Coding sequence for enhancing HMGN1 expression and application thereof
By designing a coding sequence that enhances HMGN1 expression and using adenoviral vectors to deliver it and activate DC cells, the problem of low HMGN1 delivery efficiency caused by the dense matrix of tumor tissue was solved, and effective inhibition of melanoma was achieved.
Patent Information
- Application Number
- CN202510979697.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-16
- Publication Date
- 2025-10-17
AI Technical Summary
The dense matrix of solid tumor tissue results in insufficient penetration of gold particles fired by the gene gun, low HMGN1 delivery efficiency, and difficulty in effectively activating DCs, thereby inhibiting tumor immune responses.
A coding sequence for enhancing HMGN1 expression is designed, comprising an expression enhancing sequence, a secretory sequence, a main sequence, and a termination sequence, for expressing HMGN1 protein in tumor cells, activating DCs through adenoviral vector delivery, and inducing an anti-tumor immune response.
It significantly inhibited tumor growth and enhanced tumor-specific immune responses in animal models, providing the possibility of new anti-tumor drug formulations.
Smart Images
Figure CN120795176A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic recombination technology, and particularly relates to a coding sequence for enhancing HMGN1 expression and application thereof. BACKGROUND
[0002] Tumor cells are derived from autologous cells, so the immune system has weak ability to recognize and attack tumors. This is one of the key bottleneck problems of tumor immunotherapy. Alarmin is an endogenous molecule with dual effects of dendritic cell (DC) recruitment and activation, which can enhance the induction of antigen-specific immune response by promoting antigen uptake, processing and presentation. In tumor tissue, the lack of alarmin is one of the reasons for the failure of the initiation of tumor-specific T cell response. This lack causes the tumor-infiltrating DCs to fail to obtain effective maturation signals, so that the lymph-homed DCs cannot present tumor-associated antigens to initiate T cell proliferation and clonal expansion. Therefore, the use of exogenous alarmin can induce and enhance the anti-tumor immune response.
[0003] High-mobility group nucleosome-binding protein 1 (HMGN1) is a non-histone chromatin-binding protein encoded by the HMGN1 gene, which belongs to the HMG superfamily member. HMGN1 has a strong effect of recruiting and activating DCs, and studies have shown that injecting gold particles wrapped with HMGN1 plasmid into tumor cells by gene gun can induce tumor-specific immune response. However, solid tumor tissues usually have dense stroma, resulting in insufficient penetration rate and low delivery efficiency of gold particles fired by the gene gun, which is not conducive to the occurrence of anti-tumor immune response.
[0004] Melanoma is a highly malignant skin tumor mainly derived from melanocytes in the skin. It has a low incidence among all skin tumors, but its mortality rate is high, especially for advanced metastatic melanoma. Currently, the main treatment methods for melanoma include surgical resection, radiotherapy, chemotherapy, etc. However, surgical resection is effective for early-stage localized malignant melanoma, but has limited effect on advanced or metastatic cases. Chemotherapy and radiotherapy have low sensitivity to malignant melanoma, making it difficult to effectively control tumor progression. In addition, radiotherapy has poor sensitivity to malignant melanoma, and is usually only used for locally advanced or inoperable patients.
[0005] Therefore, how to utilize HMGN1 to fully exert its alarmin function in tumor treatment is a technical problem that needs to be solved at present. SUMMARY
[0006] The present application aims to at least solve one of the technical problems existing in the related art. To this end, a first object of the present application is to provide a coding sequence for enhancing expression of HMGN1, and a second object of the present application is to provide an application of the coding sequence for enhancing expression of HMGN1.
[0007] To achieve the first object, the technical solution adopted by the present application is as follows: The coding sequence for enhancing expression of HMGN1 comprises, in the direction from 5' end to 3' end, at least an expression-enhancing sequence region, a secretion-promoting sequence region, a main sequence region, and a termination sequence region connected in sequence. The expression-enhancing sequence region is used to increase expression of the HMGN1 protein, the secretion-promoting sequence region is used to promote secretion of the HMGN1 protein, the main sequence region is used to encode the HMGN1 protein, and the termination sequence region is used to end translation of the HMGN1 protein.
