Application of cannabidiol in preparation of medicine for treating coronavirus infection

Abstract

The invention relates to application of cannabidiol in preparation of a medicine for treating coronavirus infection. In particular to application of cannabidiol, or geometric isomers, pharmaceutically acceptable salts, solvates or hydrates of cannabidiol, or a pharmaceutical composition containing any one or more of the components in preparation of drugs for preventing and / or treating diseases or infections caused by coronavirus.

Description

[0001] This application is a divisional application of the Chinese Invention Patent Application No. 202010722697.9, filed on July 24, 2020, with the title of “Use of Cannabidiol in the Preparation of a Drug for Treating Coronavirus Infection”. TECHNICAL FIELD

[0002] The present application belongs to the field of chemical drugs, and particularly relates to the use of cannabidiol (structure as shown in formula I), geometric isomers, pharmaceutically acceptable salts, solvates or hydrates thereof, or pharmaceutical compositions thereof in the preparation of a drug for treating coronavirus, especially the disease or infection caused by SARS-CoV-2.

[0003] BACKGROUND

[0004] Coronavirus is an enveloped, non-segmented, single-stranded RNA virus with a wide range of animal hosts. SARS coronavirus and MERS coronavirus derived from animal infectious diseases can cause human death. On February 11, 2020, the International Committee on Taxonomy of Viruses (ICTV) named a new type of coronavirus-severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). At present, for the new coronavirus infection, the clinical treatment is mainly supportive treatment, and there is no specific antiviral drug available.

[0005] Cannabidiol (compound of formula I), with the chemical name of (-)-2-[(3R,4R)-p-menthene-3β-yl]-5-pentylresorcinol, is a cannabinoid compound with multiple biological activities. The drug has a significant therapeutic effect on epilepsy symptoms. The antiepileptic drug Epidiolex containing cannabidiol as the effective ingredient has been marketed in the United States.

[0006] Cannabidiol was first isolated from cannabis in 1940, and is a non-psychoactive component without hallucinogenic effect and physiological dependence. In recent years, due to its wide biological effects, cannabidiol has attracted more and more attention and attention from the international community. Cannabidiol has multiple pharmacological activities, and has certain therapeutic effect on neurological diseases including anxiety, schizophrenia, addiction, neurodegenerative diseases, etc. In addition, cannabidiol also has anti-epilepsy, anti-convulsion, anti-tumor, anti-spasm, anti-emesis, anti-diabetes, and liver protection, etc. The drug, cosmetics, health products, etc. products with cannabidiol as the main active ingredient have been marketed abroad, and have broad application prospects.

[0007] Currently, research on the antiviral activity of cannabidiol and its treatment of viral diseases has not been fully carried out. Summary of the Invention

[0008] One purpose of the present invention is to find drugs that have inhibitory activity against coronaviruses, especially SARS-CoV-2, for the treatment of related diseases or infections caused by them, such as simple infections (such as fever, cough and sore throat, etc.), pneumonia, acute or severe acute respiratory tract infections, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis or septic shock, etc. Studies have shown that cannabidiol can significantly reduce the viral nucleic acid load of cells infected with SARS-CoV-2 and has the function of inhibiting the replication of SARS-CoV-2. In some experiments, cannabidiol had an inhibitory effect on the EC of SARS-CoV-2 in Vero E6 cells. 50 0.62μM, CC 50 The pH value was 4.10 μM and the SI was 6.61, indicating that it is very beneficial for treating diseases or infections caused by SARS-CoV-2.

[0009] Therefore, in a first aspect, the present invention provides a compound represented by Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing ingredients, for use in the preparation of a medicament for preventing and / or treating a disease or infection caused by a coronavirus.

[0010]

[0011] In a second aspect, the present invention provides a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing ingredients, for use in preventing and / or treating diseases or infections caused by coronaviruses.

[0012]

[0013] In a third aspect, the present invention provides a method for preventing and / or treating a disease or infection caused by a coronavirus, comprising administering to a subject in need thereof an effective amount of a compound of Formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or a pharmaceutical composition containing any one or more of the foregoing ingredients.

[0014]

[0015] In a fourth aspect, the present invention provides a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing ingredients, for use in preparing a medicament for preventing and / or treating respiratory diseases.

