Use of moxidectin in the preparation of a medicament for the treatment of the gill disease

Abstract

The application discloses the technical field of biology, and particularly discloses application of moxidectin in preparation of a medicine for resisting akawa virus (AKAV) and a preparation method of the medicine.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular, the application of moxidectin in the preparation of a drug for resisting Akabane virus. BACKGROUND

[0002] Moxidectin, the chemical name of which is [6R, 23E, 25S (E)]-5-O-demethyl-28-deoxy-25- (1, 3-dimethyl-1-butenyl)-6, 28-epoxy-23- (methoxyimino) milbemycin, is a macrocyclic lactone anthelmintic antibiotic developed by Pfizer and the World Health Organization (WHO), and is approved for the treatment of human onchocerciasis. Moxidectin has a significant effect on anti-parasites and has been proven to be effective in the treatment of enterobiasis, filariasis, soil-transmitted helminthiasis, trichinosis and scabies. In addition, studies have shown that moxidectin has antiviral activity in some viruses, such as H9 influenza virus. In general, moxidectin has certain potential in antiviral.

[0003] Akabane virus (AKAV) is a member of the Orthobunyavirus genus of the Peribunyaviridae family, a single-stranded negative-sense RNA virus, and its genome consists of three segments, L segment encoding transcription and replication-related enzymes, M segment encoding two glycoproteins (GC and GN) and a non-structural protein (NSm), and S segment encoding nucleocapsid protein (N) and non-structural protein (NSs). AKAV infection can cause a multi-type infectious disease characterized by abortion, premature birth, stillbirth, congenital joint flexion, hydrocephalic anencephaly and myelencephalitis in cattle and sheep. However, there is no drug for AKAV on the market at present, and it is urgent to develop an effective drug based on moxidectin. SUMMARY

[0004] In order to solve the above technical problems, the present application provides the application of moxidectin in the preparation of a drug for resisting Akabane virus, which is to inhibit the growth of Akabane virus and / or reduce the titer of Akabane virus, to inhibit the growth of Akabane virus and / or reduce the expression amount of Akabane virus protein, and the Akabane virus protein is Akabane virus GC protein.

[0005] To achieve the above purpose, the present application is implemented according to the following technical scheme:

[0006] One of the purposes of the present application is to provide the application of moxidectin as the only active ingredient in the preparation of a drug for resisting Akabane virus.

[0007] The second purpose of the present application is to provide a drug for resisting Akabane virus, which comprises moxidectin.

[0008] Further, the anti-akabane virus drug further comprises a pharmaceutically acceptable carrier and / or adjuvant.

[0009] Further, the dosage form of the drug is one of tablets, sprays, granules, capsules, oral liquids, injections, suspensions.

[0010] Compared with the prior art, the present application finds that moxidectin has no cytotoxicity on MDBK cells by determining the cytotoxicity after AKAV virus infection, finds that moxidectin can be an inhibitor of AKAV virus by RT-qPCR, WB, IFA, can inhibit the growth of akabane virus and / or reduce the expression amount of akabane virus GC protein, has a good inhibitory effect on AKAV virus at a concentration of 1.25-10 μM, and provides a new candidate drug for preventing and treating AKAV virus infection. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 Toxicity of moxidectin in MDBK cells;

[0012] Figure 2 Inhibitory effect of moxidectin on the genome copy number of AKAV virus;

[0013] Figure 3 Inhibitory effect of moxidectin on the expression of AKAV virus GC protein;

[0014] Figure 4 Inhibitory effect of moxidectin on the expression of AKAV virus GC protein; DETAILED DESCRIPTION

[0015] To make the purpose, technical scheme and advantages of the present application clearer and more apparent, the following combines embodiments to further describe the present application in detail. The specific embodiments described herein are only used to explain the present application and do not limit the present application.

