SNP molecular marker g.75896359at of yap1 gene associated with goat lambing traits and application

Abstract

The present application relates to the modern livestock breeding technical field, especially to a SNP molecular marker YAP1 gene g.75896359AT related to goat lambing traits and application. The SNP molecular marker is located at the 51bp of the nucleotide sequence shown in SEQ ID NO.01, and the polymorphism is A / T. When the genotype of the polymorphism site contained in the molecular marker is AT or TT, the relative advantage of the lambing traits of the goat to be detected is obtained. The molecular marker provided by the present application can be applied to the identification or prediction of the goat lambing state, and can also be applied to the field of molecular breeding. Based on the analysis of the genotype of the goat, the genetic potential of the goat is judged. By selecting the superior allele genotype of the SNP molecular marker, the lambing performance of the offspring of the goat can be improved, which is used for genetic improvement of the breeding goat, and effectively improves the economic benefit of the mutton sheep breeding industry.

Description

Technical Field

[0001] This invention relates to the field of modern animal husbandry technology, and in particular to a SNP molecular marker YAP1 gene g.75896359AT related to lambing traits in goats and its application. Background Technology

[0002] The reproductive performance of goats is a crucial factor restricting the development of the goat industry. Increasing the number of lambs born to goats can not only increase mutton production but also improve breeding efficiency. Lambing traits of goats include the number of lambs born, the number of live lambs, and the multiple lambing rate, all of which have a significant impact on the lambing capacity of goats.

[0003] Single nucleotide polymorphisms (SNPs) are characterized by their large number, wide distribution, low heterozygosity, good genetic stability, and suitability for high-throughput automated detection, making them a preferred tool for molecular breeding, gene mapping, and population evolution research. Modern selective breeding techniques, by incorporating molecular markers with significant effects into marker-associated selection (MAS) and genomic selection (GS), can significantly improve the genetic improvement of goat litter size, thereby promoting the efficient development of my country's goat industry. Genome-wide association studies (GWAS) are helpful in efficiently screening molecular markers that have a significant impact on phenotypes. Although GWAS technology has made significant progress, some challenges remain, such as low data standardization quality and high costs associated with large-scale population sequencing, which need to be addressed in GWAS research. In modern livestock breeding, because livestock and poultry populations are generally large, using high-depth sequencing for base information acquisition incurs high costs, thus reducing economic efficiency, while the data quality of low-depth sequencing needs further evaluation. Therefore, in order to meet the requirements of large-scale population sequencing, providing low-cost, high-quality SNP locus information for GWAS analysis is an important factor in improving the efficiency of SNP screening.

[0004] Currently reported SNP loci associated with goat litter size include the c.*454C>G locus in the goat NFAT5 gene, the c.*1103G>A locus in the goat RSAD2 gene, and the g.7919G>A locus in the goat ZBP1 gene. Screening for new SNP loci associated with goat litter size can provide new molecular marker resources for marker-assisted selection in goats, accelerating the process of breeding improvement.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a SNP molecular marker YAP1 gene g.75896359AT related to lambing traits in goats and its application.

[0007] Specifically, the technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides an SNP molecular marker associated with lambing traits in goats, wherein the SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.01 and has a polymorphism of A / T.

[0009] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is AT or TT, corresponding to the relative advantage of the lambing trait in the goat being tested.

[0010] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is AA, which corresponds to a relative disadvantage in lambing traits of the goat being tested.

[0011] The molecular markers screened in this invention can be applied to genotypic analysis of genes related to goat litter size or association analysis related to goat litter size, providing a new molecular marker resource for marker-assisted selection of goat litter size.

[0012] In a second aspect, the present invention provides substances for detecting the SNP molecular markers described in the first aspect above, including PCR primers for amplifying genomic DNA fragments containing the SNP molecular markers or kits containing the primers.

[0013] Thirdly, the present invention provides the application of the aforementioned molecular markers or substances in at least one of the following:

[0014] (1) Application in identifying lambing traits in goats;

[0015] (2) Application in predicting lambing traits in goats;

[0016] (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

[0017] Preferably, the lambing trait includes the average number of lambs born.

[0018] Preferably, the breed of goat includes the Chubao Blackhead Goat.

[0019] Fourthly, the present invention provides a method for detecting reproductive traits in goats, comprising: detecting whether the N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of a goat is A or T, and determining the reproductive traits of the goat based on the detection results.

[0020] Preferably, the present invention uses primers of the amplified sequence SEQ ID NO:1 to perform genotyping on the Chubao blackhead sheep material to be tested. If the genotype is AT or TT, the relative advantage of the average number of lambs per individual to be tested is determined.