[0016]

[0017] In a fifth aspect, the present application provides use of a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing, for the manufacture of a coronavirus inhibitor,

[0018]

[0019] In a sixth aspect, the present application provides a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing, for use in inhibiting a coronavirus,

[0020]

[0021] In a seventh aspect, the present application provides a method of inhibiting a coronavirus, comprising the step of administering to a cell or a subject in need thereof an effective amount of a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing,

[0022]

[0023] In an eighth aspect, the present application provides use of a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing, for the manufacture of a medicament for inhibiting replication and / or propagation of a coronavirus in a cell,

[0024]

[0025] In a ninth aspect, the present application provides a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing, for use in inhibiting replication and / or propagation of a coronavirus in a cell,

[0026]

[0027] In a tenth aspect, the present application provides a method of inhibiting replication and / or propagation of a coronavirus in a cell, comprising the step of contacting the cell with an effective amount of a compound of Formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing,

[0028]

[0029] Clinical studies have found that the symptoms of SARS-CoV-2 infection are mainly pneumonia, and can be divided into simple infection, mild pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, septic shock, etc. according to the severity of the disease. Patients with simple infection may have non-specific symptoms such as fever, cough, sore throat, nasal congestion, fatigue, headache, muscle pain or discomfort, and elderly and immunosuppressed people may have atypical symptoms. Patients with mild pneumonia are mainly cough, dyspnea and tachypnea. Severe pneumonia can be seen in adolescents, adults or children, and the main symptoms are increased respiratory rate, severe respiratory failure or dyspnea, central cyanosis, lethargy, unconsciousness or convulsions, and gasp. The lung image of acute respiratory distress syndrome is bilateral ground-glass shadow, but it cannot be completely explained by effusion, lobar exudation or atelectasis or lung mass shadow, and the main symptom is pulmonary edema. Patients with sepsis often have fatal organ dysfunction, and septic shock is the most critical patient with a higher mortality rate.

[0030] In some embodiments, the disease or infection of any aspect of the present application is a respiratory disease or infection.

[0031] In some embodiments, the disease or infection of any aspect of the present application is simple infection, pneumonia, acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock or severe acute respiratory syndrome (SARS). In some embodiments, the simple infection is fever, cough or sore throat, etc.

[0032] In some embodiments, the respiratory disease or infection of any aspect of the present application is selected from simple infection, pneumonia, acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock and severe acute respiratory syndrome. In some embodiments, the simple infection is fever, cough or sore throat, etc.

[0033] In some embodiments, the disease or infection of any aspect of the present application is COVID-19.

[0034] In some embodiments, the cell of any aspect of the present application is a mammalian cell. In some embodiments, the mammal is selected from the group consisting of bovine, equine, ovine, porcine, canine, feline, rodent and primate. In some embodiments, the mammal is human, cat, pig or dog. In some embodiments, the mammal is human.

[0035] In some embodiments, the coronavirus according to any aspect of the application is selected from the group consisting of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV and SARS-CoV-2.

[0036] In some embodiments, the coronavirus according to any aspect of the application is SARS-CoV-2.

[0037] The compound of formula I, or a geometric isomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof, in the pharmaceutical composition according to the present application is the only pharmaceutically active ingredient.

[0038] The pharmaceutical composition according to the present application further contains other antivirally active ingredients.

[0039] In some embodiments, the compound of formula I, or a geometric isomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof, or the pharmaceutical composition is combined with other antivirally active ingredients. In some embodiments, the compound of formula I, or a geometric isomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof, and the other antivirally active ingredients are in the same formulation unit.

[0040] In some embodiments, the compound of formula I, or a geometric isomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof, and the other antivirally active ingredients are in different formulation units.

[0041] In some embodiments, the compound of formula I, or a geometric isomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof, and the other antivirally active ingredients are administered simultaneously, separately or sequentially.

[0042] In some embodiments, the other antivirally active ingredients are selected from one or more of the group consisting of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin and interferon.

[0043] The pharmaceutical composition described in the present application can further contain a pharmaceutically acceptable carrier or excipient. The carrier refers to a substance used to improve the selectivity, effectiveness and / or safety of a drug during delivery. It is mainly used to control drug release and can also be used to improve the pharmacokinetic properties of a drug, particularly bioavailability. The excipient refers to other substances in addition to the active ingredient in a pharmaceutical preparation, which is mainly used for long-term stability, filling of solid preparations (therefore, it is often used to specifically refer to "fillers") or to enhance the therapeutic effect of the product (e.g., to promote absorption, reduce viscosity or increase solubility, etc.). Depending on the route of administration or the form of administration, the skilled person can select appropriate carriers and excipients based on known theories and experience.