[0016] The bovine kidney cells (MDBK) used in the following examples are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. MDBK cells are a cell line derived from the kidney of a cow, which can spontaneously differentiate into epithelial-like monolayer cells, and are the optimal in vitro model for studying anti-akabane virus drugs. Vero cells are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. Vero cells are African green monkey kidney cells, which are aneuploid cells derived from rhesus monkey kidney cell culture, and are as common cell lines as the famous Hela cell line and dog kidney cells (MDCK cells). If not specified, the related reagents used are commercially available reagents, and the methods involved are public methods if not specified.

[0017] The compound used is moxidectin, which is purchased from MedChemExpress Company, and its chemical molecular structure is shown in the following formula.

[0018] .

[0019] The strain of akabane virus used is akabane virus AKAV_FS202301, with the accession number CCTCC NO:V2024119 and the sequence number PQ567126-PQ567128, which is subcultured on Vero cells and tested on MDBK cells.

[0020] In order to verify whether moxidectin can be prepared as an anti-akabane virus drug as the only active ingredient, the following tests were carried out respectively:

[0021] 1. Cytotoxicity of moxidectin in MDBK cells

[0022] A 10 mM moxidectin solution dissolved in 30 μL dimethyl sulfoxide (DMSO) was diluted with base DMEM medium by a factor of 2, to obtain a moxidectin dilution solution with a concentration of 12.5-200 μM.

[0023] MDBK cells were plated at 1×10 5 cells / well in a 96-well cell plate (with DMEM medium containing 20% FBS), to obtain a cell plate containing MDBK, and the cytotoxicity of moxidectin was detected, as follows:

[0024] The experimental wells were set as follows: moxidectin solutions with final concentrations of 1.25 μM, 2.5 μM, 5 μM, and 10 μM were added to the 96-well culture plate containing MDBK cells, with 8 replicate wells (one column in the 96-well plate) for each concentration of moxidectin solution; the blank wells were set to contain only the medium, and were recorded as the cell group; the experimental wells were set to contain cells, medium, and moxidectin solution treatment; and the control wells were set to have no moxidectin solution treatment.

[0025] After 24 h of cell culture (37 ℃, 5% CO2), 10 μL of CCK-8 solution was added to each well. After incubation in the incubator for 4 h, the absorbance at 450 nm was measured using a microplate reader, and the cell survival rate (%) was calculated according to Formula I.

[0026] Formula I: Cell survival rate (%) = [(experimental well OD value-blank well OD value) / (control well OD value-blank well OD value)]×100.

[0027] The cytotoxicity of moxidectin in MDBK cells is shown in Table 1. Figure 1As shown, Moxidectin had no cytotoxicity in MDBK cells at 1.25-10 μM.

[0028] 2. Effect of Moxidectin treatment on MDBK cells on AKAV virus infection

[0029] (1) Effect on the copy number of AKAV virus in MDBK cells

[0030] MDBK cells (2 x 10 6 / well) were cultured in 12-well plates with DMEM medium containing 10% FBS, and the experimental group was inoculated with AKAV virus (MOI = 1) and then treated with different concentrations (1.25 μM, 2.5 μM, 5 μM, 10 μM) of Moxidectin, the infection control group was treated with AKAV virus (MOI = 1) mixed with DMSO. The blank control was treated with no AKAV virus and medium. The cell plates were incubated at 37°C, 5% CO2 for 24 h, then total RNA was extracted by the Trozil method and reverse transcribed into cDNA. Finally, the copy number of viral genome was detected by fluorescence quantitative PCR targeting the AKAV virus NSs gene, and the total volume of the fluorescence quantitative PCR reaction system was 20 μL, including 10 μL of SYBR Green I; 0.4 μL of upstream and downstream primers, 2 μL of template, supplemented with sterile deionized water to 20 μL; the upstream primer sequence was: TAAGACGCCACAACCAAGTGT; the downstream primer sequence was: CCGAAATGCGATGGAGCGTA.