[0008] Further, the nucleotide sequence of the expression-enhancing sequence region is shown in SEQ ID NO. 1, the nucleotide sequence of the secretion-promoting sequence region is shown in SEQ ID NO. 2, and the nucleotide sequence of the main sequence region is shown in SEQ ID NO. 3. The sequence of the nucleotide of SEQ ID NO. 1 from 5' end to 3' end is as follows: GCCACCATGG. The sequence of the nucleotide of SEQ ID NO. 2 from 5' end to 3' end is as follows: CCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCC. The sequence of the nucleotide of SEQ ID NO. 3 from 5' end to 3' end is as follows: CCCAAGAGGAAGGTCAGCTCCGCCGAAGGCGCCGCCAAGGAAGAGCCCAAGAGGAGATCGGCGCGGTTGTCAGCTAAACCTCCTGCAAAAGTGGAAGCGAAGCCGAAAAAGGCAGCAGCGAAGGATAAATCTTCAGACAAAAAAGTGCAAACAAAAGGGAAAAGGGGAGCAAAGGGAAAACAGGCCGAAGTGGCTAACCAAGAAACTAAAGAAGACTTACCTGCGGAAAACGGGGAAACGAAGACTGAGGAGAGTCCAGCCTCTGATGAAGCAGGAGAGAAAGAAGCCAAGTCTGAT.
[0009] Further, the nucleotide sequence of the termination sequence region is selected from any one of TAA, TAG and TGA.
[0010] Further, the secretory sequence region encodes any one of the following proteins: Protein I, the amino acid sequence of which is shown as SEQ ID NO. 4, SEQ ID NO. 4 is shown as follows from N-terminal to C-terminal: MALWMRLLPLLALLALWGPDPAAA; Protein II, the amino acid sequence of which is shown as SEQ ID NO. 5, SEQ ID NO. 5 is shown as follows from N-terminal to C-terminal: MKWVTFISLLFSSAYS; Protein III, the amino acid sequence of which is shown as SEQ ID NO. 6, SEQ ID NO. 6 is shown as follows from N-terminal to C-terminal: MGVLLTQRTLLSLVLALLFPSMASM; Protein IV, the amino acid sequence of which is shown as SEQ ID NO. 7, SEQ ID NO. 7 is shown as follows from N-terminal to C-terminal: MGWSCIILFLVATATGVHS; Protein V, the amino acid sequence of which is shown as SEQ ID NO. 8, SEQ ID NO. 8 is shown as follows from N-terminal to C-terminal: METDTLLLWVLLLWVPGSTGD; Protein VI, the amino acid sequence of which is shown as SEQ ID NO. 9, SEQ ID NO. 9 is shown as follows from N-terminal to C-terminal: MYRMQLLSCIALSLALVTNS; Protein VII, the amino acid sequence of which is shown as SEQ ID NO. 10, SEQ ID NO. 10 is shown as follows from N-terminal to C-terminal: MNLLLILTFVAAAVA; Protein VIII, the amino acid sequence of which is shown as SEQ ID NO. 11, SEQ ID NO. 11 is shown as follows from N-terminal to C-terminal: MAFLWLLSCWALLGTTFG; Protein IX, the amino acid sequence of which is shown as SEQ ID NO. 12, SEQ ID NO. 12 is shown as follows from N-terminal to C-terminal: MGVKVLFALICIAVAEA; Protein X, the amino acid sequence of which is shown as SEQ ID NO. 13, SEQ ID NO. 13 is shown as follows from N-terminal to C-terminal: MKPIFLVLLVVTSAYA; Protein XI, the amino acid sequence of which is shown as SEQ ID NO. 14, SEQ ID NO. 14 is shown as follows from N terminus to C terminus: MRAWIFFLLCLAGRALA; Protein XII, the amino acid sequence of which is shown as SEQ ID NO. 15, SEQ ID NO. 15 is shown as follows from N terminus to C terminus: MWWRLWWLLLLLLLLWPMVWA; Protein XIII, the amino acid sequence of which is shown as SEQ ID NO. 16, SEQ ID NO. 16 is shown as follows from N terminus to C terminus: MDMRVPAQLLGLLLLWLRGARC; Protein XIV, the amino acid sequence of which is shown as SEQ ID NO. 17, SEQ ID NO. 17 is shown as follows from N terminus to C terminus: MPLLLLLPLLWAGALA; Protein XV, the amino acid sequence of which is shown as SEQ ID NO. 18, SEQ ID NO. 18 is shown as follows from N terminus to C terminus: MDAMKRGLCCVLLLCGAVFVSPS; Protein XVI, the amino acid sequence of which is shown as SEQ ID NO. 19, SEQ ID NO. 19 is shown as follows from N terminus to C terminus: MKTIIALSYIFCLVLG; Protein I-Protein XVI can all be used as signal peptides to promote cell secretion of HMGN1 protein.
