Dendritic cell for knocking out or knocking down ATF6 and application thereof

Abstract

The invention relates to the technical field of biological medicines, in particular to a dendritic cell with ATF6 knocked out or knocked down, and application of the dendritic cell with ATF6 knocked out or the dendritic cell to treatment and / or prevention of sepsis by reducing generic apoptosis of the dendritic cell, especially effective improvement of multi-organ injury caused by sepsis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedicine, and particularly relates to dendritic cells with knocked out or knocked down ATF6, and treatment and / or prevention of sepsis by reducing the pan-apoptosis of dendritic cells through knocking out or knocking down ATF6 or the dendritic cells. BACKGROUND

[0002] The sharp decrease in the number of circulating immune cells caused by cell death during sepsis is the main reason for the failure or even paralysis of the body's immune response. A large number of previous studies have confirmed that a large number of DCs undergo apoptosis, pyroptosis and necroptosis under sepsis exposure, which is closely related to immune response disorders, multiple organ dysfunction and high mortality. In fact, immune cells can simultaneously undergo apoptosis, pyroptosis and necroptosis under sepsis conditions, and there is a complex interaction network between the three, such as activated Caspase-1 can cleave aspartate activation site Caspase-7, mixed lineage kinase domain-like protein (MLKL) in macrophages can activate NOD-like receptor pyroptosis domain-related protein 3 (NLRP3), thereby causing cell death. Studies have found that the zinc finger protein (ZBP1) sensor can simultaneously activate Caspase-8 (apoptosis), GSDMD (pyroptosis) and MLKL (necroptosis) related pathways during microbial infection, suggesting that the three types of programmed cell death may be triggered by a single upstream signal. In addition, previous studies have confirmed that a large number of DCs undergo apoptosis during sepsis, and inhibition of apoptosis cannot completely restore immune response balance, indicating that a single cell death mode cannot completely reveal the fundamental cause of DC reduction and immune function inhibition during sepsis.

[0003] PANoptosis is an inflammatory programmed cell death pathway named in 2019, which integrates the key features of apoptosis, pyroptosis and necroptosis, but cannot be explained by any of the three pathways alone, forming a regulatory mechanism centered on PANoptosome. The formation and activation of PANoptosome is the key mechanism of PANoptosis, including ZBP1 PANoptosome, AIM2 PANoptosome, MLKL PANoptosome, RIPK1 PANoptosome, NLRC4 PANoptosome and NLRP12 PANoptosome, which are similar to inflammasomes and are composed of specific innate immune sensors, adapters and catalytic effectors. Under the stimulation of pathogen-associated molecular patterns (PAMP) and damage-associated molecular patterns (DAMP), the body immediately responds and initiates innate immune sensors, which interact with the linker molecule containing apoptosis-associated speck-like protein (ASC) in the cytoplasm, and together promote the activation of downstream cell death effectors representing cell pyroptosis (CASP-1 and GSDMD), apoptosis (CASP-3 / 7) and necroptosis (RIPK3 and MLKL). It has also been confirmed that PANoptosis is involved in the occurrence and development of various diseases, such as infectious diseases, metabolic diseases, immune diseases, neurodegenerative diseases and cancer, providing new ideas for the treatment of clinical diseases.

[0004] Activating Transcription Factor 6 (ATF6) is one of the key effector pathways of unfolded protein response (UPR). Under the condition of ER-stress, ATF6 dissociates from glucose-regulated protein 78 (GRP78) and enters the Golgi apparatus, and then is cleaved into a protein with transcription factor activity and translocates from the Golgi membrane to the nucleus, promoting the expression of related target genes, and then regulating ER-stress to maintain endoplasmic reticulum homeostasis and cell function stability and survival. However, the relationship between ATF6 and PANoptosis activation and the related molecular mechanisms are not clear at this stage, and there is no report on the relationship between PANoptosis and multiple organ injury in sepsis.

[0005] The prior art shows that the mechanisms of different organ injuries are not completely the same, and the prevention and treatment measures for different organ injuries in sepsis are also different. SUMMARY

[0006] The present application discloses that the peripheral immunosuppression state caused by massive apoptosis of DCs (especially pyroptosis of non-canonical pathway) is a common factor affecting multi-organ damage by constructing non-human animal models knocking out or knocking down ATF6, and finds that reducing ATF6 can treat sepsis and multi-organ damage from the whole body immune level, rather than single organ damage.

