oxygen, and sulfur. Heteroaryl groups are monocyclic or bicyclic. Illustrative examples of monocyclic heteroaryl groups include pyridyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furanyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, furazanyl, indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. Illustrative examples of monocyclic heteroaryl groups include pyridyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furanyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, and furazanyl. Illustrative examples of bicyclic heteroaryl groups include indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. In some embodiments, the heteroaryl group is pyridyl, pyrazinyl, pyrimidinyl, thiazolyl, thienyl, thiadiazolyl, or furanyl. In some embodiments, the heteroaryl group contains 0-6 N atoms in the ring. In some embodiments, the heteroaryl group contains 1-4 N atoms in the ring. In some embodiments, the heteroaryl group contains 4-6 N atoms in the ring. In some embodiments, the heteroaryl group contains 0-4 N atoms, 0-1 O atom, 0-1 P atom, and 0-1 S atom in the ring. In some embodiments, the heteroaryl group contains 1-4 N atoms, 0-1 O atom, and 0-1 S atom in the ring. In some embodiments, the heteroaryl group is a C1-C9 heteroaryl group. In some embodiments, the monocyclic heteroaryl group is a C1-C5 heteroaryl group. In some embodiments, the monocyclic heteroaryl group is a 5- or 6-membered heteroaryl group. In some embodiments, the bicyclic heteroaryl group is a C6-C9 heteroaryl group. In some embodiments, the heteroaryl group is partially reduced to form a heterocycloalkyl group as defined herein. In some embodiments, the heteroaryl group is fully reduced to form a heterocycloalkyl group as defined herein.
[0456] The term definitions in the following twenty-five paragraphs apply only to the above compounds of Formula A', III-a and III-a-I, 1, VI, and VIA
[0457] As used herein, the term "aliphatic" or "aliphatic group" means a straight chain (i.e., unbranched) or branched substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units, or a monocyclic or bicyclic hydrocarbon (also referred to herein as "carbocycle," "carbocyclyl," "cycloaliphatic," or "cycloalkyl") that is fully saturated or contains one or more unsaturated units but is non-aromatic, having a single point of attachment to the rest of the molecule. Unless otherwise specified, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 carbon atoms. In some embodiments, an aliphatic group contains 1-4 carbon atoms. In some embodiments, an aliphatic group contains 1-3 carbon atoms, and in some embodiments, an aliphatic group contains 1-2 carbon atoms. In some embodiments, "carbocyclyl" (or "cycloaliphatic" or "carbocycle" or "cycloalkyl") refers to an optionally substituted monocyclic C3-C8 hydrocarbon or an optionally substituted C6-C8 hydrocarbon that is fully saturated or contains one or more unsaturated units but is non-aromatic. 12 Bicyclic hydrocarbons having a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and mixtures thereof (such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl).
[0458] As used herein, the term "alkenyl" refers to an alkyl group as defined herein having one or more double bonds. In some embodiments, the term "alkenyl" used alone or as part of a larger moiety refers to an alkyl group having at least one double bond and having (unless otherwise specified) 2-20, 2-18, 2-16, 2-14, 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C 2-20 、C 2-18 、C 2-16 、C 2-14 、C 2-12 、C 2-10 、C 2-8 、C 2-6 、C 2-4 or C 2-3 ) is an optionally substituted straight or branched hydrocarbon chain. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and heptenyl.
[0459] The term "alkenylene" refers to a divalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced by a substituent. Suitable substituents include those described below for substituted aliphatic groups.
[0460] As used herein, the term "alkyl" has the ordinary meaning in the art and can include saturated aliphatic groups, including straight chain alkyls, branched chain alkyls, cycloalkyl (alicyclic) groups, cycloalkyls substituted with alkyls, and alkyls substituted with cycloalkyls. In some embodiments, the alkyl group has 1-100 carbon atoms. In certain embodiments, the straight chain or branched chain alkyl group has about 1-20 carbon atoms in its backbone (e.g., C1-C2 for a straight chain). 20 In some embodiments, the alkyl group may be a lower alkyl group, wherein the lower alkyl group comprises 1 to 4 carbon atoms (e.g., C1-C4 for straight chain lower alkyl groups).
[0461] The term "alkylene" or "alkane" refers to a linear (i.e., unbranched) or branched, substituted or unsubstituted divalent alkyl group (i.e., a divalent saturated hydrocarbon chain). Any of the monovalent alkyl groups mentioned above can be converted to an alkylene group by removing the second hydrogen atom from the alkyl group. In some embodiments, "alkylene" is a polymethylene group, i.e., -(CH2) n -, wherein n is a positive integer, preferably 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 5, or 4 to 8. Substituted alkylene groups are polymethylene groups in which one or more methylene hydrogen atoms are replaced by substituents. Suitable substituents include those described below for substituted aliphatic groups.
[0462] As used herein, the term "alkynyl" refers to an alkyl group as defined herein having one or more triple bonds. In some embodiments, the term "alkynyl" used alone or as part of a larger moiety refers to an alkyl group having at least one triple bond and having (unless otherwise specified) 2-20, 2-18, 2-16, 2-14, 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C 2-20 、C 2-18 、C 2-16 、C 2-14 、C 2-12 、C 2-10 、C 2-8 、C 2-6 、C 2-4 or C 2-3 ) is an optionally substituted straight or branched chain hydrocarbon group. Exemplary alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, and heptynyl.
[0463] The term "aryl" refers to monocyclic and bicyclic ring systems having a total of six to fourteen ring members (e.g., C 6-14 ) of which at least one ring in the system is aromatic, and wherein each ring in the system contains three to seven ring members. The term "aryl" can be used interchangeably with the term "aromatic ring." In some embodiments, "aryl" refers to an aromatic ring system which can bear one or more substituents, including but not limited to phenyl, naphthyl, anthryl, and the like. Unless otherwise indicated, "aryl" refers to hydrocarbons.
[0464] The term "bivalent," as used herein, refers to a chemical moiety having two points of attachment. For example, a "bivalent C 1-8 (or C 1-6 ) saturated or unsaturated straight or branched hydrocarbon chain" refers to a bivalent alkylene, alkenylene, and alkynylene chain that is straight or branched as defined herein.
[0465] The term "bridged bicyclic," as used herein, refers to any bicyclic ring system (i.e., a saturated or partially unsaturated carbocyclic or heterocyclic bicyclic ring system) having at least one bridge. As defined by IUPAC, a "bridge" is a chain of unbranched atoms or atoms or valence bonds connecting two bridgeheads, where a "bridgehead" is any skeletal atom in the ring system that is bonded to three or more skeletal atoms (not including hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Such bridged bicyclic groups are well known in the art and include those listed below, wherein each group is attached to the remainder of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise indicated, a bridged bicyclic group is optionally substituted with one or more substituents listed for aliphatic groups. Additionally or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bridged bicyclic groups include, but are not limited to:
[0466]
[0467] The terms "carbocyclyl," "carbocyclic," and "carbocyclic ring," as used herein, refer to a saturated or partially unsaturated ring-like aliphatic monocyclic, bicyclic, or polycyclic ring system having 3 to 14 members as described herein, wherein the aliphatic ring system is optionally substituted as described herein. Carbocyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, "carbocyclyl" (or "cycloaliphatic") refers to an optionally substituted monocyclic C3-C8 hydrocarbon that is fully saturated or contains one or more unsaturated units but is non-aromatic. In some embodiments, "carbocyclyl" refers to a C3-C8 cycloalkyl group. In some embodiments, "carbocyclyl" refers to a C3-C8 cycloalkenyl group. 12Bicyclic hydrocarbons having a single point of attachment to the rest of the molecule. The term "cycloalkyl" refers to an optionally substituted saturated ring system of about 3 to about 10 ring carbon atoms. In some embodiments, the cycloalkyl has 3-6 carbons. Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. The term "cycloalkenyl" refers to an optionally substituted non-aromatic monocyclic or polycyclic ring system containing at least one carbon-carbon double bond and having about 3 to about 10 carbon atoms. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl, and cycloheptenyl.
[0468] The term "haloaliphatic" refers to an aliphatic group substituted with one or more halogen atoms (e.g., one, two, three, four, five, six, or seven halogens, such as fluorine, iodine, bromine, or chlorine). In some embodiments, the haloaliphatic group contains 1-7 halogen atoms. In some embodiments, the haloaliphatic group contains 1-5 halogen atoms. In some embodiments, the haloaliphatic group contains 1-3 halogen atoms.
[0469] The term "haloalkyl" refers to an alkyl group substituted with one or more halogen atoms (e.g., one, two, three, four, five, six, or seven halogen groups, such as fluorine, iodine, bromine, or chlorine). In some embodiments, the haloalkyl group contains 1 to 7 halogen atoms. In some embodiments, the haloalkyl group contains 1 to 5 halogen atoms. In some embodiments, the haloalkyl group contains 1 to 3 halogen atoms.
