Application of Degrasynn (WP1130) as PTBP1 degradation agent in preparation of DMD treatment medicine

Abstract

The invention discloses an application of Degrasynn (WP1130) as a PTBP1 degradation agent in preparation of DMD treatment drugs, and belongs to the technical field of biological medicines. According to the application, a B10-DMD-KO model mouse experiment proves that PTBP1 plays a key regulation role in DMD skeletal muscle regeneration for the first time, and Degrasynn (WP1130) can effectively degrade PTBP1 protein and remarkably improve muscle aplastic disorder. Based on the discovery, the invention provides a pharmaceutical composition taking Degrasynn (WP1130) as an active component, a collaborative treatment scheme of Degrasynn (WP1130) and a PTBP1 gene silencing agent, and a matched PTBP1 expression detection kit. The action mechanism of the PTBP1 regulatory pathway in DMD treatment is disclosed in a breakthrough mode, and compared with a traditional therapy, the PTBP1 regulatory pathway has the remarkable advantages of being accurate in targeting and low in toxic and side effect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of Degrasyn (WP1130) as a PTBP1 degrader in preparation of a drug for treating Duchenne muscular dystrophy (DMD). BACKGROUND

[0002] Duchenne muscular dystrophy (DMD) is an X-linked genetic disease caused by a deficiency in the dystrophin gene. Dystrophin mainly connects the cytoskeleton and extracellular matrix, thereby maintaining the stability of the muscle cell membrane. The absence of this protein leads to the destruction of the stability of the muscle cell membrane. Patients (mostly male) develop muscle weakness at the age of 3-5, progressive paralysis and loss of walking function in adolescence, and often die early due to cardiac dysfunction. Current treatments are divided into two categories: etiological and symptomatic. Etiological treatment (aiming at the cause: repairing / compensating for dystrophin deficiency) mainly uses gene therapy, which has four main strategies: 1) exon skipping therapy, which uses antisense oligonucleotide (ASO) drugs such as Eteplirsen (targeting exon 51), Golodirsen (exon 53), and Casimersen (exon 45) to skip the mutant exon and restore partial protein expression; 2) stop codon read-through therapy, which uses Ataluren to enable ribosomes to skip nonsense mutations, suitable for about 10% of patients; 3) gene replacement therapy, which uses adeno-associated virus (AAV) vectors to deliver a mini-dystrophin gene (such as Elevidys approved in 2023); and 4) CRISPR-Cas9 gene editing technology (such as EDIT-101) is in the clinical trial stage.

[0003] As a genetic disease, gene therapy is the most promising direction for treating DMD. However, due to the large structure of the DMD gene and the complexity of the mutation types, current gene therapy still faces many limitations: existing drugs (such as exon skipping therapy) are only effective for specific mutation types, with limited applicability to patient groups; high treatment costs significantly reduce the popularity; in addition, gene editing technology is not yet mature, resulting in a slow overall research and development process. These factors together constrain the breakthrough progress of gene therapy, making it still difficult to become a universally applicable solution at this stage.

[0004] Compared with gene therapy, symptomatic treatment adopts a multi-system comprehensive management strategy, which takes anti-inflammatory treatment as the core support, and cooperates with heart protection (ACE inhibitor combined with beta receptor blocker to delay myocardial lesions), respiratory support (night BiPAP and expectoration assistance), bone health management and rehabilitation training, etc. to form a three-dimensional intervention network covering the muscle, heart and lung, and skeleton systems. Although this comprehensive management mode cannot cure the disease, it can effectively delay the degeneration of each system function and provide more comprehensive clinical support for patients. In terms of anti-inflammatory treatment, traditional glucocorticoid drugs (prednisone, deflazacort) can delay muscle degradation, but their long-term use can cause significant side effects such as glucose and lipid metabolism disorders, osteoporosis, and immune function suppression, and patients often have to weigh between disease control and drug toxicity. Although the new drug Vamorolone shows better safety through anti-inflammatory and inhibition of muscle fibrosis, its mechanism is still limited to delaying disease progression, and it cannot correct the genetic defect of dystrophin or achieve muscle fiber regeneration, and it is essentially still a symptomatic treatment rather than a radical solution.

[0005] In recent years, the failure of multiple DMD candidate drug development highlights the limitations of current treatment strategies: Pfizer's gene therapy PF-06939926 (mobedaqi) was discontinued in phase III study due to insufficient improvement in 6-minute walking distance and risk of antibody reaction; SPK-9001 (Spark Therapeutics) requires immunosuppressive therapy due to the risk of liver toxicity; CAP-1002 (Capricor) can improve myocardial function, but is limited by the survival problem of cardiac stem cells in skeletal muscle. These cases collectively reveal the fundamental defects of existing therapies in addressing the core pathology of DMD - skeletal muscle regeneration disorder, which is the key direction for breakthroughs at this stage.