[0007] Specifically, the present application provides the following solutions:

[0008] In a first aspect, the present application provides a dendritic cell with knocked out or knocked down activating transcription factor 6 (ATF6) or a construction method thereof, wherein the dendritic cell is knocked out or knocked down by targeting exon 2-4 of the ATF6 gene.

[0009] Preferably, the knocking out method comprises one or more of CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0010] Preferably, the knocking down method comprises RNA interference.

[0011] Preferably, the sgRNA used in the construction method has a target sequence of CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1) and / or GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

[0012] In one specific embodiment of the present application, the construction method comprises introducing sgRNA and Cas9 protein into the dendritic cell.

[0013] In a second aspect, the present application provides a construction method of a non-human animal with knocked out or knocked down ATF6, wherein the construction method comprises knocking out or knocking down by targeting exon 2-4 of the ATF6 gene.

[0014] Preferably, the knocking out method comprises one or more of CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0015] Preferably, the knocking down method comprises RNA interference.

[0016] Preferably, the sgRNA used in the construction method has a target sequence of CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1) and / or GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

[0017] In one embodiment of the present application, the method for constructing comprises introducing sgRNA and Cas9 protein into the non-human animal.

[0018] Preferably, the non-human animal has reduced or no expression of ATF6 in dendritic cells.

[0019] The non-human animal is preferably a non-human mammal, more preferably a rodent, such as a rat or a mouse.

[0020] In a third aspect of the present application, there is provided a use of a non-human animal or a dendritic cell having reduced expression of ATF6 or having ATF6 knocked out or knocked down, or a use of the method for constructing, in studying the mechanism of the dendritic cell paraptosis pathway, or in the preparation of a medicament for treating and / or preventing a disease associated with paraptosis.

[0021] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0022] Preferably, the disease associated with paraptosis comprises a disease of the nervous system, a disease of the digestive system, a cardiovascular disease, an infectious disease, and a tumor.

[0023] In one embodiment of the present application, the disease associated with paraptosis is sepsis.

[0024] In a fourth aspect of the present application, there is provided a use of a non-human animal or a dendritic cell having reduced expression of ATF6 or having ATF6 knocked out or knocked down, or a use of the method for constructing, in the preparation of a medicament for treating and / or preventing sepsis.

[0025] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0026] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0027] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0028] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0029] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0030] Preferably, the ATF6 is knocked out or knocked down in dendritic cells.

[0031] Preferably, the method of knocking out comprises one or more of CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0032] Preferably, the method of knocking down comprises RNA interference.

[0033] Further preferably, the knocking out or knocking down comprises using gRNA.

[0034] Preferably, the target sequence of the sgRNA comprises CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1) and / or GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

[0035] The sepsis comprises one or more of liver injury, lung injury, kidney injury or heart injury caused by sepsis.

[0036] In a fifth aspect of the present application, there is provided use of a dendritic cell with reduced expression level of ATF6 or with ATF6 knocked out or knocked down or the dendritic cell as described above in the preparation of a medicament for treating and / or preventing liver injury, lung injury, kidney injury or heart injury caused by sepsis.

[0037] Preferably, the reducing expression level of ATF6 comprises reducing expression level of ATF6 in the dendritic cell.

[0038] Preferably, the expression level is mRNA expression level or protein expression level.

[0039] In one embodiment of the present application, the reducing expression level of ATF6 is by knocking out or knocking down ATF6.

[0040] In a sixth aspect of the present application, there is provided a reagent for knocking out or knocking down ATF6, the reagent comprising sgRNA.

[0041] The target sequence of the sgRNA comprises CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1) and / or GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

[0042] Preferably, the reagent comprises sgRNA and Cas9 protein.

[0043] In a seventh aspect of the present application, there is provided a method for improving pan-apoptosis of a dendritic cell, the method comprising reducing expression level of ATF6 or knocking out or knocking down ATF6, or using the dendritic cell as described above.