[0470] As used herein, the term "heteroalkylene" or "heteroalkane" refers to an optionally substituted straight chain (i.e., unbranched) or branched divalent alkyl group (i.e., a divalent saturated hydrocarbon chain) having one to five heteroatoms in addition to carbon atoms. The term "heteroatom" is described below. In some embodiments, the heteroalkylene group contains 2-10 carbon atoms, wherein 1-3 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, the heteroalkylene group contains 2-8 carbon atoms, wherein 1-3 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, the heteroalkylene group contains 4-8 carbon atoms, wherein 1-3 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, the heteroalkylene group contains 2-5 carbon atoms, wherein 1-2 carbon atoms are optionally and independently replaced by heteroatoms selected from oxygen, nitrogen, and sulfur. In yet other embodiments, the heteroalkylene group contains 1-3 carbon atoms, wherein one carbon atom is optionally and independently replaced by a heteroatom selected from oxygen, nitrogen, and sulfur. Suitable heteroalkylene groups include, but are not limited to, -CH2O-, -(CH2)2O-, -CH2OCH2-, -O(CH2)2-, -(CH2)3O-, -(CH2)2OCH2-, -CH2O(CH2)2-, -O(CH2)3-, -(CH2)4O-, -(CH2)3OCH2-, -CH2O(CH2)3-, -(CH2)2O(CH2)2-, -O(CH2)4-. Unless otherwise indicated, C x Heteroalkylene refers to a heteroalkylene group having x number of carbon atoms before replacement by a heteroatom.
[0471] The terms "heteroaryl" and "heteroar-", used alone or as part of a larger moiety, such as "heteroaralkyl" or "heteroaralkoxy", refer to monocyclic or bicyclic ring radicals having 5 to 10 ring atoms (e.g., a 5- to 6-membered monocyclic heteroaryl or a 9- to 10-membered bicyclic heteroaryl); having 6, 10, or 14 π electrons shared in the cyclic array; and having from one to five heteroatoms in addition to carbon atoms. Exemplary heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridinyl, pyridonyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-a]-pyridinyl, thienopyrimidinyl, triazolopyridinyl, and benzisoxazolyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, wherein the radical or point of attachment is on the heteroaromatic ring (i.e., a bicyclic heteroaryl ring having from 1 to 3 heteroatoms). Non-limiting examples include indolyl, isoindolyl, benzothiophenyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, pyrido[2,3-b]-1,4-oxazin-3(4H)-one, and benzisoxazolyl. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which includes optionally substituted rings.
[0472] The term "heteroatom" means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen; or a substitutable nitrogen of a heterocyclic ring, such as N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (as in N-substituted pyrrolidinyl)).
[0473] The terms "heterocycle", "heterocyclyl", "heterocyclic radical" and "heterocyclic ring" are used interchangeably herein and refer to a stable 3- to 8-membered monocyclic, 7- to 12-membered bicyclic or 10- to 16-membered polycyclic heterocyclic moiety which may be saturated or partially unsaturated and which has, in addition to carbon atoms, one or more, such as one to four, heteroatoms, as defined above. The term "nitrogen" when used to refer to a ring atom of a heterocycle includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR + (as in N-substituted pyrrolidinyl). The heterocyclic ring may be attached to a side group at any heteroatom or carbon atom resulting in a stable structure, and any of the ring atoms may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic groups include, but are not limited to, azetidinyl, oxetanyl, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, tetrahydropyranyl, dioxanyl, dioxolane, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, thiomorpholinyl, and The heterocyclic group can be monocyclic, bicyclic, tricyclic or polycyclic, preferably monocyclic, bicyclic or tricyclic, more preferably monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted with a heterocyclic group, wherein the alkyl portion and the heterocyclyl portion are independently optionally substituted. Bicyclic heterocyclic rings also include groups in which the heterocyclic ring is fused to one or more aryl, heteroaryl or cycloaliphatic rings. Exemplary bicyclic heterocyclic groups include indolinyl, isoindolinyl, benzodioxolyl, 1,3-dihydroisobenzofuranyl, 2,3-dihydrobenzofuranyl and tetrahydroquinolinyl. The bicyclic heterocyclic ring can also be a spirocyclic ring system (e.g., a 7- to 11-membered spirocyclic fused heterocyclic ring having, in addition to carbon atoms, one or more heteroatoms as defined above (e.g., one, two, three or four heteroatoms)). The bicyclic heterocyclic ring can also be a bridged ring system (eg, a 7- to 11-membered bridged heterocyclic ring having one, two, or three bridging atoms).
[0474] As used herein, the term "joint" is used to refer to the part in a multi-element agent by which different elements are interconnected. For example, it will be appreciated by those of ordinary skill in the art that a structure comprising a polypeptide having two or more functional or organizational domains is often included in a section of amino acids that connect these domains to each other between such domains. In some embodiments, the polypeptide comprising a joint element "L" has the overall structure of the general formula S1-L'-S2, wherein S1 and S2 can be identical or different, and represent two domains that are mutually associated by a joint. In some embodiments, the length of a polypeptide joint is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acids. In some embodiments, the linker is characterized in that it tends not to adopt a rigid three-dimensional structure, but rather provides flexibility to the polypeptide. When engineering polypeptides known in the art (e.g., fusion polypeptides), a variety of linker elements can be appropriately used (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak, RJ, et al. (1994) Structure 2: 1 121-1123).
[0475] As used herein, the term "sterol group" refers to a 17-membered fused polycyclic ring portion that is saturated or partially unsaturated and substituted with at least one hydroxyl group and has a single point of attachment to the rest of the molecule at any substitutable carbon or oxygen atom. In some embodiments, the sterol group is a cholesterol group, or a variant or derivative thereof. In some embodiments, the cholesterol group is modified. In some embodiments, the cholesterol group is an oxidized cholesterol group (e.g., oxidized on the β-ring structure or on the hydrocarbon tail structure). In some embodiments, the cholesterol group is an esterified cholesterol group. In some embodiments, the sterol group is a plant sterol group. Exemplary sterol groups include, but are not limited to, 25-hydroxycholesterol group (25-OH), 20α-hydroxycholesterol group (20α-OH), 27-hydroxycholesterol group, 6-keto-5α-hydroxycholesterol group, 7-ketocholesterol group, 7β-hydroxycholesterol group, 7α-hydroxycholesterol group, 7β-25-dihydroxycholesterol group, β-sitosterol group, stigmasterol group, brassicasterol group, and campesterol group.
[0476] As described herein, compounds of the present disclosure may be described as "substituted" or "optionally substituted." That is, the compounds may contain optionally substituted and / or substituted moieties. In general, the term "substituted," whether preceded by the term "optionally" or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. "Substituted" applies to one or more hydrogens, whether expressly or implicitly in a structure (e.g., At least and At least ). Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted by more than one substituent selected from a specified group, the substituents at each position may be the same or different. The substituent combinations contemplated by the present disclosure are preferably those that result in the formation of stable or chemically feasible compounds. As used herein, the term "stable" refers to a compound that does not substantially change when subjected to the following conditions: when subjected to its production, detection, and (in certain embodiments) its recovery, purification, and use for one or more purposes disclosed herein. A group described as "substituted" preferably has 1 to 4 substituents, more preferably 1 or 2 substituents. A group described as "optionally substituted" may be unsubstituted or "substituted" as described above.
[0477] Suitable monovalent substituents include halogen; -(CH2) 0-4 R ○ ; -(CH2) 0-4 OR ○ ;-O(CH2) 0-4 R ○ 、-O-(CH2) 0- 4C(O)OR ○ ; -(CH2) 0-4 CH(OR ○ )2;-(CH2) 0-4 Ph, which can be R ○ Substitution; -(CH2) 0-4 O(CH2) 0-1 Ph, which can be R ○ Substitution; -CH=CHPh, which can be R ○ Substitution; -(CH2) 0-4 O(CH2) 0-1 -pyridyl, which may be replaced by R ○ Substitution; -NO2; -CN; -N3; -(CH2) 0-4 N(R ○ )2;-(CH2) 0-4 N(R ○)C(O)R ○ ;-N(R ○ )C(S)R ○ ;-(CH2) 0-4 N(R ○ )C(O)NR ○ 2;-N(R ○ )C(S)NR ○ 2;-(CH2) 0-4 N(R ○ )C(O)OR ○ ;-N(R ○ )N(R ○ )C(O)R ○ ;-N(R ○ )N(R ○ )C(O)NR ○ 2;-N(R ○ )N(R ○ )C(O)OR ○ ;-(CH2) 0-4 C(O)R ○ ;-C(S)R ○ ;-(CH2) 0-4 C(O)OR ○ ;-(CH2) 0-4 C(O)SR ○ ;-(CH2) 0-4 C(O)OSiR ○ 3;-(CH2) 0-4 OC(O)R ○ ;-OC(O)(CH2) 0-4 SR ○ 、一SC(S)SR ○ ;-(CH2) 0-4 SC(O)R ○ ;-(CH2) 0-4 C(O)NR ○ 2;-C(S)NR ○ 2;-C(S)SR ○ ;-SC(S)SR ○ 、-(CH2) 0-4 OC(O)NR ○ 2;-C(O)N(OR ○ )R ○ ;-C(O)C(O)R ○ ;-C(O)CH2C(O)R ○ ;-CC(NOR ○ )R ○ ;-(CH2) 0-4 SSR ○; -(CH2) 0-4 S(O)2R ○ ; -(CH2) 0-4 S(O)2OR ○ ; -(CH2) 0-4 OS(O)2R ○ ;-S(O)2NR ○ 2; -(CH2) 0-4 S(O)R ○ ;-N(R ○ )S(O)2NR ○ 2;-N(R ○ )S(O)2R ○ ;-N(OR ○ )R ○ ;-C(NH)NR ○ 2;-P(O)2R ○ ;-P(O)R ○ 2; =OP(O)R ○ 2;-OP(O)(OR ○ )2;-SiR ○ 3;-OSiR ○ 3;-(C 1-4 Straight chain or branched alkylene)ON(R ○ )2; or -(C 1-4 Straight chain or branched alkylene) C(O)ON(R ○ )2, where each R ○ may be substituted as defined below and are independently hydrogen, C 1-6 Aliphatic group, -CH2Ph, -O(CH2) 0-1 Ph, -CH2-(5-6 membered heteroaryl ring), or a 5-6 membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, or, notwithstanding the definitions given above, two independent occurrences of R ○ Together with their intervening atom(s), they form a 3-12 membered saturated, partially unsaturated or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur, which may be substituted as defined below.