[0044] The pharmaceutical composition described in the present application can be prepared in various forms according to different administration routes.

[0045] According to the present application, the pharmaceutical composition can be administered in any of the following ways: orally, spray inhalation, rectally, nasally, buccally, vaginally, topically, parenterally such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal and intracranial injection or infusion, or by means of an external implant reservoir. Of these, oral, intraperitoneal or intravenous administration is preferred.

[0046] When administered orally, the compound of formula I, or its geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, can be prepared into any orally acceptable preparation form, including but not limited to tablets, capsules, aqueous solutions or aqueous suspensions. Among them, the carriers commonly used in tablets include lactose and corn starch, and lubricants such as magnesium stearate can also be added. The diluents commonly used in capsule preparations include lactose and dry corn starch. The aqueous suspension preparation is usually a mixture of the active ingredient with a suitable emulsifying agent and suspending agent. If necessary, some sweeteners, aromatics or colorants can also be added to the above oral preparation forms.

[0047] When administered rectally, the compound of formula I, or its geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, can generally be prepared into the form of suppositories by mixing the drug with a suitable non-irritating excipient. The excipient is in a solid state at room temperature and melts to release the drug at rectal temperature. Such excipients include cocoa butter, beeswax and polyethylene glycol.

[0048] When administered topically, particularly for the treatment of local external application of easily accessible affected areas or organs such as eyes, skin or lower intestinal nervous diseases, the compound of formula I, or its geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, can be prepared into different topical administration preparation forms according to different affected areas or organs, as described below:

[0049] When administered topically to the eye, the compound of Formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can be formulated as a micronized suspension or solution using an isotonic, sterile saline solution at a specific pH, with or without a preservative such as benzyl chloride. Furthermore, for ophthalmic use, the compound can be formulated into an ointment such as vaseline.

[0050] When applied topically to the skin, the compound of Formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates, can be formulated into an appropriate ointment, lotion, or cream formulation, wherein the active ingredient is suspended or dissolved in one or more carriers. Carriers useful for ointments include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax, and water; carriers useful for lotions or creams include, but are not limited to, mineral oil, sorbitan monostearate, Tween 60, cetyl esters wax, hexadecene alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0051] When administered topically to the lower intestine, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates can be prepared in the form of rectal suppositories or suitable enema preparations as described above. In addition, topical transdermal patches can also be used.

[0052] The compound of Formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates, or hydrates can also be administered in the form of sterile injectable preparations, including sterile water for injection or oil suspensions, or sterile injectable solutions. Among them, usable carriers and solvents include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterilized, non-volatile oils, such as monoglycerides or diglycerides, can also be used as solvents or suspending media.

[0053] The above-mentioned various dosage forms of the drugs can be prepared according to conventional methods in the pharmaceutical field.

[0054] In some embodiments, the pharmaceutical composition is a solid preparation or a liquid preparation. In some embodiments, the pharmaceutical composition is a tablet, an injection or a spray. In some embodiments, the pharmaceutical composition is an injection.

[0055] Throughout this application, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the laboratory procedures for cell culture, molecular genetics, nucleic acid chemistry, and immunology used herein are conventional procedures widely used in the relevant fields. To facilitate a better understanding of this disclosure, definitions and explanations of relevant terms are provided below.

[0056] As used herein, the term "pharmaceutically acceptable salt" includes inorganic or organic acid salts, and inorganic or organic base salts of the compounds of Formula I, such as sodium salts, potassium salts, calcium salts, lithium salts, meglumine salts, hydrochloride salts, hydrobromide salts, hydroiodide salts, nitrate salts, sulfate salts, bisulfate salts, phosphate salts, hydrogen phosphate salts, acetate salts, propionate salts, butyrate salts, oxalate salts, malonate salts, adipate salts, alginate salts, lactate salts, citrate salts, tartrate salts, succinate salts, maleate salts, fumarate salts, picrate salts, aspartate salts, gluconate salts, benzoate salts, methanesulfonate salts, ethanesulfonate salts, benzenesulfonate salts, p-toluenesulfonate salts, or pamoate salts, and the like.

[0057] As used herein, the term "geometric isomer" refers to stereoisomers that exist due to hindered rotation of atoms or groups of atoms in a molecule with a double bond or a ring, resulting in different spatial arrangements, such as cis / trans isomers.