[0006] PTBP1 (polypyrimidine tract binding protein 1) is a polypyrimidine tract binding protein 1, which belongs to RNA binding protein and plays an important role in mRNA metabolism regulation. Studies have shown that this protein not only participates in the whole process of neuronal development (including neurogenesis, synapse formation and differentiation), but also widely regulates physiological processes such as T cell activation, germ cell development and hematopoietic system differentiation. Notably, PTBP1 has an important regulatory function in the myogenic differentiation of muscle satellite cells, which provides a theoretical basis for promoting myoblast differentiation and improving DMD pathological process by targeting PTBP1. However, there is no related research report on using PTBP1 regulation mechanism to treat DMD. And although PTBP1 has a clear role in myogenesis, there is still a lack of small molecule inhibitors targeting this site.

[0007] Degrasyn (WP1130) as a multifunctional small molecule compound has shown a wide range of biological activities: not only has antibacterial effect on multi-drug resistant Staphylococcus aureus, but also has potential anti-hepatoma effect by inhibiting target points such as USP5, USP9x and Bcr-abl; its immunomodulatory function is reflected in enhancing the defense ability of macrophages and inhibiting pathogen replication; in the field of tumor treatment, it shows anti-tumor activity on non-small cell lung cancer, breast cancer and bladder cancer; and it is further confirmed that it can effectively relieve synovitis and cartilage damage in the osteoarthritis model.

[0008] Notably, although PTBP1 has been identified as a key regulator of myogenic differentiation, and there is currently a lack of specific small molecule inhibitors thereof, and Degrasyn has not been studied in the field of DMD treatment and skeletal muscle regeneration. This situation highlights the importance of exploring Degrasyn as a PTBP1 degrader for the treatment of Duchenne muscular dystrophy, and provides a possible direction for the development of new DMD treatment drugs. SUMMARY

[0009] In view of the key problems in the current DMD treatment field, the present application innovatively proposes a new treatment strategy for improving muscle regeneration disorders caused by Duchenne muscular dystrophy (DMD) by using Degrasyn (WP1130) to regulate PTBP1 protein degradation. Studies have found that PTBP1, as a key factor regulating myogenic differentiation, is closely related to the pathological process of DMD. Degrasyn significantly improves the differentiation disorder of myoblasts by specifically promoting the degradation of PTBP1 protein, providing a new compound selection for DMD treatment. Specifically, the present application first elucidates the key role of PTBP1 as a core regulator in the skeletal muscle regeneration disorder of DMD and innovatively confirms that the small molecule compound Degrasyn can effectively activate the proliferation and differentiation program of muscle satellite cells by specifically targeting the degradation of PTBP1 protein, laying an important foundation for the development of new DMD treatment drugs.

[0010] To achieve the above-mentioned purpose, the technical solutions adopted by the present application are as follows: The present application relates to an innovative drug development scheme for treating Duchenne muscular dystrophy, specifically comprising the following aspects:

[0011] 1. A core pharmaceutical composition is proposed: it needs to contain a therapeutically effective amount of Degrasyn (WP1130) as an active ingredient, which promotes muscle fiber regeneration by inhibiting the expression or activity of PTBP1 in skeletal muscle cells; the pharmaceutical composition can be prepared into injection, corrosion inhibitor or oral dosage form, etc.

[0012] 2. This application discloses for the first time the novel use of Degrasyn (WP1130) as a PTBP1 degrader in the preparation of a drug for the treatment of Duchenne muscular dystrophy, which is suitable for treating Duchenne muscular dystrophy or reducing the risk of Duchenne muscular dystrophy to achieve disease risk control. The drug must include a therapeutically effective amount of Degrasyn (WP1130) and pharmaceutically acceptable excipients, and the drug is an injectable preparation, a sustained-release preparation, or an oral preparation.

[0013] 3. Based on the discovery that PTBP1 plays a key regulatory role in DMD skeletal muscle regeneration, this application proposes a combined treatment plan: Degrasyn (WP1130) can be used in combination with PTBP1 gene silencers to achieve better disease treatment or control effects.

[0014] 4. This application proposes the development of a supporting DMD prognosis detection technology. The corresponding detection kit must contain a detection reagent for detecting PTBP1 expression levels for efficacy evaluation and prognosis monitoring.

[0015] 5. This application proposes to establish a DMD therapeutic drug screening model using PTBP1 expression inhibition as an indicator: potential drugs for the treatment of Duchenne muscular dystrophy are screened by detecting the inhibitory effect of candidate substances on PTBP1 expression or activity.

[0016] The beneficial effects of the present invention are:

[0017] 1. The technical solution provided by this invention has achieved a breakthrough in the treatment of Duchenne muscular dystrophy (DMD). Its innovation is reflected in the dual innovation of molecular mechanism and treatment paradigm. At the basic research level, it systematically elucidates for the first time the core role of PTBP1 protein in regulating skeletal muscle regeneration in the pathological process of DMD, providing a new target for the development of targeted therapeutic drugs. At the translational application level, it innovatively confirms that the small molecule compound Degrasyn (WP1130) can specifically degrade PTBP1 protein and exert its therapeutic effect by reconstructing the muscle fiber regeneration pathway. The new "PTBP1 degradation-muscle regeneration activation" treatment strategy established by this has fundamentally changed the limitation of existing DMD treatments that can only alleviate symptoms, and provides a theoretical basis and pharmaceutical foundation for the development of DMD targeted drugs with etiological therapeutic value.