[0478] In R ○ A suitable monovalent substituent (or two independent occurrences of R ○ together with its intervening atoms to form a ring) are independently halogen, -(CH2) 0-2 R ● 、-(halogenated R ● ), -(CH2) 0-2 OH, -(CH2) 0-2 OR ●, -(CH2) 0-2 CH(OR ● )2; -O(haloR ● ), -CN, -N3, -(CH2) 0-2 C(O)R ● , -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR ● , -(CH2) 0-2 C(O)NH2, -(CH2) 0-2 C(O)NHR ● , -(CH2) 0-2 C(O)NR ● 2, -(CH2) 0-2 SR ● , -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR ● , -(CH2) 0-2 NR ● 2, -NO2, -SiR ● 3, -OSiR ● 3, -C(O)SR ● , -(C 1-4 straight or branched chain alkylene)C(O)OR ● , or -SSR ● , where each R ● is unsubstituted or, when preceded by "halo," substituted only with one or more halogens, and is independently selected from C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or 5-6-membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R ○ include =O and =S.
[0479] Suitable divalent substituents include the following: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O-, or -S(C(R * 2)) 2-3 S-, where each independent occurrence of R* hydrogen, C 1-6 aliphatic, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents for a carbon optionally substituted aliphatic group bound to an ortho position of a carbon include: -O(CR * 2)2-3O- where each independent occurrence of R * hydrogen, C 1-6 aliphatic, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0480] R * Suitable substituents on the aliphatic groups of R ● include halogen, -R ● , -(haloR ● ), -OH ● , -OR, -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, where each R 1-4 is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and is independently C 0-1 aliphatic, -CH2Ph, -O(CH2) 1-6 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0481] In some embodiments, suitable substituents on the substitutable nitrogen include where each is independently hydrogen, C ● aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R , together with their intervening atoms, form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0482] Suitable substituents on the aliphatic groups of R ●), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, wherein each R ● is unsubstituted or, in the case of being preceded by“halo,” substituted with only one or more halogens, and is independently C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0483] As used herein, an aminolipid can contain at least one primary, secondary, or tertiary amine moiety that is protonatable (or ionizable) between a pH range of 4 to 14. In some embodiments, one or more amine moieties function as the hydrophilic headgroup of the aminolipid. When a majority of one or more amine moieties of an aminolipid (or aminolipids) in a nucleic acid-lipid nanoparticle formulation are protonated at physiological pH, then the nanoparticle can be referred to as a cationic lipid nanoparticle (cLNP). When a majority of one or more amine moieties of an aminolipid (or aminolipids) in a nucleic acid-lipid nanoparticle formulation are not protonated at physiological pH but can be protonated at acidic pH (e.g., endosomal pH), it can be referred to as an ionizable lipid nanoparticle (iLNP). An aminolipid that constitutes a cLNP can be generally referred to as a cationic aminolipid (cLipid). An aminolipid that constitutes an iLNP can be referred to as an ionizable aminolipid (iLipid). At physiological pH, an aminolipid can be an iLipid or a cLipid.
[0484] As used herein, the size of an LNP composition or formulation is typically on the order of microns or less and can comprise a lipid bilayer. Nanoparticle compositions encompass liposomes, lipid nanocarriers (LNPs), and lipid complexes, which are liposomes having a lipid bilayer with a diameter of 500 nm or less. The average diameter of an LNP described herein can be about 1 nm to about 2500 nm, about 10 nm to about 1500 nm, about 20 nm to about 1000 nm, about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, or about 70 nm to about 80 nm. The average diameter of an LNP described herein can be about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, or greater. An LNP described herein can be substantially non-toxic.
[0485] As used herein, a “phospholipid” can refer to a lipid comprising a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains. A phospholipid can comprise one or more multiple bonds (e.g., double or triple bonds). In some embodiments, a phospholipid can facilitate fusion with a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cell membrane or an intracellular membrane). Fusion of a phospholipid with a membrane can allow one or more components of an LNP to cross the membrane, i.e., to deliver the one or more components to a cell.
[0486] Payload
[0487] The LNPs described herein can be designed to deliver a payload, such as one or more therapeutic agents or one or more drug substances, to a target cell or to a target organ. In some embodiments, the LNPs described herein encapsulate one or more components of a base editor system as described herein. For example, the LNP can encapsulate one or more of a guide RNA, a nucleic acid encoding a guide RNA, a vector encoding a guide RNA, a base editor fusion protein, a nucleic acid encoding a base editor fusion protein, a programmable DNA binding domain, a nucleic acid encoding a programmable DNA binding domain, a deaminase, a nucleic acid encoding a deaminase, or all of them or any combination thereof. In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is RNA, e.g., mRNA and / or a guide RNA. In some embodiments, the one or more nucleic acids are chemically modified.
[0488] In some embodiments, the payload comprises one or more nucleic acids (i.e., one or more nucleic acid molecular entities). In some embodiments, the nucleic acid is a single-stranded nucleic acid. In some embodiments, the single-stranded nucleic acid is DNA. In some embodiments, the single-stranded nucleic acid is RNA. In some embodiments, the nucleic acid is a double-stranded nucleic acid. In some embodiments, the double-stranded nucleic acid is DNA. In some embodiments, the double-stranded nucleic acid is RNA. In some embodiments, the double-stranded nucleic acid is a DNA-RNA hybrid. In some embodiments, the nucleic acid is messenger RNA (mRNA), microRNA, antisense interfering RNA (aiRNA), small hairpin RNA (shRNA), antisense oligonucleotide, or Dicer substrate dsRNA. In some embodiments, the single-stranded nucleic acid forms a secondary structure, e.g., one or more stem loops. In some other embodiments, the single-stranded nucleic acid contains one or more stem loops and single-stranded regions within the molecule.
[0489] Reagent test kit
[0490] It is contemplated herein that the therapeutic agents or drug substances disclosed herein are part of the kits described herein. Accordingly, an aspect of the disclosure relates to a kit comprising a composition comprising a single guide RNA as provided herein, a base editor system and complex as provided herein, a composition as provided herein, and / or a lipid nanoparticle formulation as provided herein for use in the treatment or prevention of a disorder. The kit can further comprise one or more additional therapeutic regimens or agents for use in the treatment or prevention of a disorder.
[0491] In certain embodiments, kits and articles for use with one or more methods described herein are also disclosed herein. Such kits include carriers, packaging or containers that are compartmentalized to accommodate one or more containers (such as vials, tubes, etc.), each of which contains a component to be separated from the components used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the container is formed from a variety of materials (such as glass or plastic).
[0492] The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
[0493] For example, the one or more containers include a composition as described herein, and optionally further have a therapeutic regimen or agent disclosed herein.Such kits optionally include an identifying description or label or instructions related to their use in the methods described herein.
[0494] Kits typically include a label listing the contents and / or instructions for use, and a package insert with instructions for use. A set of instructions is also typically included.
[0495] In an embodiment, the label is located on or associated with the container. In one embodiment, the label is located on the container when the letters, numbers, or other characters forming the label are attached, molded, or etched into the container itself; when the label is present in a receptacle or carrier that also houses the container, the label is associated with the container, for example as a package insert. In one embodiment, the label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates the contents, such as instructions for use in the methods described herein.
[0496] Drug administration
[0497] The skilled artisan will appreciate that certain factors can influence the dosage and frequency of administration of an effective treatment of a subject including but not limited to the severity of the disease or condition, prior treatments, the general state of the subject's health, including the subject's health status, gender, body weight, and / or age, and the presence of other disease. Furthermore, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or can include a series of treatments. It will also be appreciated that the effective dosage of a composition of the disclosure for treatment can be increased or decreased over the course of a particular treatment. Changes in dosage can result and become apparent from diagnosis using diagnostic assays as described herein, and are within the scope of the disclosure. The treatment effective dose will generally depend on the state of the patient at the time of administration. The precise amount can be determined by routine experimentation, but can ultimately depend on the judgment of the clinician, for example by monitoring the patient's disease signs and adjusting the treatment accordingly.
[0498] The frequency of administration can be determined and adjusted over the course of therapy, and is typically, but not necessarily, based on the treatment and / or suppression and / or amelioration and / or delay of the disease. Alternatively, a sustained continuous release formulation of the polypeptide or polynucleotide can be appropriate.
[0499] The dosing regimen (including the compositions disclosed herein) can vary with time. The particular dosing regimen (i.e., dosage, scheduling, and repetition) will depend on the particular subject and the subject's medical history, as well as the properties of the polypeptide or polynucleotide (such as the half-life of the polypeptide or polynucleotide and other considerations well known in the art).
[0500] An appropriate therapeutic dosage of a composition as described herein will depend on the particular agent (or composition thereof) used, the formulation and route of administration, the type and severity of the disease, whether the polypeptide or polynucleotide is administered for prophylactic or therapeutic purposes, prior therapy, the clinical history and response to antagonists of the subject, and the discretion of the attending physician. Typically, the clinician will administer the polypeptide until a dosage is reached that achieves the desired result.