[0011] Further, an adjustment reading sequence region, a first cloning site sequence region, a tag sequence region, a second cloning site sequence region and a transmembrane sequence region are sequentially connected between the main sequence region and the termination sequence region in the direction from 5' end to 3' end; The adjustment reading sequence region is used to ensure correct synthesis of HMGN1 in the expression process, the first cloning site sequence region is a region composed of restriction enzyme recognition sites, the tag sequence region is a c-Myc tag, and the second cloning site sequence region is Eco RI cloning site, and the transmembrane sequence region is used to anchor HMGN1 on the cell membrane surface.
[0012] Further, the nucleotide sequence of the adjustment reading sequence region is TT.
[0013] Further, the nucleotide sequence of the first cloning site sequence region is shown as SEQ ID NO. 20, the nucleotide sequence of the tag sequence region is shown as SEQ ID NO. 21, and the nucleotide sequence of the second cloning site sequence region is GAATTC. The nucleotide sequence from the 5' end to the 3' end of SEQ ID NO.20 is as follows: TCTAGAGGGCCCGCGGTTC; The nucleotide sequence from the 5' end to the 3' end of SEQ ID NO.21 is as follows: GAACAAAAACTCATCTCAGAAGAGGATCTG.
[0014] Furthermore, the nucleotide sequence of the transmembrane sequence region is shown in SEQ ID NO.22, and the sequence of nucleotides from the 5' end to the 3' end of SEQ ID NO.22 is as follows: GCGAAGCCCACCACGACGCCAGCGCCGCACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACC.
[0015] In order to achieve the second purpose, the technical solution adopted by the present invention is: Application of a coding sequence for enhancing HMGN1 expression, such as any of the coding sequences for enhancing HMGN1 expression described above, for the preparation of an anti-tumor pharmaceutical preparation.
[0016] Furthermore, the pharmaceutical preparation includes an adenovirus vector vaccine.
[0017] The above one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: The coding sequence for enhancing HMGN1 expression provided by the present invention is injected into tumors or into metastatic lymph nodes, allowing an adenovirus carrying the coding sequence to infect tumor cells. This in turn encourages the cells to express HMGN1 extracellularly and / or on their cell membranes, thereby activating dendritic cells (DCs) and inducing an anti-tumor immune response. Animal experiments against B16F1 malignant tumors showed that tumor volume was significantly reduced in mice injected with adenoviral vectors carrying the coding gene, demonstrating a promising anti-tumor effect. Therefore, the coding sequence for enhancing HMGN1 expression has the potential to be used in the development of novel anti-tumor drug formulations.
[0018] Additional aspects and advantages of the present application will be made apparent from the following description. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is a protein immunoblotting result chart of different generations of recombinant adenovirus vector provided by test example 1 of the present application.
[0020] Figure 2 is a protein immunoblotting result chart of secretory HMGN1 and cell membrane type HMGN1 provided by test example 1 of the present application.
[0021] Figure 3 is an electrophoresis identification result chart provided by test example 2 of the present application.
[0022] Figure 4 is a mN1 coding sequence sequencing result chart using T7 as forward primer provided by test example 2 of the present application.
[0023] Figure 5 is a mN1 coding sequence sequencing result chart using V5 as reverse primer provided by test example 2 of the present application.
[0024] Figure 6 is a sN1 coding sequence sequencing result chart using T7 as forward primer provided by test example 2 of the present application.
[0025] Figure 7 is a sN1 coding sequence sequencing result chart using V5 as reverse primer provided by test example 2 of the present application.
[0026] Figure 8 is an animal in vivo anti-tumor experiment result chart of AdH5mN1 and AdH5sN1 provided by test example 3 of the present application. DETAILED DESCRIPTION
[0027] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be described clearly and completely below in conjunction with specific embodiments. Obviously, the described embodiments are only some, but not all of the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application. The following embodiments are used to illustrate the present application, but cannot be used to limit the scope of the present application.