[0018] 2. This invention demonstrates significant safety advantages through its innovative mechanism of targeted degradation of the PTBP1 protein. Compared to the systemic adverse reactions common with traditional hormone therapies, such as immunosuppression and metabolic disorders, this approach utilizes a therapeutic strategy that precisely regulates the expression levels of specific proteins, avoiding the nonspecific effects of hormone drugs on multiple organ systems throughout the body. This specific intervention approach, based on a molecular target, maintains the therapeutic effect while fundamentally avoiding the multiple side effects associated with the broad mechanisms of action of traditional therapies, providing patients with a safer long-term treatment option.

[0019] 3. The core raw material involved in this technical solution, the PTBP1 inhibitor Degrasyn (WP1130), has been put into industrial mass production. The synthesis process is stable and controllable, and the raw material supply chain is complete, which greatly reduces production costs. Its therapeutic mechanism can also be extended to other types of muscular dystrophy, showing broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a flowchart of the experiments for knocking down and overexpressing PTBP1 in mdx mouse myoblasts;

[0021] Figure 2 Figure 1 shows the effects of knocking down or overexpressing PTBP1 on the morphology and duration of suspension rods in wild-type and mdx mice. Figure 1 shows the changes in suspension rod morphology, and Figure 1 shows the effects on suspension rod duration.

[0022] Figure 3 Figure 1 shows the effects of knocking down or overexpressing PTBP1 on the gait of wild-type and mdx mice. Figure a shows the footprints, Figure b shows the step length statistics, and Figure c shows the step width statistics.

[0023] Figure 4 Figure 1 shows the effects of knockdown or overexpression of PTBP1 on the levels of related enzymes in the serum of wild-type and mdx mice. Figure a shows the effects on CK levels, and Figure b shows the effects on LDH levels.

[0024] Figure 5 is the effect of knockdown or overexpression of PTBP1 on the morphology of GAS, QF, TA, and DIA muscle fibers in wild-type mice;

[0025] Figure 6 is the effect of knockdown or overexpression of PTBP1 on the morphology of GAS, QF, TA, and DIA muscle fibers in mdx mice;

[0026] Figure 7 The results of the experiment using immunofluorescence staining to detect the effects of PTBP1 knockdown or overexpression on the regenerative capacity of gastrocnemius (GAS) skeletal muscle in mdx mice;

[0027] Figure 8 are the results of the experiment to detect the effect of PTBP1 knockdown or overexpression on the skeletal muscle regeneration capacity in the gastrocnemius muscle (GAS) of mdx mice by immunofluorescence staining;

[0028] Figure 9 are the effects of PTBP1 knockdown or overexpression on the expression levels of PTBP1, MyOD and MyOG in the gastrocnemius muscle (GAS) of wild type (WT) and mdx mice, wherein subgraph a is a representative banding chart of Western blot detection, subgraph b is the quantitative result of PTBP1 protein expression level, subgraph c is the quantitative result of MyoD protein expression level, and subgraph d is the quantitative result of MyoG protein expression level;

[0029] Figure 10 are the effects of Degrasyn (WP1130) on the suspension pole shape and suspension pole time of mdx mice, wherein subgraph a shows the change of suspension pole shape, and subgraph b is the effect on suspension pole time;

[0030] Figure 11 are the effects of Degrasyn (WP1130) on the gait of mdx mice, wherein subgraph a is a footprint chart, and subgraph b is a step length statistical chart;

[0031] Figure 12 are the effects of Degrasyn (WP1130) on the content of related enzymes in the serum of mdx mice, wherein subgraph a is the effect on CK content, and subgraph b is the effect on LDH content;

[0032] Figure 13 are the effects of Degrasyn (WP1130) on the muscle fiber morphology of GAS, QF, TA and DIA of mdx mice;

[0033] Figure 14 are the immunofluorescence staining results of eMyHC and MHC in the gastrocnemius muscle (GAS) tissue of mdx mice treated with Degrasyn (WP1130);

[0034] Figure 15 show the effects of Degrasyn (WP1130) on the expression of key proteins in the gastrocnemius muscle (GAS) of mdx mice, wherein subgraph a is a representative banding chart of Western blot detection of USP9X, PTBP1 and MyOG proteins, subgraph b is the quantitative analysis result of USP9X protein expression, subgraph c is the quantitative analysis result of PTBP1 protein expression, and subgraph d is the quantitative analysis result of MyoG protein expression. DETAILED DESCRIPTION

[0035] For those skilled in the art to better understand the technical solutions of the present application, the technical solutions of the present application are further described below in combination with the drawings and examples.

[0036] The experimental animal models used in the examples are B10-DMD-KO mice and C57BL / 10ScSnJ mice.

[0037] The C57BL / 10ScSnJ mice are normal wild-type mice.