[0501] The administration of one or more compositions can be continuous or intermittent, depending on, for example, the physiological condition of the recipient, the treatment goals, whether the administration is therapeutic or prophylactic, and other factors known to the skilled artisan. The administration of the composition can be essentially continuous over a preselected period of time, or can occur as a series of spaced- apart dosages (e.g., before, during, or after the occurrence of a disease).
[0502] The methods and compositions of the disclosure described herein, including embodiments thereof, can be administered with one or more additional therapeutic regimens or agents or treatments that can be co-administered to the mammal. By "co-administered" is meant that the one or more additional therapeutic regimens or agents or treatments and the compositions of the disclosure are administered sufficiently close in time to enhance the effect of the one or more additional therapeutic agents, or vice versa. In this regard, the compositions of the disclosure described herein can be administered simultaneously with, at different times from, or according to a completely different treatment regimen from, the one or more additional therapeutic regimens or agents or treatments (e.g., the first treatment can be daily, while the additional treatment is weekly). For example, in embodiments, a second therapeutic regimen or agent or treatment is administered simultaneously with, prior to, or subsequent to the compositions of the disclosure.
[0503] In embodiments, a polynucleotide encoding a base editor fusion protein and a guide RNA are administered to a subject. In embodiments, the polynucleotide encoding a base editor fusion protein is an mRNA. In embodiments, an LNP comprising such an amount of a polynucleotide encoding a base editor fusion protein and a guide RNA is administered to a subject. In embodiments, the subject is a primate. In embodiments, the subject is a non-human primate. In embodiments, the non-human primate is a cynomolgus monkey.
[0504] In embodiments, administration of a guide RNA and a polynucleotide encoding a base editor fusion protein to a non-human primate, such as a cynomolgus monkey, results in a base alteration in 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, or 60% or more of the hepatocytes as measured by next generation sequencing. In embodiments, such a percentage of base alterations is achieved when a combined dose of a guide RNA and a polynucleotide encoding a base editor fusion protein is administered to a subject. In embodiments, such a dose is administered in an LNP. In embodiments, such administration results in a reduction in serum TTR levels.
[0505] The present application is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly and are only for purposes of illustration.
[0506] Example
[0507] Example 1
[0508] Guide for adenine base editing of the TTR gene
[0509] Through this example, gRNA sequences were identified that allow ABE8.8 (and other ABE variants containing S. pyogenes Cas9, such as ABE7.10, or other ABE variants containing another Cas protein that can use an NGG PAM) to: 1) destroy the start codon, or 2) destroy the splice site (either donor or acceptor) via A→G editing within its editing window (approximately positions 4 to 7 in the 20-nt protospacer region of DNA). Five sequences were identified throughout the human TTR gene (Table 1). gRNAs matching each of the protospacer sequences and otherwise conforming to the standard 100-nt S. pyogenes CRISPR gRNA sequence were synthesized, with each gRNA molecule having minimal chemical modifications (indicated in Table 1). Each of these gRNAs was co-transfected with an equal amount of in vitro transcribed ABE8.8 mRNA (1:1 ratio based on molecular weight) into primary human hepatocytes using MessengerMax reagent (Lipofectamine) using various dilutions (2500, 1250, 625 ng / RNA / mL) to evaluate the editing activity of different concentrations of the test article.
[0510] Table 1. TTR guides
[0511]
[0512]
[0513] For orthogonal protospacer sequences corresponding to the cynomolgus monkey TTR gene sequence, each gRNA was also transfected into primary cynomolgus monkey hepatocytes with an equal amount of ABE8.8 mRNA (1:1 ratio by molecular weight) at 5000, 2500, 1250, 625, 312.5 and 156.25 ng / RNA / mL. The mRNA sequence and corresponding amino acid sequence of ABE8.8 (MA004) used are shown in Table 11 below. Three days after transfection, genomic DNA was harvested from the hepatocytes and base editing of the genomic DNA was assessed by next generation sequencing of PCR amplicons generated around the target splice sites. Several sites showed high editing efficiency. In particular, GA457 (GA458 is the cynomolgus monkey equivalent), GA460 and GA461 showed high editing activity in both human and cynomolgus monkey primary hepatocytes. See Figures 5A-5C 、 Figure 6 and Tables 2-3.
[0514] Table 2. Editing activity in primary human hepatocytes
[0515]
[0516] Table 3. Editing activity in primary cynomolgus monkey hepatocytes
[0517]
[0518] The results presented in Tables 2 and 3 should be understood as representative of the results that can be achieved according to the teachings provided herein. The compositions for editing the TTR gene according to the present invention can produce editing activities that are 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% or more different from the activities listed in Tables 2 or 3. In some embodiments, the composition provides editing activities that are within 100%, within 90%, within 80%, within 70%, within 60%, within 50%, within 40%, within 30% or more, within 20% or more, or within 10% or more of the activities listed in Tables 2 or 3.
[0519] Example 2
[0520] Off-target analysis
[0521] To determine the safety of base editing therapy for knocking down TTR in human liver in vivo, off-target mutagenesis analysis was evaluated in primary human hepatocytes. Off-target editing was evaluated in human hepatocytes following the ONE-seq procedure detailed in PCT / US19 / 27788 (“Highly Sensitive in vitro Assays to Define Substrate Preferences and Sites of Nucleic-Acid Binding, Modifying, and Cleaving Agents”). A simplified flowchart of off-target analysis using the ONE-seq procedure is available in Figure 7 The in vitro biochemical assay ONE-seq was used to generate a list of candidate off-target sites and determine the propensity of ribonucleoproteins containing the ABE8.8 base editor protein and each of the three protospacer guide sequences (GA457, GA460, and GA461) to cleave oligonucleotides in the library. The results of the ONE-seq analysis of the libraries generated for GA457, GA460, and GA461 are shown in Tables 8 to 10, which list the candidate off-target sites.
[0522] The ONE-seq method is as follows: ONE-seq library design begins with in silico identification of sites in the reference genome that share sequence homology with the target site. For the human ONE-seq library, the reference human genome (GRCh38, Ensembl v98, chromosomes ftp: / / ftp.ensembl.org / pub / release-98 / fasta / homo_sapiens / dna / Homo_sapiens.GRCh38.dna.chromosome.{1-22,X,Y,MT}.fa and ftp: / / ftp.ensembl.org / pub / release-98 / fasta / homo_sapiens / dna / Homo_sapiens.GRCh38.dna.nonchromosomal.fa) was searched for potential off-target sites with up to six mismatches to the above protospacer sequences, as well as sites with up to four mismatches and up to two DNA or RNA bulges, using Cas-Designer v1.2 (http: / / www.rgenome.net / cas-designer / ).
[0523] Sites with up to six mismatches and no bulges are referred to using the code X<number of mismatches><number of bulges>. Thus, an on-target site is labeled X00; a site with one mismatch and no bulge is labeled X10, and so on. Sites with DNA bulges are referred to using a similar nomenclature: DNA<number of mismatches><number of bulges>. Thus, a site with four mismatches and two DNA bulges is labeled DNA42. RNA bulges use the same nomenclature, but are coded as RNA<number of mismatches><number of bulges>.
[0524] The identified protospacer sequences were extended 10 nucleotides (nt) on both sides with adjacent sequences from the respective reference genome (these regions are referred to herein as genomic context). These extended sequences were then padded with additional sequence until a final length of about 200 nt, including a predefined constant region of 6 different nucleotide compositions and sequence lengths; 2 copies of a 14-nt site-specific barcode, one on each side of the central protospacer sequence; and 2 different 11-nt unique molecular identifiers (UMIs), one on each side of the central protospacer sequence. The UMIs were used to correct for bias from PCR amplification, and the barcode allowed unambiguous identification of each site during analysis. These barcodes were selected from an initial list of 668,420 barcodes that contained neither CC nor GG in their sequence, and each barcode had a Hamming distance of 2 from any other barcode. A custom Python script was used to design the final library.
[0525] The final oligonucleotide library was synthesized by a commercial vendor (Agilent Technologies). Each library was subjected to PCR amplification and to 1.25x AMPure XP bead purification (Beckman Coulter). After incubation in CutSmart buffer (New England Biolabs) for 10 min at 25 °C, RNP containing 769 nM of recombinant ABE8.8-m protein and 1.54 mM of gRNA was mixed with 100 ng of purified library and incubated for 8 h at 37 °C. The RNP dose was derived from an analysis demonstrating that this RNP dose was a supersaturating dose, i.e., a dose higher than the one that achieves the maximum amount of on-target editing in a biochemical assay.
[0526] Proteinase K (New England Biolabs) was added to quench the reaction at 37°C for 45 minutes, followed by 2x AMPure XP bead purification. The reaction was then sequentially incubated with endonuclease V (New England Biolabs) at 37°C for 30 minutes, Klenow fragment (New England Biolabs) at 37°C for 30 minutes, and NEBNext Ultra II End Prep Enzyme Mix (New England Biolabs) at 20°C for 30 minutes followed by 65°C for 30 minutes, with 2x AMPure XP bead purification after each incubation. The reaction was ligated with annealed adaptor oligo duplex at 20°C for 1 hour to facilitate PCR amplification of the cleaved library products, followed by 2x AMPure XP bead purification. Size selection of the ligated reaction was performed on a PippinHT system (Sage Sciences) to isolate DNA between 150 and 200 bp on a 3% agarose cassette, followed by 2 rounds of PCR amplification to generate a barcoded library that underwent paired-end sequencing on an Illumina MiSeq system as described above.
[0527] Two cleavage products were obtained in the ONE-seq experiment. The PROTO side contains the oligonucleotide portion upstream of the cleavage position, while the PAM side contains the oligonucleotide portion downstream of the cleavage position. In the ABE experiment, only the PROTO side provides information on editing activity (A→G substitution); therefore, only this side was sequenced.