[0021] Fifthly, this invention provides a genetic breeding method to improve the number of lambs born in goats. The method involves identifying SNP molecular markers in breeding goats within a core goat population. These SNP molecular markers are located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, with a polymorphism of A / T. Based on the goat SNP molecular markers, appropriate selections are made: in the successive breeding of breeding goats, individuals with the AT and / or TT type base at the 51st position of the SNP marker are selected, while AA type individuals are eliminated. This process gradually increases the frequency of gene C at this locus, thereby improving the lambing performance of offspring goats.

[0022] Beneficial effects:

[0023] This invention provides a SNP molecular marker YAP1 gene g.75896359AT associated with lambing traits in goats and its application. The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.01, and its polymorphism is A / T. When the genotype of the polymorphic site contained in the molecular marker is AT or TT, it corresponds to the relative dominance of the lambing trait in the goat being tested. The molecular marker provided by this invention can be applied to the identification or prediction of lambing status in goats, and can also be applied in the field of molecular breeding. Based on the analysis of goat genotypes, the genetic potential of goats can be determined. By optimizing the dominant allele of this SNP molecular marker, the lambing performance of goat offspring can be improved, which can be used for the genetic improvement of breeding sheep and effectively improve the economic benefits of meat sheep farming. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0025] Figure 1 Manhattan plot of goat birth rate. The black circles and arrows point to the molecular markers screened in this invention, which are located on goat chromosome 15. Detailed Implementation

[0026] The main objective of this invention is to screen out a molecular marker g.75896359AT that is associated with the lambing number trait in goats, and to provide the application of this molecular marker in goat lambing number detection or goat breeding.

[0027] First, this invention provides a goat SNP molecular marker located at nucleotide position 75,896,359 on chromosome 15 of the goat reference genome. The base at this position is either A or T. The nucleotide sequences of the 50 bp upstream and downstream of this SNP position are shown below (SEQ ID NO:1):

[0028] GAATGTTCCATGCCTATGGCAGCAGCCCGGTCAGAGGGGCTGAG GCAGATN(A / T)TGAAGAACAGCAGGAAGGCCGCTACAGCGGGGACAG AGCCGGTGAAAAGG.

[0029] The N at position 51 of the above sequence represents an A51-T51 allelic mutation, which causes nucleotide polymorphism in the SEQ ID NO:1 sequence. This molecular marker can be used to detect factors related to goat litter size, and a T at position 51 of the sequence shown in SEQ ID NO:1 is associated with goats having a higher average multiparous litter size.

[0030] The present invention further provides a reagent or kit comprising primers for detecting the above-mentioned SNP molecular markers. Those skilled in the art can design primers capable of amplifying the sequence shown in SEQ ID NO:1 according to primer design principles to detect the SNP marker genotypes associated with goat litter size in the present invention, thereby predicting goat reproductive traits, especially the average number of multiparous lambs.

[0031] The SNP molecular markers or reagents or kits described above in this invention can be applied to the detection of goat reproductive traits or goat breeding; the goat reproductive trait is the average number of lambs born per litter; the preferred breed of goat is the black-headed goat.

[0032] The present invention further provides a method for detecting the number of lambs born to goats, which detects whether the N-labeled mononucleotide in the above-mentioned SEQ ID NO:1 sequence of the goat is A or T.

[0033] Preferably, the number of lambs born to the goats is the average number of lambs born to goats in multiparous litters.

[0034] As a more preferred and specific implementation method, the present invention uses primers that amplify the sequence shown in SEQ ID NO:1 to perform genotyping on the goat material to be tested. The average number of lambs born to goat individuals with genotype AT or TT is significantly higher than that of individuals with AA genotype.

[0035] The present invention preferably uses the reagents or kits mentioned above for detection.

[0036] This invention also provides the application of the above-mentioned single nucleotide polymorphisms of goat SNP sites or substances (reagents or kits) for detecting single nucleotide polymorphisms of goat SNP sites in the detection or auxiliary detection of reproductive traits or goat breeding.

[0037] This invention also provides a method for screening the above-mentioned SNP molecular markers, comprising the following steps:

[0038] ① Extract goat genomic DNA and perform whole-genome low-depth and high-depth resequencing to obtain raw sequencing data;

[0039] ② Quality control of the raw sequencing data was performed, and the data was compared with the goat reference genome. The Sentieon+Beagle strategy was used to detect genetic variations and fill genotypes on all autosomes of the sample to obtain high-quality SNP locus data.

[0040] ③ Using the FarmCPU model with rMVP software, GWAS analysis was performed on SNP sites and average multiparous lambing of goats to obtain SNP molecular markers related to the number of lambs born to the goats.