[0058] The compounds of Formula I described herein can exist in the form of solvates (preferably hydrates) that contain a polar solvent, particularly water, methanol or ethanol, as a structural element of the crystal lattice of the compound. The amount of polar solvent, particularly water, can be present in stoichiometric or non-stoichiometric amounts. It is understood that any solvate of a compound of Formula I used in the treatment of a disease or infection described herein, while possibly providing different properties, including pharmacokinetic properties, will yield a compound of Formula I once absorbed into a subject, such that use of a compound of Formula I encompasses use of any solvate of a compound of Formula I, respectively.

[0059] As used herein, SARS-CoV-2 refers to severe acute respiratory syndrome coronavirus 2, the disease caused by which is named COVID-19.

[0060] As used herein, the term "therapeutically effective amount" or "prophylactically effective amount" refers to an amount that, within the scope of sound medical judgment, is sufficient to treat or prevent a disease in a patient but low enough to avoid serious side effects (at a reasonable benefit / risk ratio). The therapeutically effective amount of a compound will vary depending on the particular compound chosen (e.g., taking into account potency, efficacy, and half-life of the compound), the chosen route of administration, the disease being treated, the severity of the disease being treated, the age, size, body weight, and physical condition of the patient being treated, the medical history of the patient being treated, the duration of treatment, the nature of concurrent therapy, the desired therapeutic effect, and like factors, but can be routinely determined by one of skill in the art.

[0061] It is to be further understood that the specific dosage and treatment regimen for a given patient depends upon a variety of factors, including the age, body weight, general health, nutritional status, sex, active strength of the drug, time of administration, rate of metabolism, severity of the condition and the judgment of the attending physician. The preferred dosage is in the range of 0.001-1000 mg / kg body weight / day. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 The effect of cannabidiol on viral nucleic acid load on SARS-CoV-2 infected vero E6 cells is shown; cannabidiol was able to inhibit viral RNA load on cells after 48h of infection of cells with SARS-CoV-2, and the inhibitory activity was dose-dependent. The left vertical axis is the percentage inhibition calculated from the copy number of viral RNA in the sample (corresponding to the circles and their fitted line in the figure), and the right vertical axis is the percentage toxicity calculated from cell viability (corresponding to the squares and their fitted line in the figure), and the horizontal axis is the drug concentration. DETAILED DESCRIPTION

[0063] The application will be further described in conjunction with specific examples. It should be understood that the following examples are intended to illustrate the application and are not intended to limit the scope of the application. In the following examples, the specific conditions are not specified, and the conventional conditions or according to the manufacturer's recommendations are used. The drugs or reagents used are not specified by the manufacturer, and are all conventional products that can be purchased on the market.

[0064] Example 1: Cannabidiol reduces viral nucleic acid load in SARS-CoV-2 infected cells

[0065] (1) Drug treatment of virus-infected cells

[0066] Vero E6 cells (purchased from ATCC, item number 1586) were seeded into 24-well plates and cultured for 24h, and then infected with virus. Specifically, the SARS-CoV-2 virus was diluted to the corresponding concentration with 2% cell maintenance solution (formula: FBS (purchased from Gibco, item number 16000044) was added to MEM (purchased from Gibco, item number 10370021) at a volume ratio of 2%, which was 2% cell maintenance solution), and then added to the 24-well plate so that each well contained 100 TCID 50Next, the cannabidiol (purchased from Selleck Chemicals, item number S7975) was diluted to the corresponding concentration with 2% cell maintenance solution, and added to the corresponding wells, so that the final concentration of the drug was 100 μM, 33 μM, 11 μM, 3.7 μM, 1.23 μM, 0.41 μM, 0.14 μM, respectively. Then, the cells were incubated at 37°C in a 5% CO2 incubator for 48 hours. The cell control group was only added with 2% cell maintenance solution without any test drug.

[0067] (2) RNA extraction

[0068] The RNA extraction kit was purchased from Qiagen Company, item number 74106. The consumables (centrifugal column, 2ml RNAase-free collection tube, etc.) and reagents (RLT, RW1, RPE, RNAase-free water, etc.) involved in the following RNA extraction steps were all components of the kit. The following extraction steps were recommended by the kit instructions.