[0528] Paired-end reads were trimmed for sequencing adapters using trimmomatic v0.39 (Bolger et al., 2014) with a custom Nextera adapter (PrefixPE / 1: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 30); PrefixPE / 2: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3' (SEQ ID NO: 31); as specified in the file) and parameters "ILLUMINACLIP:NEB_custom.fa:2:30:10:1:true LEADING:0 TRAILING:0 SLIDINGWINDOW:4:30 MINLEN:36". For experiments with lower sequencing quality (VOL014), these parameters were set to "ILLUMINACLIP NEB_custom.fa:2:30:10:1:true LEADING:2 TRAILING:0 SLIDINGWINDOW:30:30 MINLEN:36". Reads were then merged using FLASH v1.2.11 (Magoc and Salzberg, 2011) with the parameters "--max-mismatch-density=0.25 --max-overlap=160". The merged reads were scanned for constant sequence, barcode, and protospacer sequence unique to each site and filtered to those with evidence of A→G substitutions in the editing window (defined as 1-10 PAM-distal positions of the protospacer). Duplicate reads were discarded.
[0529] For each site, the total number of edited reads was normalized to the total number of edited reads assigned to the on-target site, and this ratio defined the ONE-seq score for that site. Sites were ranked according to the ONE-seq score, and those with a score equal to or greater than 0.001 were selected for validation. A score equal to or greater than 0.001 covers sites where the editing activity in the biochemical assay was reduced by 1000-fold compared to editing at the target site. This threshold is based on the premise that in cells, if there is 100% on-target editing, 1 / 1000-fold less editing activity will translate into <0.1% off-target editing, which is below the lower limit of NGS detection of editing. Oligonucleotides with higher sequence counts reflect a higher propensity for Cas9 / gRNA cutting in vitro and, therefore, a greater potential for off-target mutagenesis in cells.
[0530] Off-target editing of several candidate off-target sites was analyzed in human primary hepatocytes. Table 4 shows results from validation of 47 candidate off-target sites for guide RNA GA457 from cells co-transfected with gRNA and equal amounts of in vitro transcribed ABE8.8 mRNA (1 : 1 ratio by molecular weight) via MessengerMax reagent (Lipofectamine) into primary human hepatocytes. The on-target site had high editing efficiency, while all off-target sites had little editing (net editing less than 0.4%).
[0531] Table 4. Validation of GA457 against 47 potential off-target candidate sites in primary human hepatocytes
[0532]
[0533]
[0534] Off-target editing of GA459, GA460, and GA461 was also similarly assessed, as shown in Tables 5, 6, and 7, respectively. While the on-target site for each guide showed high editing efficiency in the treatment group compared to the control group, little off-target editing was observed at the candidate off-target sites.
[0535] Table 5. Validation of GA459 against six potential off-target candidate sites in primary human hepatocytes
[0536]
[0537] Table 6. Validation of GA460 against three potential off-target candidate sites in primary human hepatocytes
[0538]
[0539]
[0540] Table 7. Validation of GA461 against four potential off-target candidate sites in primary human hepatocytes
[0541]
[0542] Table 8 provides some results of off-target editing using the GA457 guide.
[0543] Table 9 provides some results of off-target editing using the GA460 guide.
[0544] Table 10 provides some results of off-target editing using the GA461 guide.
[0545] The results presented in Tables 4, 6, 7, 8, 9, and 10 should be understood to be representative of the results that can be achieved according to the teachings provided herein. The compositions for editing the TTR gene according to the present invention can produce a total off-target editing activity that differs from the activity listed in Table 4, 6, 7, 8, 9, or 10, or discussed with respect to GA457, 460, or 461. For example, for one or more off-target sites listed in Table 4, 6, 7, 8, 9, or 10, or discussed with respect to GA457, 460, or 461, the composition can produce a total off-target editing activity that differs from the activity listed in Table 4, 6, 7, 8, 9, or 10, or discussed with respect to GA457, 460, or 461 by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% or more. In some embodiments, the composition provides a total off-target editing activity within 100%, within 90%, within 80%, within 70%, within 60%, within 50%, within 40%, within 30% or more, within 20% or more, or within 10% of the activity listed in Table 4, Table 6, Table 7, Table 8, Table 9 or Table 10 or discussed for GA457, 460 or 461, for one or more sites listed in Table 4, Table 6, Table 7, Table 8, Table 9 or Table 10, or discussed for GA457, 460 or 461. In some embodiments, the composition produces off-target editing activity that is less than or equal to the activity listed in Table 4, Table 6, Table 7, Table 8, Table 9, or Table 10, or discussed for GA457, 460, or 461, for one or more sites listed in Table 4, Table 6, Table 7, Table 8, Table 9, or Table 10, or discussed for GA457, 460, or 461. In some embodiments, the composition does not produce off-target editing activity for one or more sites listed in Table 4, Table 6, Table 7, Table 8, Table 9, or Table 10, or discussed for GA457, 460, or 461.
[0546] Table 8. Some candidate off-target sites of GA457
[0547]
[0548]
[0549] Additional examples of GA457 off-target sites are presented in U.S. Provisional Patent Application No. 63 / 322,182, filed on March 21, 2022. GA457 off-target sites can include any one of SEQ ID NOs: 92-1073.
[0550] Table 9. Some candidate off-target sites of GA460
[0551]
[0552]
[0553] Additional examples of GA460 off-target sites are presented in U.S. Provisional Patent Application No. 63 / 322,182, filed March 21, 2022. GA460 off-target sites can include any one of SEQ ID NOs: 1074-3725.
[0554] Table 10. Some candidate off-target sites of GA461
[0555]
[0556]
[0557] Additional examples of GA461 off-target sites are presented in U.S. Provisional Patent Application No. 63 / 322,182, filed March 21, 2022. GA461 off-target sites can include any one of SEQ ID NOs: 3726-5745.
[0558] Table 11. ABE variant sequences
[0559]
[0560]
[0561]
[0562]
[0563]
[0564]
[0565]
[0566]
[0567]
[0568] Other ABE variants can be used to effect editing of the human TTR gene. Examples of such ABE variants are described in International Patent Application PCT / US21 / 26729, filed April 9, 2021, entitled BASE EDITING OF PCSK9 AND METHODS OF USING SAME FOR TREATMENT OF DISEASE, and naming Verve Therapeutics, Inc. as applicant.
[0569] Example 3
[0570] In vivo non-human primate (NHP) base editing of the TTR gene
[0571] In this example, NHP surrogate sgRNAs (GA519 and GA520) corresponding to the human GA457 and GA460 sgRNAs described above were prepared and formulated with the previously described ABE8.8 mRNA, encapsulated in lipid nanoparticles (LNPs), and administered intravenously to NHPs. The study involved two different aspects.
[0572] The first aspect of the NHP in vivo study involved the evaluation of LNP1 and LNP2, which differed only in that LNP1 was formulated to encapsulate GA519 and ABE8.8 mRNA, while LNP2 was formulated to encapsulate GA520 and ABE8.8 mRNA. The second aspect of the study involved the formulation and evaluation of a third LNP (LNP3). LNP3 was formulated to encapsulate GA519 and ABE8.8 mRNA, like LNP1. However, LNP3 differed from LNP1 in that LNP3 contained a GalNAc moiety component. In each aspect of the study, base editing efficiency, TTR protein expression, safety profile, and pharmacokinetics were evaluated at multiple times after infusion of the NHPs, as further detailed below and illustrated in the figures.
[0573] Part A: In vivo NHP evaluation of GA519 and GA520 using non-GalNAc LNPs
[0574] LNP preparation
[0575] In this first aspect of the NHP study, two LNPs (LNP1 and LNP2) were formulated, with LNP1 encapsulating GA519 and ABE8.8 mRNA, and LNP2 encapsulating GA520 and ABE8.8 mRNA. The components of each of these LNPs consisted of the ionizable amino lipid (iLipid), neutral helper lipid, PEG-lipid, and sterol lipid described in Table 12 below, and in the ratios indicated in Table 12 below.
[0576] Table 12. LNP1 / LNP2 components
[0577]
[0578] *described in International Published Patent Application WO 2015 / 095340 Al
[0579] It is understood that the lipids in Table 12 can be substituted with other suitable lipids in the listed class. In some embodiments, for example, the LNP comprises the aminolipid VL422 described in International Publication Patent Application WO 2022 / 060871 Al. For example, the aminolipid can be VL422 or a pharmaceutically acceptable salt or solvate thereof:
[0580]
[0581] It is further understood that the mol% of the lipids in Table 12 can be adjusted, and the mol% included in Table 12 is the target excipient percentage of the LNP (which is intended to represent the aggregate mol% of all LNP formulated in a given batch), and a particular LNP within a batch can have a different mol%. Thus, it is contemplated herein that the mol% of one or more or all of the LNP components listed in Table 12 can be adjusted, for example, + / - 1-5%, + / - 5-10%, or + / - 10-20%. It is further contemplated herein that the mol% of one or more or all of the LNP components listed in Table 12 can differ from the target mol% by, for example, + / - 1-5%, + / - 5-10%, or + / - 10-20%, or even greater than + / - 20% relative to the particular LNP formulated in a given batch of LNP formulated according to the desired target excipient percentage. Further, it is understood that additional LNP components (including non-lipid components) can be added to the LNP components listed in Table 12. As listed in Table 13, LNP1 is formulated with sgRNA GA519 and LNP2 is formulated with GA520, which correspond to sgRNAs GA457 and GA460, respectively, described previously. GA519 and GA520 are chemically synthesized, and the sequences and chemical modifications of GA519 and GA520 are indicated in Table 13.