[0031] The results of calculating the copy number of virus after treating MDBK cells with different concentrations (1 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM) of Moxidectin after AKAV virus infection are shown in Figure 2 . The results show that in MDBK cells, compared with the control group, the copy number of AKAV virus genome gradually decreased with the increase of the concentration of Moxidectin. The results show that Moxidectin can inhibit the replication of AKAV virus in a dose-dependent manner.

[0032] (2) Effect on the expression of GC protein of AKAV virus in cells

[0033] Cell culture, GHV infection and moxidectin treatment were the same as described in (1). The specific sample processing method was as follows: the cell culture supernatant was discarded, washed with PBS for three times, 1x SDS-PAGE loading buffer was added for protein denaturation treatment (100℃, 10 min), then centrifuged for 10 min (12000 r / min), the protein sample was added to the sample well of the gel after homogenization, electrophoresis (120 V, 30 min) was performed under bromophenol blue dye, then 0.2 μm nitrocellulose membrane (NC membrane) was used for membrane transfer (100 V, 1 h), 5% skimmed milk powder was used for blocking (1 h), the skimmed milk powder was discarded, the NC membrane was washed with 1x TBST, the primary antibody was added and placed in the refrigerator overnight at 4℃, the NC membrane was washed with 1x TBST (5 times / 5 min), the corresponding secondary antibody was added (incubated for 1 h), 1x TBST was washed (5 times / 5 min), finally ECL luminescent liquid was used for exposure, and the expression of G protein of GHV was detected.

[0034] The results of G protein expression of GHV after MDBK cells were treated with different concentrations of moxidectin after GHV infection are shown in Figure 3

[0035] The results show that in MDBK cells, compared with the control group, the expression amount of G protein of GHV gradually decreases with the increase of the concentration of moxidectin. The results show that moxidectin can inhibit the replication of GHV.

[0036] (3) Effect of moxidectin on immunofluorescence of GHV in cells

[0037] Cell culture, GHV infection and moxidectin treatment were the same as described in (1). The specific sample processing method was as follows: the cell culture supernatant was discarded, washed with PBS for three times, 1x SDS-PAGE loading buffer was added for protein denaturation treatment (100℃, 10 min), then centrifuged for 10 min (12000 r / min), the protein sample was added to the sample well of the gel after homogenization, electrophoresis (120 V, 30 min) was performed under bromophenol blue dye, then 0.2 μm nitrocellulose membrane (NC membrane) was used for membrane transfer (100 V, 1 h), 5% skimmed milk powder was used for blocking (1 h), the skimmed milk powder was discarded, the NC membrane was washed with 1x TBST, the primary antibody was added and placed in the refrigerator overnight at 4℃, the NC membrane was washed with 1x TBST (5 times / 5 min), the corresponding secondary antibody was added (incubated for 1 h), 1x TBST was washed (5 times / 5 min), finally ECL luminescent liquid was used for exposure, and the expression of G protein of GHV was detected.

[0038] The results of virus fluorescence observation after MDBK cells were treated with different concentrations of moxidectin after GHV infection are shown in Figure 4 ​As shown in the figure, wherein the DAPI group is to use DPAI staining solution to stain the nucleus of MDBK cell; the Anti-N group is to use fluorescein isothiocyanate (FITC) to label N protein; the Merge group is the synthesis diagram of the DAPI group and the Anti-N group.

[0039] The results show that in the MDBK cells, compared with the control group, the fluorescence of the Akabane virus is significantly reduced with the increase of the concentration of moxidectin.

[0040] In summary, moxidectin can be prepared as an only active ingredient of the medicine against the Akabane virus, and of course, the prepared medicine contains moxidectin, and also contains a pharmaceutically acceptable carrier and / or adjuvant; the dosage form of the medicine is one of a tablet, a spray, a granule, a capsule, an oral liquid, a needle, and a suspension.

[0041] The technical scheme of the present application is not limited to the above specific embodiments, and any technical modification made according to the technical scheme of the present application falls within the protection scope of the present application.

Claims

1. Use of moxidectin as the sole active ingredient in the manufacture of a medicament for the treatment of the Gumboro virus.

Images