[0038] The B10-DMD-KO male mouse model is caused by the deletion mutation of the 4th exon of the DMD gene, which results in the inability to synthesize functional dystrophin protein, which is essential for maintaining the connection between the cytoskeleton and the extracellular matrix. Compared with wild-type C57BL / 10ScSnJ mice, B10-DMD-KO mice exhibit typical Duchenne muscular dystrophy (DMD) pathological features: abnormal muscle fiber structure (enlargement, disordered arrangement), significantly weakened skeletal muscle tension, accompanied by persistent inflammatory cell infiltration, extensive fibrosis and muscle fiber necrosis. In addition, due to the loss of dystrophin, the integrity of the muscle fiber membrane is destroyed, and creatine kinase (CK) leaks out of the muscle cells, resulting in a significant increase in serum CK levels, which is highly consistent with the phenotype of human DMD patients.

[0039] Example 1

[0040] In this example, the knockdown and overexpression of the PTBP1 gene were performed on wild-type mice and mdx mouse models, respectively.

[0041] The present study adopts 5-week-old wild type (WT) and B10-DMD-KO (mdx) mice for the pharmacodynamic evaluation of PTBP1 gene knockdown and overexpression. Before the experiment, all mice are adaptively fed for 1 week and then randomly grouped according to body weight. Two groups are set up: wild type control group and mdx model group, and each group is further divided into three subgroups: AAV empty vector control group (control group), AAV-siPTBP1 knockdown group (PTBP1 specific knockdown, denoted as AAV-PTBP1 KD), and AAV-PTBP1 overexpression group (PTBP1 forced overexpression, denoted as AAV-PTBP1-OE), with 6 animals in each group. Adeno-associated virus (AAV) administration is performed by tail vein injection, which is performed as follows: after the AAV virus solution is thawed on ice, 100 μL of the virus solution is taken up using a 300 μL insulin syringe, the needle is inserted at a 30° angle at the distal 1 / 3 of the mouse tail vein, and after confirming the backflow of blood, the virus solution is slowly injected, and after the injection is completed, the iodophor cotton ball is pressed to stop bleeding. The AAV2 / 9 serotype vector is selected for the experiment, and the PTBP1 knockdown or overexpression sequence is driven by the MyOG promoter, which is a marker for the late proliferation and early differentiation of myoblasts, to construct a gene manipulation vector that can specifically target the PTBP1 of mouse myoblasts. The PTBP1 gene knockdown sequence (GGGTGAAGATCCTGTTCAATA, SEQ ID NO. 1) and overexpression plasmid (gene transcription ID: NM_001077363) are synthesized and constructed by Shanghai Hanheng Biotechnology Co., Ltd. The experimental procedure is shown in Figure 1 , and the specific experimental scheme is shown in Table 1:

[0042] Table 1, specific grouping and administration scheme of experimental animals

[0043]

[0044]

[0045] 1, behavioral test

[0046] 1.1, mouse round ring suspension experiment

[0047] After the mice are administered for 20 days, the mouse round ring suspension experiment is used to evaluate the muscle endurance of the mice. A metal round ring with a diameter of 5 cm is used, and first, the mouse tail is suspended for 20 s to adapt it. The mouse is guided to hold the round ring, and after the mouse holds it stably, the mouse tail is released to make it freely suspended and the timing starts. If the mouse falls from the round ring, the timing stops and the mouse is suspended on the round ring again. If it falls again within 20 s, the previous suspension time is recorded as the final result. If it continues to suspend for more than 20 s, the time is accumulated until the next fall. After each experiment, the same mouse is rested for 30 min, and then the suspension experiment is performed again. The results are shown in Figure 2shown.

[0048] Figure 2 Experimental results demonstrate the effects of PTBP1 gene regulation on the ability of mice to hang on a pole. In wild-type (WT) mice, neither the PTBP1 knockdown (AAV-PTBP1-KD) nor the overexpression (AAV-PTBP1-OE) groups showed significant differences in hanging morphology (panel a) and hanging time (panel b) compared with the control group. However, significant changes were observed in the mdx mouse model. PTBP1 knockdown not only improved hanging postural coordination (panel a) but also significantly prolonged hanging time (panel b). Conversely, PTBP1 overexpression led to worsened hanging morphology (panel a) and shortened hanging time (panel b). These data indicate that PTBP1 expression levels specifically regulate muscle endurance in mdx mice but have limited effects on hanging ability in wild-type mice. These results suggest that PTBP1 may be a potential therapeutic target for ameliorating the muscular dystrophy phenotype in mdx mice.

[0049] 1.2 Mouse gait experiment

[0050] This study evaluated the gait characteristics of mice by recording their walking footprints in a free-walking state to reflect their skeletal muscle function status. The experimental setup includes a narrow runway of 8cm×1m, with A4 paper laid on the bottom and a dark box connected to the end as an induction device. The specific operation process is as follows: First, ink marks are evenly applied to the soles of the hind limbs of the mouse on both sides, and then the mouse is placed at the starting end of the runway to walk freely. After the mouse has completely entered the dark box, the footprint recording paper under the runway is collected. For data analysis, the middle section of the continuous walking trajectory was selected, and the distance between the front and rear footprints on the same side (step length) and the lateral distance between the bilateral footprints (step width) were measured respectively. After each mouse was measured 3 times, the average value (unit: mm) was taken as the final gait parameter. This method can objectively quantify the motor coordination of mice, and the relevant results are shown in Figure 3 middle.