[0582] Table 13. Guides for GA519 and GA520 TTR gene targeting
[0583]
[0584]
[0585] Letters in sequence: A = adenosine; C = cytidine; G = guanosine; U = uridine; a = 2’-O-methyl adenosine; c = 2’-O-methyl cytidine; g = 2'-O-methyl guanosine; u = 2'-O-methyl uridine; s = phosphorothioate (PS) backbone linkage. C = Nucleotides that differ from the human TTR sequence in NHP. Bold in gRNA sequence indicates spacer sequence corresponding to protospacer.
[0586] Notably, in comparison to GA457, GA519 hybridizes between positions 50,681,581 and 50,681,603 of exon 1 of the reference cynomolgus monkey genome (macFas5) and edits the adenosine at position 50,681,584, resulting in a disruption of the full-length TTR protein sequence by converting the methionine to a threonine amino acid and inhibiting protein translation Figure 8 ). GA519 is a cynomolgus monkey substitute for the human GA457 gRNA and maps to a similar region of the human TTR locus as in Figure 4 , as previously described. The cynomolgus monkey GA519 gRNA differs from GA457 by a single nucleotide at position 17 of the protospacer and is highlighted with an underline in the protospacer column of Table 13. In addition, GA519 and GA457 differ from each other in that the tracr region of GA519 incorporates a chemical modification (detailed in Table 13). This chemical modification was designed to improve in vivo stability or was designed to be able to improve in vivo stability.
[0587] Similarly, in comparison to GA460, GA520 hybridizes between positions 50,678,305 and 50,678,327 of exon 3 of the reference cynomolgus monkey genome (macFas5) and edits the adenosine at position 50,678,324, resulting in a splice acceptor disruption that produces a truncated nonfunctional TTR protein Figure 9 ). The protospacer region of GA520 is identical to human GA460 and maps to a similar region of the human TTR locus as in Figure 4 , as previously described. GA520 and GA460 differ in the tracr region and incorporate a chemical modification (detailed in the table above), which was designed to improve in vivo stability or was designed to be able to improve in vivo stability.
[0588] For reference, the targeted nucleotides for base editing are highlighted in bold in Figure 8 and Figure 9 . Figure 8 and Figure 9 The positions of the spacer regions of GA519 and GA520 relative to the TTR gene as previously described are also identified.
[0589] LNP1 and LNP2 were formulated using ABE 8.8 mRNA and GA519 and GA520, respectively, with a sgRNA:mRNA weight ratio of 1:1. In other words, the LNP was formulated with an equal amount (by weight) of guide RNA as mRNA. The resulting LNP encapsulating sgRNA and ABE 8.8 mRNA was filtered using a 0.2 micron filter and frozen at -80 °C. The physical properties of the formulated LNP are summarized in Table 14.
[0590] Table 14. LNP1 / LNP2 Characterization
[0591] LNP Average LNP size (nm) PDI RNA loading (%) 1 68.6 0.022 95.7 2 68.6 0.029 96.2
[0592] PDI is polydispersity index
[0593] One of ordinary skill in the art will appreciate that the average LNP size, PDI, and RNA encapsulation values listed in Table 14 are subject to measurement error or accuracy. It is also contemplated herein that the LNP size, PDI, and RNA encapsulation values listed in Table 14 can vary + / - 1-5%, + / - 5-10%, or + / - 10-20%.
[0594] NHP study design
[0595] In this aspect of the study, female cynomolgus monkeys of Cambodian origin were used as the study animals. All animals were administered a premedication regimen comprising dexamethasone, and H1 and H2 antihistamines, on Day -1 (about 24 hours prior to dosing) and on Day 1 (30 to 60 minutes prior to test article dose administration). On Day 1 of the study, three monkeys were dosed with LNPl and 3 monkeys were dosed with LNP2 (n=3 / group) via a single IV infusion at a dose level of 3 mg of the combined sgRNA and mRNA per kg of animal body weight and at a dose volume of 6 mL / kg.
[0596] Blood samples were collected from all animals for baseline measurements prior to dosing and from all animals at various time points on Days 1 through 15 post-dosing to assess biomarkers, cytokines, plasma iLipid and PEG-lipid pharmacokinetics, and serum safety parameters.
[0597] Necropsy was performed on all animals on Day 16. Liver biopsy samples were collected to assess TTR gene editing.
[0598] Editorial efficiency analysis
[0599] The amount of gene editing in the liver was evaluated by next-generation sequencing (NGS) of targeted polymerase chain reaction (PCR) amplicons at the TTR target site derived from genomic DNA extracted from the livers of the animals using methods previously described (Musunuru et al., Nature 593, Issue 7859 (May 2021): 429-34. https: / / doi.org / 10.1038 / s41586-021-03534-y). Percent editing was reported as the percentage of all reads containing non-reference alleles at the target adenine.
[0600] Figure 10Figure 9 illustrates TTR editing efficiency of LNP1 compared to LNP2. Notably, as Figure 10 illustrated, the average liver TTR editing efficiency in NHPs treated with LNP1 (52%) was higher compared to LNP2 (29%).
[0601] Quantification of TTR protein expression in serum
[0602] Serum was collected from all animals at -10, -7, -5 days prior to infusion and at 7 and 14 days post LNP infusion for TTR protein analysis. Two methods were used to quantify serum TTR. TTR protein levels were initially quantified using a custom TTR sandwich ELISA, data obtained from this analysis is shown in Figure 11 . Values at -10, -7, and -5 days were averaged to obtain baseline values. Notably, LNP1 treated animals showed higher liver TTR editing compared to LNP2 treated animals (3% change from baseline at day 14) and also showed greater plasma TTR reduction (-63% change from baseline at day 14). TTR protein collected from serum was also quantified using liquid chromatography mass spectrometry (LC-MS), where four unique serum TTR peptide fragments were quantified from each sample time point and the average of the results was reported. LC-MS serum TTR quantification analysis using LC-MS is listed in Figure 12 and is in significant agreement with data obtained from ELISA quantification as it also demonstrates greater plasma TTR reduction for LNP1 compared to LNP2 (-73% change from baseline at day 14) (-21% change from baseline at day 14).
[0603] Thus, as Figure 10 , Figure 11 and Figure 12 illustrated, infusion of LNP1 and LNP2 in NHPs resulted in editing of the TTR gene in the liver with LNP1 showing higher editing than LNP2. The higher editing of LNP1 NHPs corresponded to a commensurate increase in reduction of serum TTR concentration in serum.
[0604] Security Analysis
[0605] Serum was collected from all animals at -10, -7, -5 days prior to infusion and at 6, 24, 48, 96, 168, 240, and 336 hours post LNP infusion for safety analyses, particularly aimed at observing changes in liver enzyme and cytokine levels. Serum chemistry parameters were measured directly on serum samples on a Beckman Coulter AU680 analyzer. Values at -10, -7, and -5 days were averaged to obtain baseline values. Animals dosed with LNP1 and LNP2 both showed a transient alanine aminotransferase (ALT) Figure 13A ) elevation, which peaked at 48 hours post infusion end and returned to baseline levels at 168 hours post infusion end. LNP1 and LNP2 treatment also both elevated aspartate aminotransferase (AST) levels (as illustrated in Figure 13B ), which peaked at 6 hours post infusion end and returned to baseline levels at 96 hours post infusion end. Serum lactate dehydrogenase concentrations (as illustrated in Figure 14A ) and glutamate dehydrogenase concentrations (as illustrated in Figure 14B ) were also found to be elevated shortly after administration of LNP1 or LNP2, returning to baseline levels at 96-168 hours post infusion end. LNP1 or LNP2 infusion did not change serum concentrations of gamma-glutamyltransferase (as illustrated in Figure 15A ) and alkaline phosphatase (as illustrated in Figure 15B ). In addition, LNP1 and LNP2 treatment did not affect serum total bilirubin concentrations, as illustrated in Figure 16 . Animals dosed with LNP1 and LNP2 also each showed elevated serum creatine kinase concentrations (as illustrated in Figure 17 ), which peaked at 6 hours post infusion end in each case and fully returned to baseline levels at 168 hours post infusion end.
[0606] Serum was collected from all animals at -10, -7, -5 days prior to treatment and at 24, 168, and 336 hours post LNP infusion for serum cytokine analysis. Cytokines were measured using a multiplex sandwich immunoassay, in which four (MCP-1, IL-6, IP-10, IL-1RA) cytokines were simultaneously quantified from serum samples using the U-PLEX Biomarker Panel 1 (Monkey) assay from MesoScale Diagnostics (Rockville, MD). Values at -10, -7, and -5 days were averaged to obtain baseline values. Animals dosed with LNP1 and LNP2 both showed elevated serum IL-6 concentrations (as illustrated in Figure 18 ) to a similar extent, which peaked at 6 hours post infusion end and returned to baseline at 24 hours post infusion end. As Figure 18As further shown, animals administered LNP1 and LNP2 showed increased serum IL-1RA, which peaked at 6 hours and fully returned to baseline by 336 hours. Figure 18 As shown, neither LNP1 nor LNP2 had any measurable significant effect on serum MCP-1 or IP-10 concentrations.
[0607] Overall, analysis of the aforementioned parameters indicated that infusion of LNP1 and LNP2 in monkeys resulted in transient increases in liver enzymes and cytokines that resolved rapidly.