[0044] In an eighth aspect of the present application, a method for treating and / or preventing sepsis or liver injury, lung injury, kidney injury or heart injury caused by sepsis is provided, which comprises reducing the expression level of ATF6 or knocking out or knocking down ATF6.

[0045] In a ninth aspect of the present application, a method for treating and / or preventing sepsis or liver injury, lung injury, kidney injury or heart injury caused by sepsis is provided, which comprises administering the dendritic cell or the agent for knocking out or knocking down ATF6 described above to a subject in need.

[0046] In a tenth aspect of the present application, an application of ATF6 as a target in preparing a drug for improving the general apoptosis of dendritic cells is provided.

[0047] In an eleventh aspect of the present application, a drug for treating sepsis is provided, which reduces the expression level of ATF6 or can knock out or knock down ATF6.

[0048] Preferably, the drug comprises the agent described above.

[0049] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0050] The drug of the present application can be used by formulating a pharmaceutical composition in any manner known in the art. Such a composition comprises the active ingredient, plus one or more pharmaceutically acceptable carriers, diluents, fillers, binders and other excipients, depending on the mode of administration and the dosage form designed. Therapeutically inert inorganic or organic carriers known to those skilled in the art include, but are not limited to, lactose, corn starch or its derivatives, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, sucrose, ethanol, glycerol, and the like, various preservatives, lubricants, dispersants, flavorings, humectants, antioxidants, sweeteners, colorants, stabilizers, salts, buffers, and the like, which are added as needed to help the stability of the formulation or to help improve the activity or its bioavailability or, in the case of oral administration, to produce an acceptable taste or smell. The formulation that can be used in such a composition can be in the form of the original compound itself, or optionally in the form of a pharmaceutically acceptable salt thereof. The drug of the present application can be administered alone, or in various combinations, and in combination with other therapeutic agents. The composition thus formulated can be administered to the drug in any appropriate manner known to those skilled in the art as needed. When a pharmaceutical composition is used, a safe and effective amount of the drug of the present application is administered to a human, and the specific dose should also take into account the route of administration, the health status of the patient, and the like, which are within the skill of a skilled physician.

[0051] The pharmaceuticals of the present application can be prepared into various dosage forms as needed. These include, but are not limited to, tablets, solutions, granules, patches, ointments, capsules, aerosols, or suppositories for transdermal, mucosal, nasal, buccal, sublingual, or oral use.

[0052] The route of administration of the pharmaceuticals of the present application is not limited as long as it can exert the desired therapeutic or prophylactic effect, including but not limited to intravenous, intraperitoneal, intraocular, intraarterial, intrapulmonary, oral, intravesicular, intramuscular, intratracheal, subcutaneous, transdermal, transpleural, topical, inhalation, transmucosal, transdermal, enteral, intraarticular, intraventricular, rectal, vaginal, intracranial, intraurethral, intraliver, intratumoral. In some cases, it can be administered systemically. In some cases, it is administered topically.

[0053] The dosage of the pharmaceuticals of the present application is not limited as long as the desired therapeutic or prophylactic effect is obtained. The dosage of the therapeutic or prophylactic pharmaceuticals of the present application can be determined using, for example, the therapeutic or prophylactic effect on the disease as an index.

[0054] The "subject" of the present application can be a human or a non-human animal.

[0055] The non-human animal of the present application is a non-human mammal, including but not limited to rodents, lagomorphs, even-toed ungulates, odd-toed ungulates, primates, and carnivores. Rodents include but are not limited to Muridae (mice, rats) and Cricetidae (hamsters). Lagomorphs include but are not limited to Leporidae (rabbits). Even-toed ungulates include but are not limited to Bovidae (cattle, sheep) and Suidae (pigs). Odd-toed ungulates include but are not limited to Equidae (horses). Primates include but are not limited to Cercopithecidae (macaques), Gibbonidae (gibbons), and Pan (chimpanzees). Preferably, the mammal is a rodent or a primate.

[0056] The "treatment" of the present application encompasses treating the relevant disease or disease state in a human or non-human animal suffering from the relevant disease or disease state, and includes:

[0057] (1) preventing the disease or disease state from occurring in a human or non-human animal, especially when such human or non-human animal is predisposed to the disease state, but has not yet been diagnosed as having the disease state;

[0058] (2) inhibiting the disease or disease state, i.e., arresting its development; or

[0059] (3) relieving the disease or disease state, i.e., causing the disease or disease state to regress.