[0051] Figure 3The results of the study on the influence of PTBP1 gene regulation on mouse gait characteristics are shown. In wild-type mice, PTBP1 knockdown (AAV-PTBP1-KD) or overexpression (AAV-PTBP1-OE) did not significantly change the gait parameters. However, significant changes were observed in the mdx mouse model: the footprint graph in panel a shows that PTBP1 knockdown makes the gait pattern of mdx mice closer to that of wild-type mice; while PTBP1 overexpression does not improve gait abnormalities. The step length statistics in panel b show that PTBP1 knockdown significantly increases the step length of mdx mice, and overexpression further shortens the step length. The step width analysis in panel c shows that PTBP1 knockdown normalizes the step width of mdx mice, and overexpression still leads to abnormal increase in step width. These results suggest that PTBP1 may affect the motor coordination of mdx mice by regulating neuromuscular function.

[0052] 1.3, Blood biochemistry determination

[0053] After the 21-day drug administration experiment, the experimental mice were euthanized after fasting for 12 hours and sample collection was performed. The specific operation process is as follows: blood samples were obtained by eye ball blood sampling after isoflurane anesthesia, and the collected blood samples were centrifuged at 4°C at a speed of 4000 rpm after standing for 2 hours. The supernatant was used to determine the contents of creatine kinase (CK) and lactate dehydrogenase (LDH). The experimental results show that Figure 4 ), in wild-type mice, specific knockdown or overexpression of PTBP1 in myoblasts did not significantly change the serum CK and LDH levels; while in the mdx mouse model, specific knockdown of PTBP1 in myoblasts significantly reduced the serum CK and LDH contents, and overexpression of PTBP1 also showed a trend of reducing the activities of these two enzymes, suggesting that PTBP1 may be involved in the regulation of pathological processes related to muscle cell membrane integrity.

[0054] 1.4, HE staining

[0055] On the 21st day of the experiment, we performed histopathological analysis on the mice. Target muscle tissues such as gastrocnemius muscle (GAS), tibialis anterior muscle (TA), quadriceps femoris muscle (QF), and diaphragm muscle (DIA) were quickly collected, and immediately frozen and embedded with OCT embedding agent. 10 μm thick continuous sections were prepared using a freezing microtome, and after HE staining, neutral resin was used for mounting. All sections were systematically observed under an Olympus BX53 microscope and image data were collected (results shown in Figure 5 、 6 ).

[0056] Histopathological analysis showed that the skeletal muscle tissue structure of wild-type mice was normal, with tight and orderly arrangement of muscle fibers and typical marginalization of cell nuclei. Notably, neither myoblast-specific knockdown nor overexpression of PTBP1 had a significant impact on the histomorphological characteristics of gastrocnemius (GAS), quadriceps femoris (QF), tibialis anterior (TA), and diaphragm (DIA) muscles in wild-type mice. Figure 5 ).

[0057] In contrast, the mdx mouse model exhibited typical muscular dystrophy pathological features: significant muscle fiber swelling, necrosis, and loss, abnormal centralization of cell nuclei, and significant inflammatory cell infiltration in various skeletal muscles, with the pathological changes in the gastrocnemius (GAS) muscle being particularly similar to those in patients with Duchenne muscular dystrophy (DMD). The experimental results showed that knockdown of PTBP1 in mdx mouse myoblasts significantly improved the above pathological changes, including reducing muscle fiber swelling, necrosis, and loss, reducing skeletal muscle inflammatory infiltration, and promoting muscle fiber structure recovery; while PTBP1 overexpression had the opposite effect, further exacerbating muscle fiber damage and inflammatory response Figure 6 ).

[0058] 1.5, Immunofluorescence test

[0059] Through immunofluorescence staining experiments, we systematically evaluated the effects of PTBP1 gene knockdown and overexpression on wild-type (WT) and mdx mouse skeletal muscle nascent muscle fibers (eMyHC) and mature muscle fibers (MHC), while also detecting apoptosis using the TUNEL method. During the experiment, the gastrocnemius (GAS) muscle tissue of mice was taken, embedded with OCT, and prepared into 10 μm thick frozen sections. The sections were fixed with 4% paraformaldehyde for 15 minutes, washed with PBS three times (5 min each time), blocked with 5% goat serum and 3% BSA for 1 hour, and then incubated with eMyHC, PTBP1, and MHC primary antibodies at 4°C overnight. The next day, after rewarming for 1.5 hours, incubate at 37°C for 0.5 hours, wash with PBS three times (5 min each time), and stain with the corresponding fluorescent secondary antibodies for 2 hours, and finally mount with an anti-fluorescence quencher containing DAPI. All samples were imaged under an FV3000 confocal microscope (results shown in Figure 7 、 8 ).