[0028] The coding sequence of secretory expressed HMGN1 (sN1 coding sequence) is enhanced, and the nucleotide sequence is shown as SEQ ID NO. 23 from 5' end to 3' end as follows: CGCGGATCCGCCACCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCCCCAAGAGGAAGGTCAGCTCCGCCGAAGGCGCCGCCAAGGAAGAGCCCAAGAGGAGATCGGCGCGGTTGTCAGCTAAACCTCCTGCAAAAGTGGAAGCGAAGCCGAAAAAGGCAGCAGCGAAGGATAAATCTTCAGACAAAAAAGTGCAAACAAAAGGGAAAAGGGGAGCAAAGGGAAAACAGGCCGAAGTGGCTAACCAAGAAACTAAAGAAGACTTACCTGCGGAAAACGGGGAAACGAAGACTGAGGAGAGTCCAGCCTCTGATGAAGCAGGAGAGAAAGAAGCCAAGTCTGATTAAGCGGCCGCCTAA; The coding sequence of the secretory expression HMGN1 includes, in sequence, a BamH I enzyme cutting site sequence region, an expression enhancement sequence region (SEQ ID NO. 1), a secretion promotion sequence region (SEQ ID NO. 2), a main sequence region (SEQ ID NO. 3), a termination sequence region (TAA), and Not The BamH I enzyme cutting site sequence region (SEQ ID NO. 24); Among them, Bam The BamH I enzyme cutting site sequence region contains a protection base sequence CGC for improving cutting efficiency and a restriction enzyme Bam The BamH I enzyme cutting site sequence region contains a restriction enzyme Not The BamH I enzyme cutting site sequence region contains a restriction enzyme Not The BamH I enzyme cutting site sequence region contains a protection base CTAA for improving cutting efficiency and a restriction enzyme Not The nucleotide sequence of the BamH I enzyme cutting site sequence region is shown as SEQ ID NO. 24, and SEQ ID NO. 24 is shown as follows from 5' end to 3' end: GCGGCCGCCTAA.
[0029] The coding sequence for enhancing cell membrane expression of HMGN1 (mN1 coding sequence) has a nucleotide sequence as shown in SEQ ID NO. 25. SEQ ID NO. 25 is as follows from the 5' end to the 3' end: ; A coding sequence for cell membrane-expressed HMGN1, comprising, based on a secretory HMGN1 coding sequence, an adjusted reading sequence region (TT), a first cloning site sequence region (SEQ ID NO. 20), a tag sequence region (SEQ ID NO. 21), a second cloning site sequence region (GAATTC), and a transmembrane sequence region (SEQ ID NO. 22) sequentially connected between a main sequence region (SEQ ID NO. 3) and a termination sequence region (TAA); wherein the adjustment reading sequence region in the coding sequence is used to ensure the correct synthesis of HMGN1 in the expression process of the main sequence region, the first cloning site sequence region is a region composed of restriction enzyme recognition sites, the tag sequence region is a c-Myc tag, and the second cloning site sequence region is Eco RI cloning site, and the transmembrane sequence region is used to anchor HMGN1 to the cell membrane surface.
[0030] In the following examples, the experimental methods used are conventional methods, and the materials, reagents, etc. used are obtained from commercial channels unless otherwise specified, are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, and are used without special instructions.
[0031] Example 1: Construction of a recombinant adenovirus vector.
[0032] After synthesizing the above two DNA fragments (mN1 coding sequence and sN1 coding sequence) respectively; the mN1 coding sequence and the sN1 coding sequence are subjected to double enzyme digestion using Bam HI and Not I, and the pENTR™4 Dual Selection Vector vector is subjected to double enzyme digestion using Bam HI and Not I, and the pENTR™4 Dual Selection Vector vector is subjected to double enzyme digestion using
[0033] The recovered DNA fragments and the pENTR™4 Dual Selection Vector vector are ligated using T4 DNA ligase, and the ligation is performed at room temperature for 2 h to obtain a ligation product; wherein the ligation system is shown in the following table: Reaction conditions: incubation at 16°C for 10-12 h (or incubation at 25°C for 10 min if 5x Rapid Ligation Buffer is used).