[0069] 1) Take 100 μL of the supernatant of the test culture plate and add it to a nuclease-free EP tube. Then add 350 μL of Buffer RLT to each well, mix well by blowing and sucking with a pipette gun, and centrifuge to take the supernatant;

[0070] 2) Add an equal volume of 70% ethanol to the supernatant obtained in 1), and mix well;

[0071] 3) Transfer the mixture obtained in 2) to a RNAase-free centrifugal column, centrifuge at 12000 rpm for 15s, and discard the waste liquid;

[0072] 4) Add 700 μL of Buffer RW1, centrifuge the centrifugal column at 12000 rpm for 15s, and discard the waste liquid;

[0073] 5) Add 500 μL of Buffer RPE, centrifuge the centrifugal column at 12000 rpm for 15s, and discard the waste liquid;

[0074] 6) Add 500 μL of Buffer RPE, centrifuge the centrifugal column at 12000 rpm for 2min, and discard the waste liquid;

[0075] 7) Replace the RNAase-free 2ml collection tube, centrifuge at 12000 rpm for 1min, dry the centrifugal column, and then transfer the whole centrifugal column to the 1.5ml collection tube of step 8);

[0076] 8) Replace the new 1.5ml collection tube, put the dried centrifugal column in step 7) into the centrifugal column, and add 30μl of RNAase-free water to the centrifugal column, centrifuge at 12000rpm for 2min, and the eluate contains the corresponding RNA. Add RNAase inhibitor (purchased from NEB company, catalog number M0314L), and detect the concentration of each RNA with Nano Drop (purchased from Thermo scientific, model Nano Drop One).

[0077] (3) RNA reverse transcription

[0078] The experiment uses the reverse transcription kit produced by Takara company (PrimeScript TM RT reagent Kit withgDNA Eraser, catalog number RR047Q) for RNA reverse transcription, as follows.

[0079] ① gDNA removal: collect the RNA samples of each experimental group, and take 1μg for reverse transcription. First, add 2μl 5×gDNA Eraser Buffer to each experimental group of RNA, and add RNase Free water to make up the reaction system to 10μl, mix well, and remove the gDNA that may exist in the sample at 42℃ water bath for 2min;

[0080] ② Reverse transcription: add appropriate amount of enzyme and primer Mix and reaction buffer to the sample obtained in ①, and add RNase Free water to make up the volume to 20μl, react at 37℃ water bath for 15min, and then put into 85℃ water for 5 seconds, and the cDNA can be transcribed.

[0081] (4) Real-time PCR

[0082] The fluorescent quantitative PCR is used to detect the copy number per milliliter of the original virus liquid.

[0083] The reaction system is mixed with TB Green Premix (Takara, Cat#RR820A), and the amplification reaction and reading are carried out on StepOne Plus Real-time PCR instrument (brand: ABI). The copy number per milliliter of the original virus liquid is calculated. The steps are as follows:

[0084] ① First, establish the standard: dilute the plasmid pMT-RBD to 5×10 8 copies / μL, 5×10 7 copies / μL, 5×10 6 copies / μL, 5×10 5 copies / μL, 5×10 4 copies / μL, 5×10 3copies / μL, 5 x 10 2 copies / μL. Take 2 μL of the standard or cDNA template for qPCR reaction.

[0085] The primer sequences used in the experiment are as follows (all are represented in the direction of 5'-3'):

[0086] RBD-qF: CAATGGTTTAACAGGCACAGG

[0087] RBD-qR: CTCAAGTGTCTGTGGATCACG

[0088] The reaction program is as follows:

[0089] Pre-denaturation: 95°C for 5 minutes;

[0090] Cycle parameters: 95°C for 15 seconds, 54°C for 15 seconds, 72°C for 30 seconds, for a total of 40 cycles.

[0091] (5) Drug cytotoxicity test

[0092] The detection of drug cytotoxicity uses CCK-8 kit (Beoytime). The specific steps are as follows:

[0093] ① 1 x 10 4 Vero E6 (ATCC) cells were inoculated in 96-well plates and cultured at 37°C for 8 hours.

[0094] ② The drug was diluted with DMSO to the appropriate stock concentration, and then diluted with MEM medium (purchased from Gibco Company, item number 10370021) containing 2% FBS (purchased from Gibco Company, item number 16000044) to the same concentration as drug treatment. The original culture medium in the 96-well plate was discarded, and 100 μL of MEM medium containing the drug was added to the cells, with three replicate wells for each concentration. Note to set negative control (Vehicle group, add DMSO and medium to the cell well without adding drug) and blank control (without cells, add DMSO and medium). After adding the drug, the cells were cultured at 37°C for 48 hours.