[0608] Pharmacokinetic (PK) evaluation
[0609] Blood samples (K2EDTA) were obtained for plasma PK analysis and determination of the concentrations of iLipid and PEG lipid excipients that comprise LNP1 and LNP2. After the infusion was complete, plasma samples were collected at 0.25, 2, 6, 24, 48, 96, 168, 240, and 336 hours after LNP infusion. The concentrations of iLipid and PEG lipids were measured using a qualified LC-MS assay. Figure 19A The time points when lipids were below the limit of quantification are not included in this figure. Figure 19A As shown in the figure, serum iLipid concentrations in animals administered LNP1 and LNP2 continued to decrease until approaching the lower limit of quantification (LLOQ) 96 hours after LNP infusion. Figure 19B As shown, serum PEG-lipid concentrations in animals administered LNP1 and LNP2 also declined rapidly, reaching the LLOQ 24 hours after the end of the infusion.
[0610] Part B: In vivo NHP evaluation of GA519 using GalNAc LNPs In further evaluation of GA519, an additional LNP (LNP3) was formulated to encapsulate the same GA519 and ABE8.8 mRNA in a 1:1 weight ratio and administered intravenously to NHPs as previously described. LNP3 differed from LNP1 in that it was formulated with an additional GalNAc ligand excipient, as described in more detail below.
[0611] TNP preparation
[0612] The GalNAc LNP (LNP3) prepared for this aspect of the present research comprises the same iLipid, neutral helper lipid, PEG-lipid and sterol lipid as described in conjunction with LNP1 / LNP2, but unlike LNP1 / LNP2, LNP3 also comprises a GalNAc-conjugated lipid. The molar ratio of each constituent component of LNP3 is described in Table 15.
[0613] Table 15. LNP3 components
[0614]
[0615] * described in International Published Patent Application WO 2015095340 Al
[0616] ** described in International Published Patent Application WO 2021 / 178725 Al
[0617] It is understood that the lipids in Table 15 can be substituted with other suitable lipids in the listed class. For example, the amino lipid can be the following amino lipids or salts thereof:
[0618]
[0619] It is further understood that the mol% of the lipids in Table 13 can be adjusted, and the mol% included in Table 13 is the target excipient percentage of the LNP (which is intended to represent the aggregate mol% of all LNP formulated in a given batch), and a particular LNP within a batch can have a different mol%. Thus, it is contemplated herein that the mol% of one or more or all of the LNP components listed in Table 13 can be adjusted, e.g., + / - 1%-5%, + / - 5%-10%, or + / - 10%-20%. It is further contemplated herein that the mol% of one or more or all of the LNP components listed in Table 13 can differ from the target mol% by, e.g., + / - 1%-5%, + / - 5%-10%, or + / - 10%-20%, or even greater than + / - 20% relative to the particular LNP formulated in a given batch of LNP formulated according to the desired target excipient percentage. Further, it is understood that additional LNP components (including non-lipid components) can be added to the LNP components listed in Table 13.
[0620] In formulating LNP3, the GalNAc-lipid was pre-mixed with the other LNP excipients mentioned in Table 15, followed by inline mixing with the GA519 sgRNA and ABE 8.8 mRNA at a 1 : 1 weight ratio to form LNP3. WO 2021178725 by Raigev et al. includes a description of the synthesis and characterization of the GalNAc lipids. As with LNP1 / LNP2, the resulting GalNAc-LNP (LNP3) was filtered using a 0.2 micron filter and frozen at -80°C. The physical properties of the formulated LNP3 are summarized in Table 16.
[0621] Table 16. LNP3 characterization
[0622] LNP Average LNP size (nm) PDI RNA packaging 3 61.92 0.055 98.7
[0623] Those of ordinary skill in the art will appreciate that the average LNP size, PDI, and RNA encapsulation values listed in Table 16 are subject to measurement error or accuracy. It is also contemplated herein that the LNP size, PDI, and RNA encapsulation values listed in Table 16 can vary + / - 1-5%, + / - 5-10%, or + / - 10-20%.
[0624] NHP study design
[0625] In this aspect of the study, male cynomolgus monkeys of Cambodian origin were used. A premedication regimen comprising dexamethasone, and H1 and H2 antihistamines was administered to all animals on Day -1 (approximately 24 hours prior to dosing) and between 30 and 60 minutes prior to test article dose administration on Day 1. On Day 1 of the study, LNP3 dosing formulations were administered by IV infusion at the following dose levels to two groups of 3 monkeys: (i) 2 mg of the combined sgRNA and mRNA per kg of animal body weight and a dose volume of 6 mL / kg for the first group of 3 monkeys (n=3 / group), and (ii) 3 mg of the combined sgRNA and mRNA per kg of animal body weight and a dose volume of 6 mL / kg for the second group of 3 monkeys (n=3 / group).
[0626] Blood samples were collected from all animals for baseline measurements prior to dosing and from all animals at various time points on Days 1 through 35 post-infusion to assess biomarkers, plasma iLipid and PEG pharmacokinetics, and serum safety parameters.
[0627] Necropsy was performed on Day 36. Liver tissue samples were collected from all animals to assess TTR gene editing in the liver.
[0628] Editorial efficiency analysis
[0629] The amount of gene editing in the liver was evaluated by next-generation sequencing (NGS) of targeted polymerase chain reaction (PCR) amplicons derived from the TTR target site at genomic DNA extracted from the liver as previously described (Musunuru et al., Nature 593, Issue 7859 (May 2021): 429-34. https: / / doi.org / 10.1038 / s41586-021-03534-y). Percent editing was reported as the percentage of all reads containing non-reference alleles at the target adenine.
[0630] As shown in Figure 20 LNP3 produced similar levels of liver TTR editing efficiency in monkeys dosed with 2 mg / kg (60%) compared to monkeys dosed with 3 mg / kg (63%).
[0631] Quantification of TTR protein expression in serum
[0632] Serum was collected for TTR protein analysis on days −10, −7, and −5 before infusion and on days 7, 14, 21, 28, and 35 after the end of infusion. Serum TTR was initially quantified using a custom TTR sandwich ELISA, and data from this analysis are presented in Figure 21 The values on days -10, -7, and -5 were averaged to obtain the baseline value. Figure 21 As shown, both groups of animals dosed with LNP3 showed significant reductions in serum TTR protein at the first time point after dosing (day 7). These reductions were maintained for the duration of the study, reaching a maximum reduction of -84% and -91% relative to baseline for the 2 mg / kg and 3 mg / kg monkey groups, respectively, on day 28. To confirm the ELISA results, TTR protein was also quantified by LC-MS, where four unique TTR peptide fragments were quantified in the serum at each time point, and the average of the four results was reported. LC-MS serum TTR quantification (e.g. Figure 22 Figure 3 (illustrated) confirmed that TTR was reduced at the first time point after the animals were infused, day 7, and was maintained until necropsy on day 35. For animals administered 2 mg / kg LNP3, the maximum reduction in TTR protein was achieved on day 35 (-82% change from baseline), while for the 3 mg / kg group, the maximum reduction in TTR protein was achieved on day 28 (-87% change from baseline).
[0633] Thus, as described above and illustrated in the aforementioned referenced figures, administration of both 2 mg / kg and 3 mg / kg LNP3 to NHPs resulted in significant, relatively rapid hepatic TTR gene editing and corresponding reductions in serum TTR concentrations as protein.
[0634] Security Analysis
[0635] Before infusion, -10, -7, -5 days and after infusion, 6 hours, 24 hours, 48 hours, 96 hours, 168 hours, 336 hours, 21st day, 28th day and 35th day, serum was collected from each animal in the research for safety analysis, particularly intended to observe changes in liver enzymes and cytokine levels. Serum chemistry parameters of serum samples were directly measured on Beckman Coulter AU680 analyzer. The values of -10, -7 and -5 days were averaged to obtain baseline values. Animals that were administered LNP3 showed a dose-dependent, short-term increase in alanine aminotransferase (ALT) (e.g., 48 hours, 96 hours, 168 hours, 336 hours, 21st day, 28th day and 35th day). Figure 23Apeaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 23B peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 24A peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 24B peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 25B peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 26 peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 27 peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively.
[0636] The analysis of the foregoing safety parameters in this aspect of the in vivo NHP study was consistent with the previous aspects of the study in that they demonstrated that both doses of LNP3 resulted in a transient increase in liver enzymes that rapidly resolved within 2 weeks of dosing the subjects.
[0637] Pharmacokinetic (PK) evaluation
[0638] Blood samples (K2EDTA) were obtained from all animals for plasma PK analysis and determination of concentrations of the ionizable amino lipid (iLipid) and PEG lipid that constitute LNP3. Plasma samples were collected at 0.25, 2, 6, 24, 48, 96, 168, 240, and 336 hours after the end of LNP3 infusion. Concentrations of iLipid and PEG-lipid were measured using a qualified LC-MS assay. Dose-dependent plasma exposure of iLipid was observed (as shown in Figure 257A), which declined to below the LLOQ by 96 hours after the end of infusion. Dose-dependent plasma exposure of PEG lipid was also observed (as shown in Figure 257B), which reached the LLOQ by 24 hours after the end of infusion. Figure 28A peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively. Figure 28B peaked at 6 hours after the end of infusion and returned to baseline levels 168 hours after the end of infusion. As shown in Figure 258A and 258B, respectively, neither of the two LNP doses significantly changed serum concentrations of gamma-glutamyltransferase and alkaline phosphatase, respectively.