[0034] The ligation product is transformed into DH5α™ competent E. coli, and positive clones are selected using an LB plate containing kanamycin at a concentration of 50 µg / ml, and the recombinant vectors obtained by screening are named pENTR™4-mN1 and pENTR™4-sN1, respectively, according to the inserted fragments.
[0035] The pENTR™4-mN1 and pENTR™4-sN1 recombinant vectors are extracted using a PureLink™ HQ plasmid purification kit; The pENTR™4-mN1 and pENTR™4-sN1 recombinant vectors are extracted using a PureLink™ HQ plasmid purification kit; ®II The enzyme mixture will be used to perform homologous recombination between pENTRTM4-mN1 or pENTRTM4-sN1 and pAd / CMV / V5-DEST™ vector, respectively, to generate recombinant adenovirus expression vectors. The composition of the system is shown in the following table: Incubate at 25°C for 1 h (usually 1 hour is sufficient, but longer incubation time can improve the success rate of recombination), add proteinase K (1 μl) to terminate the reaction, and then incubate at 25°C for 10 min. Transform the recombination product into One Shot™ OmniMAX™ 2 T1 R Chemically competent E. coli, LB plates containing ampicillin at a concentration of 100 μg / ml are used to screen positive clones, and recombinant adenovirus expression vectors are screened, which are named pAd-mN1 and pAd-sN1 according to the inserted fragments, respectively.
[0036] Use PureLink ® Extract the recombinant adenovirus expression vectors pAd-mN1 and pAd-sN1 using the HiPure Plasmid Extraction Kit, respectively, and use Pac I Restriction enzymes are used to cut pAd-mN1 and pAd-sN1, respectively, to linearize them. Use PureLink ® HiPure Plasmid Miniprep Kit is used to recover linearized pAd-mN1 and pAd-sN1, respectively.
[0037] Use Lipofectamine ® 2000 to transfect 293A cells with linearized pAd-mN1 and pAd-sN1, respectively, to generate recombinant adenoviruses carrying the corresponding coding sequences.
[0038] The human 5 type replication-defective adenovirus used in the present application is abbreviated as AdH5, and the AdH5 recombinant adenovirus carrying the cell membrane type expression HMGN1 coding sequence used in the following is represented by AdH5mN1, and the AdH5 recombinant adenovirus carrying the secretory type expression HMGN1 coding sequence is represented by AdH5sN1. The obtained AdH5mN1 or AdH5sN1 recombinant adenovirus can be amplified by infecting 293A cells again for different generations.
[0039] It should be noted that other commercially available human 5 type replication-defective adenovirus packaging kits can be used to package the corresponding recombinant adenovirus.
[0040] Test Example 1 Western blotting experiment.
[0041] I. Preparation of cell pellets.
[0042] The 293A cells infected with AdH5sN1 were cultured at 37℃, 5% CO2 to 80%-90% confluence, and then the cells were gently blown with a pipette to collect the cell suspension. The cell suspension was centrifuged at 800 r / min for 5 min, and the supernatant was discarded to obtain the cell precipitate.
[0043] According to the above process, the cell precipitates of AdH5sN1 P0, P2 and P3 and the cell precipitates of AdH5mN1 P0, P2 and P3 were prepared, respectively.
[0044] II. Protein extraction
[0045] The cells were lysed by adding SDS lysis solution (150 μl) per 1 million cells overnight (16-24 h), and then centrifuged at 4000 r / min for 20 min. The supernatant was taken and stored at -20℃ for standby.
[0046] III. Polyacrylamide gel electrophoresis
[0047] Separation gel: 12%; Concentration gel 5%; Electrophoresis solution: Tris-glycine buffer (pH 8.3); Loading volume: 25 μL of protein sample (containing 1×loading buffer) was added per well; Electrophoresis time: First stage: voltage 35v, duration 2h; second stage: voltage 80v, duration 2.5h; IV. Blocking
[0048] Blocking solution: 10 (w / v)% BSA; Blocking time: 4℃ overnight (16-24 h).
[0049] V. Incubation of primary antibody
[0050] Preparation of primary antibody solution: the anti-HMGN1 rabbit antibody was diluted in the blocking solution at a ratio of 1:200 to obtain the primary antibody solution.
[0051] Incubation conditions: room temperature, 2h.
[0052] VI. Incubation of secondary antibody
[0053] Preparation of secondary antibody solution: the anti-HRP labeled secondary antibody was diluted in the Tris buffer saline solution at a ratio of 1:300 to obtain the secondary antibody solution.