[0095] ③ Add 20 μL of CCK-8 solution (Beoytime) to the test well, mix gently without generating bubbles, and continue to culture at 37°C for 2 hours. Read OD 450 on the enzyme marker (purchased from Molecular Devices Company, model SpectraMax M5), and calculate the cell activity:

[0096] Cell viability (%) = (A (药物处理组) -A (空白对照) ) / (A (阴性对照) -A(空白对照) ) x 100% where A is the plate reader reading.

[0097] (6) Experimental Results

[0098] The results of the viral propagation inhibition experiment showed that the test compound (cannabidiol) was able to effectively inhibit the replication of SARS-CoV-2 viral genome in the infected supernatant at concentrations of 10 mM, 3.3 mM, 1.1 mM and 0.37 mM (Table 1 and Figure 1 )

[0099] Table 1. Antiviral experiment of the test compound (cannabidiol)

[0100]

[0101] The results of the cytotoxicity experiment showed that the treatment of the test compound (cannabidiol) at concentrations of 1.56 mM and 0.78 mM did not change the cell viability, i.e. the test compound did not have significant toxic effects on the cells at all concentrations (Table 2 and Figure 1 ).

[0102] Table 2. Cytotoxicity experiment of the test compound (cannabidiol)

[0103] Concentration (μΜ) Cell viability (%) 100 8.87±3.59 50 22.85±18.47 25 38.39±5.70 12.5 50.01±8.40 6.25 60.07±6.01 3.13 58.45±5.30 1.56 74.22±13.42 0.78 73.45±7.48 Vehicle 100±3.21

[0104] While the specific embodiments of the application have been described in detail, those skilled in the art will appreciate that various modifications and substitutions can be made of those details without departing from the spirit of the application as disclosed above. The scope of the application is defined by the appended claims and any equivalents thereto.

Claims

1. Use of a compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or a pharmaceutical composition containing any one or more of the foregoing ingredients in the preparation of a medicament for preventing and / or treating a disease or infection caused by a coronavirus, 2. The method of claim 1, wherein the disease or infection is a respiratory disease or infection; Preferably, the disease or infection is a simple infection, pneumonia, acute or severe acute respiratory infection, hypoxic respiratory failure, acute respiratory distress syndrome, sepsis, septic shock or severe acute respiratory syndrome (SARS); preferably, the simple infection is fever, cough or sore throat.

3. The method of claim 1 or 2, wherein the disease or infection is COVID-19.

4. Use of a compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or a pharmaceutical composition containing any one or more of the foregoing ingredients in the preparation of a coronavirus inhibitor.

5. Use of a compound of formula I, or a geometric isomer, pharmaceutically acceptable salt, solvate or hydrate thereof, or a pharmaceutical composition containing any one or more of the foregoing ingredients, in the preparation of a medicament for inhibiting the replication and / or reproduction of coronaviruses in cells, 6. The use of claim 5, wherein the cell is a mammalian cell; preferably, the mammal is selected from bovine, equine, ovine, porcine, canine, feline, rodent and primate; preferably, the mammal is human, cat, pig or dog; preferably, the mammal is human.

7. The use according to any one of claims 1 to 6, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient; Preferably, the pharmaceutical composition is a solid preparation or a liquid preparation; further preferably, the pharmaceutical composition is a tablet, an injection or a spray.

8. The use according to any one of claims 1 to 7, wherein the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, is the sole active pharmaceutical ingredient in the pharmaceutical composition; Preferably, the pharmaceutical composition further contains other antiviral active ingredients; Preferably, the compound of formula I, or its geometric isomers, pharmaceutically acceptable salts, solvates or hydrates, or pharmaceutical compositions are administered in combination with other antiviral active ingredients (e.g., simultaneously, separately or sequentially); Preferably, the other antiviral active ingredients are selected from one or more of amantadine, rimantadine, enfuvirtide, maraviroc, acyclovir, ganciclovir, valacyclovir, famciclovir, foscarnet, lamivudine, zidovudine, emtricitabine, tenofovir, adefovir dipivoxil, efavirenz, nevirapine, saquinavir, oseltamivir, zanamivir, ribavirin and interferon.

9. The method of any one of claims 1 to 8, wherein the coronavirus is selected from the group consisting of HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, MERS-CoV, and SARS-CoV-2.

10. The method of any one of claims 1 to 9, wherein the coronavirus is SARS-CoV-2.

Images