[0060] As Figure 7As shown, 21 days after AAV infection, skeletal muscle in wild-type (control) mice remained intact, satellite cells remained quiescent, and MyoG-expressing myoblasts were virtually undetectable in the tissue. Therefore, knockdown or overexpression of PTBP1 had no significant effect on skeletal muscle in WT mice. In contrast, numerous MyoG-expressing myoblasts were observed in skeletal muscle of mdx mice, indicating ongoing myofiber regeneration. This result clearly demonstrates the differential regulation of PTBP1 in pathological (mdx) and normal (WT) skeletal muscle.

[0061] Figure 8 The pathological regulatory mechanism of PTBP1 was further revealed. Wild-type mice (control group) exhibit quiescent satellite cells in skeletal muscle, with very low expression of PTBP1 and MyoD. In contrast, mdx mice exhibited significant muscle fiber swelling and loss, with high PTBP1 expression in the injured area and few new muscle fibers, indicating impaired regeneration. Notably, myoblast-specific knockdown of PTBP1 significantly promoted new muscle fiber formation and reduced muscle fiber loss in mdx mice, while overexpression of PTBP1 exacerbated muscle fiber necrosis and inhibited regeneration.

[0062] In the injured area of ​​mdx mice, MyoD-positive cells colocalized significantly with overexpressed PTBP1, suggesting that PTBP1 may promote myoblast proliferation while inhibiting differentiation, leading to the blockage of new muscle fiber formation and impaired skeletal muscle regeneration. Experiments confirmed that PTBP1 knockdown reduced MyoD-positive cells and promoted myofiber formation, while overexpression led to abnormal accumulation of myoblasts. Furthermore, TUNEL staining revealed that overexpression of PTBP1 induced myoblast apoptosis, a phenomenon exacerbated by the overexpression group, while knockdown of PTBP1 effectively alleviated apoptosis. These results suggest that PTBP1 directly influences the efficiency of skeletal muscle regeneration in mdx mice by regulating the balance between myoblast proliferation and differentiation and the process of apoptosis.

[0063] 1.6. Western Blot

[0064] GAS tissue protein samples were analyzed using a standard Western blot protocol: protein samples were first separated by 10% SDS-PAGE electrophoresis, and then the proteins were transferred to a PVDF membrane. The blocking step was performed with 5% skim milk at room temperature for 1 hour, followed by incubation with the primary antibody overnight at 4°C. The next day, after incubation with the corresponding secondary antibody at room temperature for 1 hour, the protein bands were visualized using the ECL detection kit from Vazyme (China), and finally the protein band signals were acquired using the Tanon-5200 Multi imaging system (see results). Figure 9 Sub-figure a).

[0065] Figure 9Results show that PTBP1 expression level is very low in wild type mice (control or WT control) due to the quiescent state of satellite cells in skeletal muscle, thus neither knockdown nor overexpression of PTBP1 causes significant changes. In mdx mouse model, PTBP1 shows a clear high expression feature: knockdown of PTBP1 can significantly reduce its expression level, while overexpression further enhances the expression of PTBP1 (subgraph b).

[0066] The expression of myogenic regulatory factors (MyoD and MyoG) in wild type mice is not affected by PTBP1 intervention. In contrast, mdx mice (mdx or mdx control) show overall up-regulation of myogenic regulatory factors, which may be due to the compensatory increase of the body after skeletal muscle injury in mdx mice. Compared with wild type mice, the proliferation marker MyoD in mdx mice is significantly increased while the differentiation marker MyoG has limited increase, suggesting that there is a proliferation-differentiation imbalance. Notably, knockdown of PTBP1 can significantly down-regulate MyoD and up-regulate MyoG, promoting the differentiation of myoblasts to differentiation state, promoting the production of new muscle fibers and regeneration of skeletal muscle; on the contrary, overexpression of PTBP1 exacerbates the expression of MyoD and inhibits MyoG, hindering the differentiation process (subgraphs c and d).

[0067] Comprehensive analysis shows that PTBP1 in wild type mice skeletal muscle shows very low expression level, and its knockdown or overexpression intervention does not cause significant changes in PTBP1 expression. However, in mdx mouse model, PTBP1 shows a clear high expression feature: through genetic intervention means, knockdown of PTBP1 can significantly reduce its expression level, while overexpression can effectively increase the content of PTBP1 protein. Further research found that PTBP1 expression level has clear relevance with myogenic regulatory factors - knockdown of PTBP1 not only down-regulates the expression of proliferation marker MyoD, but also significantly promotes the expression of differentiation marker MyoG, thus promoting the differentiation of myoblasts to differentiation state; on the contrary, overexpression of PTBP1 shows the characteristics of up-regulating MyoD and inhibiting MyoG expression, eventually leading to the blockage of myoblast differentiation. These results confirm that PTBP1 plays a key role in regulating the proliferation-differentiation balance of myoblasts.