[0054] Incubation conditions: room temperature, 2h.
[0055] VII. Color development
[0056] After coloration for 30 min with DAB coloration kit, rinse with distilled water, dry and take a photo after sunning, as shown in Figure 1 and Figure 2 ; In the figure, the reference is PageRuler™ Prestained Protein Ladder (Thermo Scientific).
[0057] Test Example 2: Results of gene sequence alignment.
[0058] Take the prepared AdH5sN1 P0 and AdH5mN1 P0, and use the DNA rapid extraction kit produced by Thermo to extract the target DNA (adenovirus DNA containing mN1 coding sequence or sN1 coding sequence).
[0059] The adopted primers are as follows: The nucleotide sequence of the forward primer T7 from 5' end to 3' end is as follows: TAATACGACTCACTATAGGG; The nucleotide sequence of the reverse primer V5 from 5' end to 3' end is as follows: ACCGAGGAGAGGGTTAGGGAT.
[0060] The reaction procedure is as follows: Pre-denaturation: 94℃ 5 min; denaturation: 94℃ 30 s, 30 cycles; annealing: 58℃ 30 s; extension: 72℃ 2 min; termination: 72℃ 8 min.
[0061] The electrophoresis identification is as follows: 1% agarose gel electrophoresis (80V, 40min) is used to separate and identify the target DNA fragments, and the results are shown in Figure 3 From the figure, it can be seen that the fragments at 516bp and 795bp should be clearly visible.
[0062] The sequencing and alignment results are shown in Figure 4 , Figure 5 , Figure 6 and Figure 7 , which shows that the constructed AdH5mN1 and AdH5sN1 recombinant adenovirus carries no error in forward and reverse sequencing of the coding sequence.
[0063] Test Example 3: Anti-tumor experiment of AdH5mN1 and AdH5sN1 in vivo.
[0064] I. Materials.
[0065] B16F1 cells: purchased from the Basic Medicine Cell Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences; C57BL / 6: purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. AdH5mN1: constructed according to the method provided in Example 1, VP = 2.4 x 10 12 ; AdH5sN1: constructed according to the method provided in Example 1, VP = 3.24 x 10 12 ; AdH5eGFP (control adenovirus carrying green fluorescent protein): constructed by a conventional method, VP = 4.3 x 10 12 ; Wherein, VP is the abbreviation of Viral Particles in English.
[0066] II. The animal experiment process is as follows: Inoculation of tumor cells: 24 6-8-week-old C57BL / 6 female mice were divided into 4 groups (AdH5sN1, AdH5mN1, AdH5eGFP control group, PBS control group), and each was subcutaneously inoculated with B16F1 tumor cells 2.0 x 10 5 / mouse in the left groin.
[0067] On the 4th day after inoculation of tumor cells, black spots were observed at the inoculation site of the mice, but they did not protrude from the skin surface. On the 6th day, melanoma grew at the injection site, protruding from the skin surface. On the 9th day, the tumor diameter was about 6-7 mm. The short and long diameters of the tumor were measured, the tumor volume was calculated, and intratumoral injection of vaccine was started.
[0068] Intratumoral injection: On the 9th day after inoculation of tumor cells, sterile PBS, AdH5sN1, AdH5mN1 and AdH5eGFP were injected according to the grouping, and each mouse was injected with 100 μL of sterile PBS (containing 10 10 vp / 100 μL of corresponding recombinant adenovirus) or 100 μL of sterile PBS (PBS control group) intratumorally. On the 13th day, the measurement was repeated and injected again, and on the 17th day, the measurement was repeated once.
[0069] The number of days after inoculation of tumor cells in mice was taken as the abscissa, and the size of the tumor volume was taken as the ordinate to draw a curve, as shown in Figure 8 From the figure, it can be seen that the AdH5sN1 group and the AdH5mN1 group have obvious inhibitory effect on tumor growth, and the AdH5mN1 group has more obvious inhibitory effect on tumor growth than the AdH5sN1 group, and the difference is statistically significant.
[0070] B16F1 is a highly malignant, fast proliferating tumor, the recombinant adenovirus vector carrying the sN1 coding gene and / or the mN1 coding gene provided by the application has obvious inhibitory effect on the tumor, and the result shows that the sN1 coding gene and / or the mN1 coding gene is expected to be applied to an antitumor drug preparation.