[0639] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for example, nucleotide sequence submissions in, for example, GenBank and RefSeq, and amino acid sequence submissions in, for example, SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. In the event that any conflict between the disclosure of this application and the disclosure of any of the documents incorporated by reference exists, the disclosure of this application shall prevail. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The application is not limited to the particular details described and is
[0640] Example 4
[0641] TTR gene editing by GA521 guide RNA
[0642] This example illustrates gene editing by the exemplary modified guide RNA GA521.
[0643] The exemplary guide RNA GA521 was transfected into primary human hepatocytes using MessengerMax transfection. GA521 disrupts the start codon of the TTR gene by editing the AUG start codon to ACG using an A to G base editor (e.g., ABE8.8; ABE8.8-m).
[0644] Three days post transfection, genomic DNA was harvested from the hepatocytes and assessed for base editing by next generation sequencing of PCR amplicons generated around the target splice site.
[0645] The following human TTR locus primers were used for NGS analysis:
[0646] In the presence of NGS adaptors:
[0647] Forward (F):
[0648]
[0649] Reverse (R):
[0650]
[0651] In the absence of NGS adaptors:
[0652] Forward (F): GATAAGCAGCCTAGCTCAGGAGA (SEQ ID NO: 5771) Reverse (R): GGGCCAGCCTCAGACACAAA (SEQ ID NO: 5772)
[0653] Figure 29 Dose response of human gRNA GA521 in primary human hepatocytes is depicted. Percent base editing at various total RNA doses (ng / ml) was determined by NGS analysis. GA521 is guide RNA.
[0654] Overall, GA521 showed increasing base editing with increasing total RNA dose (ng / ml) and showed high and consistent editing activity over 40% in human cells.
[0655] Other embodiments
[0656] From the foregoing description, it will be apparent that variations and modifications can be made to the disclosures described herein to apply the disclosures to various uses and conditions. Such embodiments are also within the scope of the following claims.
[0657] The recitation of a list of elements in any definition of a variable herein includes definitions of that variable that encompass any single element or combination (or sub-combination) of listed elements. The recitation of embodiments herein includes that embodiment in the form of any single embodiment, any portion of that embodiment, or combination with any other embodiment or portion thereof.
[0658] As described herein, it will be appreciated that the disclosure includes specific embodiments and examples of base editing systems for effecting nucleobase alterations in genes and methods of using the base editing systems to treat diseases, including compositions comprising such base editing systems, designs and modifications made thereto; and specific examples and embodiments describing synthesis, preparation, uses, and efficacy of the foregoing, both alone and in combination, including as pharmaceutical compositions for treating diseases and for delivering active agents to mammalian cells in vivo and in vitro under the conditions described.
[0659] While specific examples and numerous embodiments have been provided to illustrate aspects and combinations of aspects of the foregoing, it will be appreciated that any aspect or combination of aspects of the example or disclosed embodiments can be excluded therefrom to constitute another embodiment without limitation, and that any such embodiment can constitute a separate and independent claim. Similarly, it will be appreciated that any aspect or combination of aspects of one or more embodiments can also be included or combined together with any aspect or combination of aspects of one or more embodiments, and that all such combinations thereof are contemplated herein and can be presented as separate and independent claims without limitation. Thus, it will be appreciated that any feature presented in one claim can be included in another claim; any feature presented in one claim can be deleted from that claim to constitute a claim without that feature; and any feature presented in one claim can be combined with any feature in another claim, with each feature being considered herein.
[0660] Table 17. gRNA spacer sequences with PS linkages at the 5’ end
[0661] gRNA spacer sequence (5’-3’) gscscsAUCCUGCCAAGAAUGAG (SEQ ID NO: 6) gscscsAUCCUGCCAAGAACGAG (SEQ ID NO: 7) gscsasACUUACCCAGAGGCAAA (SEQ ID NO: 8) usasusAGGAAAACCAGUGAGUC (SEQ ID NO: 9) usascsUCACCUCUGCAUGCUCA (SEQ ID NO: 10) gscscsAUCCUGCCAAGAACGAG (SEQ ID NO: 7)
[0662] wherein: A is adenosine; C is cytidine; G is guanosine; U is uridine; a is 2’-O-methyl adenosine; c is 2’-O-methyl cytidine; g is 2’-O-methyl guanosine; u is 2’-O-methyl uridine and s is a phosphorothioate (PS) backbone linkage.
[0663] Table 18. gRNA spacer sequences without PS linkages
[0664] gRNA spacer sequence (5’-3’) GCCAUCCUGCCAAGAAUGAG (SEQ ID NO: 1) GCCAUCCUGCCAAGAACGAG (SEQ ID NO: 2) GCAACUUACCCAGAGGCAAA (SEQ ID NO: 3) UAUAGGAAAACCAGUGAGUC (SEQ ID NO: 4) UACUCACCUCUGCAUGCUCA (SEQ ID NO: 5) GCCAUCCUGCCAAGAACGAG (SEQ ID NO: 2)
[0665] wherein: A is modified or unmodified adenosine; C is modified or unmodified cytidine; G is modified or unmodified guanosine; and U is modified or unmodified uridine.
[0666] Table 19. Guide RNA sequences
[0667]
[0668]
[0669] wherein: A is adenosine; C is cytidine; G is guanosine; U is uridine; a is 2’-O-methyl adenosine; c is 2’-O-methyl cytidine; g is 2’-O-methyl guanosine; u is 2’-O-methyl uridine and s is a phosphorothioate (PS) backbone linkage, and wherein bold indicates the spacer sequence.
[0670] Table 20. Guide RNA sequences
[0671]
[0672]
[0673] It will also be appreciated by reviewing the disclosure that where one or more aspects or features are presented in one or a group of related clauses, the same can also be incorporated in other clauses or in combination with one or more aspects or features in other clauses.
Claims
1. A base editor system for modifying a target thyroxine translocator (TTR) gene, the base editor system comprising a guide RNA comprising a sequence defined by: mG*mC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAG UmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU(GA521,SEQ ID NO:11), wherein A is adenosine, C is cytidine, G is guanosine, U is uridine, mA* is 2′-O-methyladenosine, mC* is 2′-O-methylcytidine, mG* is 2′-O-methylguanosine, mU* is 2′-O-methyluridine, and wherein the nucleotides in bold are linked by phosphorothioate (PS) backbone linkages, The guide RNA directs the base editor system to effectuate a nucleobase change in the TTR gene.
2. An engineered, non-naturally occurring base editing system for modifying a target thyroxine translocase (TTR) gene, the base editing system comprising (a) a guide RNA molecule having a (a) a codon-optimized nucleic acid encoding a Cas9 protein fused to a deaminase, wherein the Cas9 protein fusion is capable of binding to the guide RNA and editing a target TTR sequence complementary to the guide RNA.
3. The composition of claim 2, wherein the deaminase comprises cytosine deaminase or adenine deaminase.
4. The composition of claim 2 or 3, wherein the Cas9 protein is a catalytically impaired Cas9 protein.
5. The composition of claim 4, wherein the Cas9 protein is a dead Cas9 or a nickase Cas9.
6. The composition of claim 3, wherein the cytosine or adenine deaminase is a deoxycytosine or deoxyadenosine deaminase.
7. The composition of claim 3, wherein the Cas9 is fused to ABE8.
8.
8. A lipid nanoparticle (LNP), comprising the system of any one of claims 2-7.
9. The LNP of claim 8, wherein the LNP comprises an ionizable amino lipid, a neutral helper lipid, a PEG-lipid, a sterol lipid, and / or a GalNAc lipid.
10. The LNP of claim 9, wherein the ionizable amino lipid is VL422 or LP-01, the neutral helper lipid is DSPC, and the PEG lipid is PEG 2000 -DMG, the sterol lipid is cholesterol and the GalNAc lipid is DSG-PEG-Lys-tris(GalNAc).
11. The LNP of claim 10, wherein the ionizable lipid is LP-01 (or CIN16645) defined by the following structure, 12. The LNP of any one of the preceding claims, wherein the LNP comprises an N:P ratio of between about 1:40 and about 1:
1.
13. The LNP of claim 12, wherein the LNP comprises an N:P ratio of about 1:
6.
14. A pharmaceutical composition comprising the LNP according to any one of claims 9 to 13.
15. A method of editing a TTR gene in a cell, the method comprising contacting the cell with an LNP comprising (a) a guide RNA molecule having a sequence defined by mG*mC*mC*AUCCUCGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 11); and (b) A base editor system comprising a codon-optimized nucleic acid encoding a Cas9 protein fused to a deaminase, wherein the Cas9 protein fusion is capable of binding to the guide RNA and is capable of editing a target nucleic acid sequence complementary to the guide RNA.
16. A method of treating a disease or condition comprising administering the pharmaceutical composition of claim 14 to a subject in need thereof.
17. The method of claim 16, wherein the disease or condition is hereditary transthyretin amyloidosis, cardiomyopathy, polyneuropathy, or senile cardiac amyloidosis.
18. The method of claim 16 or 17, wherein the pharmaceutical composition is administered by a route selected from intravenous, intradermal, transdermal, intranasal, intramuscular, subcutaneous, transmucosal, or oral.
19. The method of any one of claims 16-18, wherein the LNP is delivered to the liver.
Citation Information
Patent Citations
Compositions and methods for targeted RNA delivery
US11207416B2
Lipid carrier and method of preparing the same
US20070087045A1
Modified polynucleotides for the production of secreted proteins
US20160375134A1
Compositions and methods for delivery of agents
US20180147298A1
Compositions and methods for treating lung diseases and lung injury
US20180200186A1