[0060] The "effective amount" of the present application refers to the amount or dosage of the pharmaceuticals of the present application that provides the desired treatment or prevention after administration to an individual or an organ in a single or multiple doses.

[0061] The "prevention" described in the present application means a manner implemented in order to prevent or delay the occurrence of a disease or a disorder or a symptom in a body.

[0062] The "pharmaceutically acceptable" described in the present application means that neither a biological body is significantly stimulated nor the biological activity and characteristics of an active substance of an administered product are inhibited. BRIEF DESCRIPTION OF DRAWINGS

[0063] Hereinafter, embodiments of the present application will be described in detail with reference to the accompanying drawings, in which:

[0064] Figure 1 A targeting strategy for ATF6 gene knockout is shown;

[0065] Figure 2 A diagram for verifying the ATF6 knockout effect of mice is shown, in which Figure A represents a PCR amplification result using primer 1, Figure B represents a PCR amplification result using primer 2, WT is a wild type mouse, M is a marker, and Water is a water control;

[0066] Figure 3 shows the ATF6 protein and gene expression in sepsis, in which Figure A represents the detection of ATF6 protein expression in mouse DC by Western blotting; Figure B represents a subject introduction; Figure C represents the detection of ATF6 mRNA expression in peripheral blood DC of sepsis patients and healthy controls by real-time fluorescent quantitative PCR, WT represents a wild type mouse, ATF6- / - represents an ATF6 knockout mouse, Sham represents a sham operation group, CLP 24h represents 24h after cecal ligation and puncture, and *** represents P<0.001;

[0067] Figure 4 Transmission electron microscopy observation of cell and organelle structure changes in DC in sepsis is shown, in which WT-Sham represents a sham operation group constructed from a wild type mouse, WT-Sepsis represents a sepsis model group constructed from a wild type mouse, ATF6- / -Sham represents a sham operation group constructed from an ATF6 knockout mouse, and ATF6- / -Sepsis represents a sepsis model group constructed from an ATF6 knockout mouse;

[0068] Figure 5 Flow cytometry detection of DC apoptosis and necrosis in sepsis is shown, in which WT represents a wild type mouse, ATF6- / - represents an ATF6 knockout mouse, CON represents a control group, LPS 24h represents 24h after LPS stimulation, Sham represents a sham operation group, CLP 24h represents 24h after cecal ligation and puncture, and **** represents P<0.0001;

[0069] Figure 6Figures 6A-6D show the effect of ATF6 gene knockout on the activation of DC pan- apoptosis in sepsis, wherein Figure 6A represents the detection of pan-apoptosis related protein expression by Western blotting; Figure 6B represents the co-localization of p-MLKL and p-RIPK3 observed by laser confocal microscopy, WT represents wild-type mice, ATF6- / - represents ATF6 knockout mice, LPS 24h represents stimulation with lipopolysaccharide (LPS, 1 μg / ml) for 24h, CON or Control represents the control group; Merge represents the merged image, Enlarged represents the enlarged image;

[0070] Figure 7 Figures 7A-7D show the effect of ATF6 gene knockout on the peripheral immune suppression state of sepsis mice, wherein Figure 7A represents the proportion of CD3 + T cells, Figure 7B represents the proportion of CD3 + CD4 + T cells, Figure 7C represents the proportion of CD3 + CD4 + FOXP3 + Treg cells in peripheral blood T lymphocytes detected by flow cytometry; Figure 7D represents the cytokine content in peripheral blood serum detected by ELISA. WT represents wild-type mice, ATF6- / - represents ATF6 knockout mice, Sham represents the sham operation group, CLP 24h represents 24h after cecal ligation and puncture, * represents P<0.05, **** represents P<0.0001.