[0071] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. A coding sequence for enhancing HMGN1 expression, characterized in that The nucleotide sequence of the coding sequence includes at least an expression enhancing sequence region, a secretion promoting sequence region, a main sequence region and a termination sequence region connected in sequence from the 5' end to the 3' end; The expression enhancing sequence region is used to increase the expression of HMGN1 protein, the secretion promoting sequence region is used to promote the secretion of HMGN1 protein by cells, the main sequence region is used to encode HMGN1 protein, and the termination sequence region is used to terminate the translation of HMGN1 protein.
2. The coding sequence for enhancing HMGN1 expression according to claim 1, wherein The nucleotide sequence of the expression-enhancing sequence region is shown in SEQ ID NO.1, the nucleotide sequence of the secretion-promoting sequence region is shown in SEQ ID NO.2, and the nucleotide sequence of the main sequence region is shown in SEQ ID NO.
3.
3. The coding sequence for enhancing HMGN1 expression according to claim 1, wherein The nucleotide sequence of the termination sequence region is selected from any one of TAA, TAG and TGA.
4. The coding sequence for enhancing HMGN1 expression according to claim 1, wherein The secretory sequence region encodes any one of the following proteins: Protein I, the amino acid sequence of which is shown in SEQ ID NO.4; Protein II, the amino acid sequence of which is shown in SEQ ID NO.5; Protein III, the amino acid sequence of which is shown in SEQ ID NO.6; Protein IV, the amino acid sequence of which is shown in SEQ ID NO.7; Protein V, the amino acid sequence of which is shown in SEQ ID NO.8; Protein VI, the amino acid sequence of which is shown in SEQ ID NO.9; Protein VII, the amino acid sequence of which is shown in SEQ ID NO.10; Protein VIII, the amino acid sequence of which is shown in SEQ ID NO.11; Protein IX, the amino acid sequence of which is shown in SEQ ID NO. 12; Protein X, the amino acid sequence of which is shown in SEQ ID NO.13; Protein XI, the amino acid sequence of which is shown in SEQ ID NO. 14; Protein XII, the amino acid sequence of which is shown in SEQ ID NO. 15; Protein XIII, the amino acid sequence of which is shown in SEQ ID NO. 16; Protein XIV, the amino acid sequence of which is shown in SEQ ID NO. 17; Protein XV, the amino acid sequence of which is shown in SEQ ID NO. 18; Protein XVI, the amino acid sequence of which is shown in SEQ ID NO.
19.
5. The coding sequence for enhancing HMGN1 expression according to claim 1, wherein It also includes an adjustment reading sequence region, a first cloning site sequence region, a tag sequence region, a second cloning site sequence region and a transmembrane sequence region sequentially connected between the main sequence region and the termination sequence region along the direction from the 5' end to the 3' end; The adjustment reading sequence region is used to ensure the correct synthesis of HMGN1 during the expression of the main sequence region, the first cloning site sequence region is a region consisting of restriction endonuclease recognition sites, the tag sequence region is a c-Myc tag, and the second cloning site sequence region is Eco RI cloning site, and the transmembrane sequence region is used to anchor HMGN1 to the cell membrane surface.
6. The coding sequence for enhancing HMGN1 expression according to claim 5, wherein The nucleotide sequence of the adjusted reading sequence region is TT.
7. The coding sequence for enhancing HMGN1 expression according to claim 5, wherein The nucleotide sequence of the first cloning site sequence region is shown as SEQ ID NO. 20, the nucleotide sequence of the tag sequence region is shown as SEQ ID NO. 21, and the nucleotide sequence of the second cloning site sequence region is GAATTC.
8. The coding sequence for enhancing HMGN1 expression according to claim 5, wherein The nucleotide sequence of the transmembrane sequence region is shown in SEQ ID NO.
22.
9. Use of a coding sequence for enhancing HMGN1 expression, characterized in that: The coding sequence for enhancing HMGN1 expression according to any one of claims 1 to 8, wherein the application includes use in preparing an anti-tumor pharmaceutical preparation.
10. The use of the coding sequence for enhancing HMGN1 expression according to claim 9, characterized in that: The pharmaceutical preparation includes an adenovirus vector vaccine.