[0041] As a more specific implementation method, the low depth of the present invention is 1-2×, and the high depth is 15-20×; preferably, the number of low depth sequencing results is higher than that of high depth sequencing results, so as to fill the genotypes of more low depth sequencing results with fewer high depth sequencing results, thereby reducing sequencing costs.

[0042] This invention also provides a genetic breeding method to improve the number of lambs born in goats. The method involves identifying the above-mentioned SNP molecular markers in the breeding goats in the core goat population and making corresponding selections based on the goat SNP molecular markers: in the successive breeding of breeding goats, individuals with the AT type and / or TT type at the 51st base of the SNP marker are selected, and individuals with the AA type are eliminated, so as to increase the frequency of the T gene at this locus in each generation, thereby improving the lambing performance of the offspring goats.

[0043] In the following embodiments, this invention resequencing the whole genome of 500 Dongbao Blackhead sheep, with 466 sheep having a low sequencing depth of 1× and 34 sheep having a high sequencing depth of 15×, aims to fill in the genotypes of the low sequencing results (which are more numerous) with the high-depth sequencing results (which are fewer), thereby reducing sequencing costs. Then, the resequencing data was aligned to the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy was used to detect genetic variations and fill in the genotypes of all autosomes in the 500 samples. SNP locus data were obtained to conduct a GWAS study related to the weight of goats at 12 months of age, ultimately identifying the YAP1 gene, which is related to goat reproduction. The SNP marker is located at nucleotide position 75,896,359 on chromosome 15 of the goat reference genome Capra hircus ARS1.2, and the base at this position is either A or T. Referring to Ensembl, the nucleotide sequences of the 50 bp upstream and downstream of this SNP site were obtained, and the nucleotide sequence of this fragment is shown in SEQ ID NO:1 (where T at position 51 is the nucleotide of the allelic mutation). GWAS analysis showed that g.75896359AT was significantly associated with the number of lambs born in goats, and individuals with the AT or TT genotype had significantly higher lambing numbers than AA individuals, indicating that T is an allelic gene that is beneficial for increasing lambing numbers. This molecular marker can be used to detect molecular markers related to lambing numbers in goats, and when the nucleotide at position 51 of the sequence shown in SEQ ID NO:1 is T, it is beneficial for goats to have higher lambing performance, which is of great significance for goat breeding and reproduction.

[0044] This invention combines low-depth resequencing with genotype imputation and utilizes GWAS analysis to screen for significant SNP molecular markers affecting goat litter size. These markers are then used in marker-assisted selection and genomic selection to select genotypes favorable for increasing goat litter size for breeding. This progressively increases the gene frequency of dominant alleles, accelerating the breeding improvement process and bringing significant economic benefits to goat farming. This invention verifies the impact of these SNP molecular markers on goat litter performance and demonstrates their applicability in genetic improvement of breeding goats to increase average litter size, thereby enhancing offspring litter performance and increasing the market competitiveness of goat farming enterprises.

[0045] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0046] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0047] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0048] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0049] Example 1

[0050] This embodiment provides a whole-genome resequencing method, as detailed below:

[0051] 1. Blood sample collection and white blood cell separation.

[0052] A 5 mL blood sample was collected from the goat's jugular vein using a veterinary lancet and placed in an EDTA anticoagulant tube. The anticoagulant tube was then placed in an ice box filled with ice packs and brought back to the laboratory. These samples were stored at 4°C for leukocyte extraction, following the specific steps below:

[0053] (1) Take 2-3 mL of blood sample into a 10 mL EP tube.

[0054] (2) Add ultrapure water to EP to make the total liquid volume 9 mL.

[0055] (3) Slowly invert the EP tube up and down 20 times and let it stand for 10 minutes.

[0056] (4) Place the EP tube into a centrifuge and centrifuge at 5000 rpm for 10 min.

[0057] (5) Slowly pour out the supernatant from the EP tube.

[0058] (6) Add ultrapure water again to make the total liquid volume 9 mL.

[0059] (7) Repeat steps (3), (4), and (5).

[0060] (8) After the separated white blood cells are numbered, they are placed in a -80℃ freezer.

[0061] 2. Genomic DNA extraction and whole-genome resequencing.

[0062] DNA extraction from leukocytes was performed using the Tianmo Biotechnology Genomic DNA Mini-Extraction Kit (catalog number: d3024), following the instructions. The qualified genomic DNA was sent to Beijing Novogene Technology Co., Ltd. for secondary quality control and library construction, and then subjected to PE150 whole-genome resequencing on the BGI platform. Raw data was obtained in FASTQ format. High-depth whole-genome resequencing was performed on 34 samples, with an average sequencing depth of approximately 19.72×, and a total data size of 1.4T; low-depth whole-genome resequencing was performed on 466 samples, with an average sequencing depth of approximately 1.65×, and a total data size of 1.6T.