[0068] In summary, the expression level of PTBP1 has a significant regulatory effect on skeletal muscle function in the mdx mouse model. Compared with the non-intervened mdx model group, knocking down PTBP1 can significantly prolong the suspension time of mice and enhance the ring grip ability, while overexpression of PTBP1 leads to shortening of the suspension time and further deterioration of the grip ability. Gait analysis shows that mdx mice exhibit similar characteristics of shortened hind limb stride and "duck step" gait to DMD patients, while PTBP1 knockdown can significantly increase the stride and improve abnormal gait, and overexpression aggravates gait disturbance. These results show that targeting inhibition of myoblast PTBP1 level can effectively improve the skeletal muscle function of mdx mice, ultimately promoting skeletal muscle fiber regeneration and skeletal muscle strength recovery.

[0069] This study confirmed that PTBP1 plays a key regulatory role in skeletal muscle regeneration by using B10-DMD-KO mouse model, PTBP1 gene knockdown and overexpression intervention. The experimental results show that the expression level of PTBP1 is negatively correlated with the regeneration ability of muscle fibers, which provides an important theoretical basis for developing new gene therapy strategies for Duchenne muscular dystrophy (DMD).

[0070] Example 2

[0071] In this example, wild-type mice and mdx mouse models were administered.

[0072] 5-week-old wild-type (WT) and B10-DMD-KO (mdx) mice were selected for the experiment, and after one week of adaptive feeding, they were randomly divided into 5 groups (n = 6 / group) according to body weight: wild-type control group (control group), mdx model group, Degrasyn (WP1130) low-dose group (15 mg / kg), Degrasyn (WP1130) high-dose group (30 mg / kg), and prednisolone (Prednisolone, 5 mg / kg) positive control group. The administration used standard intraperitoneal injection operation: a 300 μL insulin syringe was used, the needle was inserted at a 30° angle near the thigh on the lower abdomen, 200 μL of drug solution was slowly injected, and then the needle was rotated back. After injection, immediately press with iodophor cotton ball to prevent leakage. The specific experimental scheme is shown in Table 2:

[0073] Table 2, specific grouping and administration scheme of experimental animals

[0074]

[0075]

[0076] Behavioral test

[0077] 2.1, mouse ring suspension experiment

[0078] The experimental method is the same as 1.1, and the results are as follows Figure 10 shown.

[0079] Figure 10 Experimental data show that Degrasyn significantly improves the pole-hanging ability of mdx mice. In the pole-hanging test, both the low- and high-dose Degrasyn groups demonstrated more coordinated pole-hanging postures (sub-figure a) and significantly prolonged their duration of hanging compared to the untreated mdx group (sub-figure b). The positive control group also showed similar improvements. These results confirm that Degrasyn specifically enhances muscle endurance in mdx mice, suggesting that it may be an effective candidate for the treatment of Duchenne muscular dystrophy.

[0080] 2.2 Mouse gait experiment

[0081] The experimental method is the same as 1.2, and the results are as follows Figure 11 shown.

[0082] Figure 11 The results of this study showed that Degrasyn significantly improved the gait characteristics of mdx mice. Footprint analysis (sub-figure a) showed that mdx mice treated with Degrasyn exhibited a gait pattern closer to that of wild-type mice. Stride length measurement data (sub-figure b) further confirmed that both low- and high-dose Degrasyn groups significantly increased the stride length of mdx mice, an improvement comparable to that of the positive control group. These findings suggest that Degrasyn may improve the gait function of mdx mice by regulating motor coordination.

[0083] 2.3. Blood biochemistry assay

[0084] The determination method is the same as 1.3, and the results are as follows Figure 12 shown.

[0085] Experimental data showed that serum creatine kinase (CK) and lactate dehydrogenase (LDH) levels in wild-type (WT) mice remained low. In contrast, mdx model mice, due to impaired skeletal muscle regeneration, showed significantly elevated serum levels of these two muscle damage markers. Notably, treatment with Degrasyn (WP1130) and prednisolone decreased serum CK and LDH levels in mdx mice, suggesting that these two drugs may have a potential role in ameliorating muscle damage in mdx mice.

[0086] 2.4 HE staining

[0087] The HE staining process is the same as 1.4. The collected image data can be found in Figure 13 .

[0088] HE staining results showed that the wild type mouse skeletal muscle tissue exhibited typical healthy muscle fiber characteristics, with muscle fibers arranged in an orderly manner and nuclei evenly distributed under the sarcolemma. In contrast, the mdx mouse skeletal muscle tissue exhibited obvious pathological changes, including muscle fiber swelling and necrosis, nuclear centralization, uneven muscle fiber size, and a decrease in the number of muscle fibers, accompanied by significant inflammatory cell infiltration. The pathological characteristics of the gastrocnemius muscle (GAS) were highly similar to those of patients with Duchenne muscular dystrophy (DMD). Notably, after treatment with Degrasyn (WP1130), the pathological changes in the skeletal muscle of mdx mice were significantly improved, and the therapeutic effect was comparable to that of the Prednisolone positive control group, which was manifested by a reduction in muscle fiber swelling and necrosis, a decrease in inflammatory cell infiltration, and inhibition of muscle fiber loss, thereby promoting the structural and functional recovery of skeletal muscle tissue.