[0071] Figure 8 Figures 8A-8B show the effect of ATF6 gene knockout on the multiple organ injury and survival rate of sepsis mice, wherein Figure 8A represents the HE staining of mouse heart, liver, lung and kidney tissues to compare the pathological morphological changes (left) and scores (right) of each group; Figure 8B represents the observation and recording of the 7d survival rate of mice, WT represents wild-type mice, ATF6- / - represents ATF6 knockout mice, Sham represents the sham operation group, CLP 24h represents 24h after cecal ligation and puncture, * represents P<0.05. DETAILED DESCRIPTION

[0072] Unless otherwise defined, all terms used in disclosing the application, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this application belongs. By means of example, the terms "including", "containing" or "comprising" and variations thereof do not specify an exhaustive or total list of elements or components as used when describing compositions of claimed applications.

[0073] The technical solutions of the present application are described below through specific examples. It should be understood that one or more steps mentioned in the present application do not exclude other methods and steps before and after the combination steps, or other methods and steps can be inserted between these explicitly mentioned steps. It should also be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. Unless otherwise specified, the numbering of each method step is only for the purpose of identifying each method step, and is not intended to limit the arrangement order of each method or to limit the scope of the implementation of the present application. Changes or adjustments of the relative relationship can also be considered as the scope of the implementation of the present application without substantial technical content changes.

[0074] The raw materials and instruments used in the examples are not specifically limited in source, and can be purchased on the market or prepared according to the conventional methods well known to those skilled in the art.

[0075] The main experimental techniques and methods used in the examples are as follows:

[0076] 1. Genotype identification of mouse tail PCR

[0077] (1) DNA extraction

[0078] TaKaRa MiniBEST Universal Genomic DNA Extraction Kit (Ver. 5.0 Code No. 9765) was used to obtain high-purity genomic DNA. The steps are as follows:

[0079] a. In a microcentrifuge tube, add 180 μL buffer GL, 20 μL protease K and 10 μL RNase A to each tail (2-5 mm).

[0080] b. Incubate the microcentrifuge tube at 56°C overnight.

[0081] c. Centrifuge in a microcentrifuge at 12000 rpm for 2 minutes to remove impurities.

[0082] d. Add 200 μL buffer GB and 200 μL anhydrous ethanol and mix well.

[0083] e. Place the centrifugal column in the collection tube. Place the sample on the centrifuge and centrifuge at 12000 rpm for 2 min. Discard the effluent.

[0084] f. Add 500 μL buffer WA to the centrifugal column and centrifuge at 12000 rpm for 1 minute. Discard the effluent.

[0085] g. Add 700 μL buffer WB to the centrifugal column and centrifuge at 12000 rpm for 1 min. Discard the effluent. (Note: Ensure that the buffer WB has been pre-mixed with 100% ethanol. When adding the buffer WB, add the tube wall to wash away the residual salt.)

[0086] h. Repeat step g.

[0087] i. Place the spin column in a collection tube and centrifuge at 12000 rpm for 2 min.

[0088] j. Place the spin column in a new 1.5 ml centrifuge tube, add 50-200 μL sterile water or elution buffer to the center of the column membrane, and let stand for 5 min.

[0089] k. To elute the DNA, centrifuge the column at 12000 rpm for 2 min. To increase the yield of DNA, add the flow-through and / or 50-200 μL sterile water or elution buffer to the center of the spinning column membrane, and let the column stand for 5 min. Centrifuge at 12000 rpm for 2 min.

[0090] l. Quantification of genomic DNA. The eluted genomic DNA can be quantified by electrophoresis.

[0091] (2) The PCR reaction system (primer concentration: 10 μM) is shown in Table 1.

[0092] Table 1

[0093] Ingredients ×1 Mouse tail genomic DNA 1.5 μl Forward primer (10 μM) 1.0 μl Reverse primer (10 μM) 1.0 μl P520 Taq DNA polymerase 12.5 μl ddH2O 9 μl Total volume 25 μl

[0094] The primers used in the PCR are as follows:

[0095] Primer 1: (annealing temperature 60°C)

[0096] F1: 5'-CTTGGCAGCACCTTGACCTTC-3' (SEQ ID NO: 3)

[0097] R1: 5'-TGGCTCGGCAGGGAGAAATG-3' (SEQ ID NO: 4)

[0098] The length of the PCR product amplified by primer 1 is 801 bp, and the wild-type allele is 7621 bp.