[0063] Example 2

[0064] This embodiment provides a method for genome alignment, genetic variation detection, and genotype imputation, as detailed below:

[0065] 1. Analysis of raw sequencing data and genome alignment.

[0066] High-depth sequencing data and low-depth sequencing data are subjected to the same quality control process.

[0067] (1) The raw data was filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value below 20 exceeding 30% were removed; reads with n bases greater than 5% were removed. After the above quality control steps, clean reads were obtained.

[0068] (2) Use BWA software to align cleanreads to the goat reference genome (Capra_hircus.ARS1.2).

[0069] (3) Use Samtools software to sort the compared BAM files.

[0070] (4) Use Picard to mark repeated reads.

[0071] (5) Use Samtools software to build indexes.

[0072] 2. Detection of variant sites and genotyping.

[0073] (1) GATKHaploytypeCaller generates gvcf files for each sample according to the autosomal number.

[0074] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0075] (3) GATKGenotypeGVCFs were used for population SNP calling based on chromosomes.

[0076] (4) GATKMergeVcfs merges the vcf files of autosomal populations.

[0077] (5) GATKSelectVariants filters SNPs in vcf files of a population.

[0078] (6) GATK Variant Filtration is used to mark false positive SNP sites.

[0079] (7) The grep command filters tagged SNP sites.

[0080] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0081] (9) Beagle software fills in the missing sites.

[0082] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and genotype population genomic genetic variations.

[0083] (11) Using Beagle for genotyping, 26,131,221 high-quality SNPs were obtained.

[0084] Example 3

[0085] This embodiment demonstrates the application of the rs669481944 molecular marker genotyping method in association analysis of goat litter size, as detailed below:

[0086] Association analysis between the rs669481944 molecular marker and goat birth rate.

[0087] (1) The phenotypes used for the association analysis between genotype and number of lambs were measured by professional technicians in strict accordance with the measurement specifications. The age of the sheep was 360±15 days. The live weight of the sheep was measured after fasting for 12-16 hours and fasting for 2 hours. The weight was expressed in kilograms (kg). A total of 500 samples were collected.

[0088] (2) GWAS analysis of SNP loci and average number of lambs was performed using the FarmCPU model with rMVP software.

[0089] The FarmCPU model uses both fixed-effects and random-effects models for iteration. The fixed-effects analysis model is as follows:

[0090] y = Xb + Z t u t +S i d i +e

[0091] In the formula, y is the observer vector of the trait; b is the individual fixed effects vector, including the first three principal components of the SNP, birth season, parity, and birth weight; u t The nucleotide genotype matrix of t pseudo-quantitative traits is used as a fixed effect; X and Z t They are b and u respectively t The correlation matrix; S i It is the i-th SNP marker, d i This represents the corresponding effect value; e is the random residual effect vector, which follows a normal distribution e ~ N(0, Iσ). e 2 ).

[0092] GWAS analysis showed that rs669481944 was significantly associated with the number of lambs born in goats. The effects of different genotypes of this marker on the number of lambs born in goats are shown in Table 1.

[0093] Table 1. Effects of different rs669481944 genotypes on lambing number in goats.

[0094]

[0095] Note: A marker is considered significant when its p-value is less than 1E-05 (Bonferroni correction).

[0096] As shown in Table 1, for the average number of lambs produced in Chubao black-headed sheep, individuals with genotypes AT or TT had a significantly higher average number of lambs produced than individuals with AA genotypes, indicating that T is an allele that is beneficial for increasing the number of lambs produced.

[0097] Finally, it should be noted that the above embodiments are merely preferred embodiments of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a substance for detecting goat SNP molecular markers in identifying or predicting the average number of lambs per litter in Chubao black-headed sheep, said substance comprising PCR primers for amplifying genomic DNA fragments including the SNP molecular markers or a kit containing said primers; said SNP molecular markers are located at the 51st bp of the nucleotide sequence shown in SEQ ID NO.1, with a polymorphism of A / T; the average number of lambs per litter in black-headed sheep with the AT genotype is significantly higher than that of sheep with the AA genotype.

2. A method for detecting reproductive traits in goats, characterized in that, include: Genotyping of the Chubao blackhead sheep was performed using primers with the amplified sequence SEQ ID NO:

1. The N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of the Chubao blackhead sheep was determined to be either A or T. The average number of lambs born to the AT genotype blackhead sheep was significantly higher than that of the AA genotype.

Images