[0089] 2.5. Immunofluorescence test

[0090] To investigate the effects of drug administration on the eMyHC and MHC of the skeletal muscle of wild type (WT) and mdx mice, the gastrocnemius muscle (GAS) was selected for immunofluorescence staining analysis. Fresh muscle tissue was embedded in gum arabic to prepare 8 μm thick sections, which were fixed with 4% paraformaldehyde for 15 minutes and washed with PBS three times (5 minutes each time). After blocking with 5% goat serum and 3% BSA for 1 hour, the eMyHC and MHC primary antibodies were incubated overnight at 4°C. The next day, the sections were warmed for 1.5 hours, washed with PBS three times (5 minutes each time), incubated with the corresponding fluorescent secondary antibodies for 2 hours, mounted with DAPI antifade mounting medium, and finally observed and imaged using an FV3000 confocal microscope.

[0091] As shown in Figure 14 , the satellite cells in the skeletal muscle tissue of wild type mice (control) remained in a resting state, and no obvious myoblast proliferation or differentiation activity was observed. In contrast, the mdx mice exhibited significant pathological changes in muscle fibers, including extensive muscle fiber swelling and loss, and only a small amount of newly formed muscle fibers were observed in the damaged area, indicating impaired skeletal muscle regeneration capacity. After drug intervention, the number of newly formed muscle fibers in the damaged area of the skeletal muscle of mdx mice increased significantly, and the pathological loss of mature muscle fibers was alleviated. The high-dose Degrasyn (WP1130) group showed more obvious effects, indicating that the drug can effectively improve the skeletal muscle regeneration dysfunction of mdx mice.

[0092] 2.6. Immunoblotting

[0093] The GAS tissue protein samples were analyzed using the standard Western blot experimental procedure, and the analysis method was the same as that in 1.6, as shown in Figure 15 .

[0094] Figure 15 The results show that the satellite cells of wild-type mice maintain a resting state, and the myoblast activity is very low, and the markers such as MyOG, MyOD and PTBP1 are not expressed. Due to the continuous damage of skeletal muscle in mdx mice, a large number of myoblasts in proliferative state exist in the muscle tissue, showing high expression of MyOD and PTBP1; at the same time, part of the cells enter the differentiation stage, resulting in a significant increase in the expression level of MyOG. Drug intervention experiments show that Degrasyn (WP1130) and Prednisolone can significantly reduce the expression levels of PTBP1 and USP9x in the skeletal muscle of mdx mice. It is particularly noteworthy that compared with the mdx mice without drug administration, the mice in the treatment group show a characteristic change pattern of down-regulation of the expression of muscle growth regulatory factor MyOD and up-regulation of the expression of MyOG, and the effect of the high-dose Degrasyn (WP1130) group is particularly significant, which suggests that the drugs may promote the formation of new muscle fibers by regulating the transition of myoblasts from the proliferative state to the differentiated state, thereby effectively improving the skeletal muscle regeneration function of mdx mice.

[0095] In summary, Degrasyn (WP1130) and the positive control drug Prednisolone have a significant improvement effect on the skeletal muscle function of mdx mice. Compared with the mdx model group without intervention, the mice in the drug treatment group show longer suspension time and stronger ring grip strength. In the gait analysis, mdx mice characteristically show a shortened hind limb stride and a "duck step" gait, which is similar to the clinical manifestations of DMD patients; after treatment with Degrasyn (WP1130) and Prednisolone, the hind limb stride of the mice is significantly increased, and the abnormal gait is significantly improved. These findings confirm that the administration of Degrasyn (WP1130) can effectively promote the regeneration of muscle fibers and the recovery of muscle strength in mdx mice, providing a new potential drug selection for DMD treatment.

[0096] The above shows and describes the basic principles, main features and advantages of the present application. However, the above description is only a specific embodiment of the present application, and the technical features of the present application are not limited thereto. Any other implementation derived by those skilled in the art without departing from the technical solution of the present application should be covered in the scope of the present application.

Claims

1. A pharmaceutical composition for treating Duchenne muscular dystrophy, characterized in that: The invention comprises a therapeutically effective amount of Degrasyn (WP1130) as an active ingredient. The Degrasyn (WP1130) promotes myofiber regeneration by inhibiting the expression or activity of PTBP1 in skeletal muscle cells.

2. Use of the PTBP1 degrader Degrasyn (WP1130) in the preparation of a drug, characterized in that: The drug is used to treat Duchenne muscular dystrophy or reduce the risk of developing Duchenne muscular dystrophy.

3. The use according to claim 2, characterized in that The medicine comprises a therapeutically effective amount of Degrasyn (WP1130) and pharmaceutically acceptable excipients, and is an injection preparation, a sustained-release preparation or an oral preparation.

4. A method for screening potential drugs for treating Duchenne muscular dystrophy, characterized in that: This is achieved by detecting the inhibitory effect of candidate substances on PTBP1 expression or activity.

5. A combined drug regimen for treating Duchenne muscular dystrophy, characterized in that: Contains the combination of Degrasyn (WP1130) and a PTBP1 gene silencer.

6. A kit for diagnosing the prognosis of Duchenne muscular dystrophy, characterized in that: Contains detection reagents for detecting PTBP1 expression levels.

Images