[0099] Primer 2: (annealing temperature 60°C)

[0100] F2: 5'-AGAAATCTGTTACCTCCTGGGTTC-3' (SEQ ID NO: 5)

[0101] R1: 5'-TGGCTCGGCAGGGAGAAATG-3' (SEQ ID NO: 4)

[0102] The length of the product amplified by primer 2 is 594 bp.

[0103] If it is a homozygote, there will be a single band of 801 bp; if it is a heterozygote, there will be two bands of 801 bp and 594 bp; the wild-type allele will be a single band at 594 bp.

[0104] (3) PCR reaction conditions are shown in Table 2.

[0105] Table 2

[0106]

[0107] 2. Isolation of Mouse Splenic DCs

[0108] (1) Miltenyi MiniMACS magnetic bead method (CD11c + ) Isolation of spleen CD11c + DC: Experimental mice were sacrificed and fixed in the right lateral decubitus position on an operating board. After abdominal disinfection, the skin was incised to expose the spleen. The spleen was bluntly dissected in a cleanroom and placed in a 15ml sterile centrifuge tube filled with pre-chilled PBS. Under sterile conditions in the cleanroom, the splenic fascia and other connective tissue were removed using toothless forceps. The spleen was carefully minced and transferred to a pre-moistened 75μm cell strainer for thorough trituration. The cell strainer was rinsed continuously with pre-chilled PBS. The cell suspension was collected and mixed. An appropriate amount of PBS was then added, and the cells were centrifuged at 1500 rpm for 5 minutes. The supernatant was discarded and the suspension was resuspended in a 15ml centrifuge tube. In another centrifuge tube, 4ml of mouse organ lymphocyte separation buffer was added. Using a disposable sterile pipette, the cell suspension was slowly layered on top of an equal volume of lymphocyte separation buffer and centrifuged at 3000 rpm for 15 minutes. After centrifugation, the centrifuge tube was carefully removed, and the middle haze layer (mononuclear cells) was aspirated using a sterile pipette into a fresh centrifuge tube. The cells were washed three times with PBS and counted. The isolated mononuclear cell suspension was centrifuged at 1500 rpm for 5 min and the supernatant was discarded. 7 Resuspend cells in 40 μl MACS buffer. 8 Add 100 μl CD11c + The magnetic beads were operated and placed in a 4°C refrigerator for 10-15 minutes. After that, pre-cooled PBS was added to the cell suspension and centrifuged at 1500 rpm for 5 minutes. The supernatant was discarded and the cells were resuspended in MACS buffer according to the proportion. A separation column of appropriate specifications (MS column upper limit is 2×10 8 cells; the upper limit of LS column is 2×10 9Cells), before use, first rinse the separation column with 500μl (MS) or 1ml (LS) PBS, then add the cell suspension into the column, and when the liquid in the column is clear, add 500μl (MS) or 1ml (LS) PBS to wash, and wash 3 times in total. After the last wash, remove the separation column from the magnetic field and place it in a 15ml centrifuge tube, add 1ml (MS) or 2.5ml (LS) PBS to the column, and quickly use the piston to push out the target cells adsorbed in the separation column, i.e., mouse spleen CD11c + DC. The cells were washed with PBS and then counted for subsequent flow cytometry analysis.

[0109] (2) EasySep CD11c + Isolation of mouse spleen CD11c by immunomagnetic cell sorting + DC: Transfer the mouse spleen to a culture dish and remove the fascia tissue. Use toothless forceps to tear the spleen into pieces and grind it with a disposable 75μm cell strainer. Collect the spleen cell suspension, centrifuge at 1500rpm for 5min, discard the supernatant and count. 8 Resuspend spleen cells in 1 ml PBS, then block the sample by adding 50 μl rat serum per ml of cell suspension, mix thoroughly on a shaker, and incubate at room temperature for 5 minutes. At the same time, mix Component A and Component B at a ratio of 1:1 and let stand at room temperature for 5 minutes. 8 Add 50 μl of AB mixture to the blocked spleen cell suspension, mix well and incubate at room temperature for 5 minutes. Vortex the RapidSpheres (CD11c + magnetic beads) for 30 seconds (s), according to the instructions for each 1 × 10 8 Add 60μl of magnetic beads to spleen cells, mix them in proportion and incubate at room temperature for 3 minutes. Transfer the cell suspension to a 14ml separation column and resuspend it to 10ml with PBS [containing 2% fetal bovine serum (FBS)]. Place it on an EasySep magnetic column and let it stand at room temperature for 3 minutes. Then pour the liquid in the column into the waste tank, remove the separation column, blow off the cells adhering to the tube wall with a disposable pipette and resuspend it to 10ml and mix. Repeat this step three times. The last 5ml PBS resuspension is the mouse spleen CD11c + DC. Wash the cells and count them for subsequent Western blotting.

[0110] 3. Isolation of human peripheral blood DCs (PBDCs):

[0111] EasySep Human Pan-DC Pre-Enrichment Kit immunomagnetic beads cell sorting technology to separate human PBDCs: take about 10 ml of peripheral blood from healthy controls and sepsis patients, centrifuge at 3000 rpm for 10 min, resuspend the cell pellet in PBS to 3 times the original volume, pass through a 40 pm cell filter, add 15 ml of human peripheral blood lymphocyte separation medium to a 50 ml centrifuge tube, slowly add an equal volume of human peripheral blood, centrifuge at 800 g for 30 min at room temperature with an acceleration of 9 and a deceleration of 1, aspirate the ring-shaped cell layer, wash once with PBS, resuspend the pellet in PBS to 5 ml, centrifuge at 1500 rpm for 5 min, discard the supernatant, resuspend the cell pellet in 5 x 10 7

[0112] 4. Western blotting to detect the expression levels of ATF6 and cell pan-apoptosis related proteins:

[0113] Collect cells from each group, add appropriate amount of lysis buffer (RIPA + phosphatase inhibitor + protease inhibitor) according to the total number of cells, place the above samples on ice for 30 min, and take out the vortex shaker oscillator every 5 min; then rapidly freeze-thaw the sample with liquid nitrogen for 3 times. Use a low-temperature (4°C) high-speed (12000 rpm) centrifuge for 30 min; collect the supernatant of each sample after centrifugation, and quantitate using a BCA protein quantitation kit. Add 5x protein loading buffer and mix well, denature the protein in a metal bath at 95°C for 5 min. Store the obtained sample at -20°C for later use. Collect cells from each group and lyse them, and detect the protein concentration by BCA method. Separate the protein samples by polyacrylamide (SDS-PAGE) electrophoresis, transfer the protein to a polyvinylidene fluoride membrane (PVDF membrane) by wet transfer, then block in a fast blocking solution at room temperature for 10 min, incubate the primary antibody (1:1000) at 4°C overnight and the secondary antibody (1:5000) at room temperature for 1 h, develop using a hypersensitive ECL chemiluminescence solution, observe and image using an Image Quant LAS 4000 gel imaging system, and analyze the gray value of the target protein band using Image J software.

[0114] ​5. Detection of ATF6 mRNA expression level by real-time fluorescence quantitative PCR:

[0115] 1) RNA extraction: Collect cells from each group, centrifuge at 1800 rpm for 5 min, discard the supernatant, and add <5×10 6 Add 500μl of Buffer CRL to each cell and vortex until no obvious cell clumps are present. Transfer all the above lysates to RNA Columns I (each in a 2ml Collection Tube), centrifuge at 12000rpm for 30sec, and discard the waste liquid; add 500μl of Buffer RNA to RNA Columns I, centrifuge at 12000rpm for 30sec, and discard the waste liquid; add 500μl of Buffer RW to RNA Columns I, centrifuge at 12000rpm for 30sec, and discard the waste liquid; return RNA Columns I to the collection tube, centrifuge at 12000rpm for 30sec, and discard the waste liquid; carefully transfer RNA Columns I to a new 1.5ml RNAase-free centrifuge tube, add 20-100μl of RNAase-free ddH2O to the adsorption column membrane, incubate at room temperature for 1min, and centrifuge at 12000rpm for 1min to elute RNA; the extracted total RNA can be used directly in downstream experiments or stored at -80℃.

[0116] 2) Quality testing: RNA was tested using a microplate reader. OD 260 and OD 280 The value at OD 260 / OD 280 Between 1.8 and 2.0, it indicates good quality; below or above this range indicates unqualified quality.

[0117] 3) Reverse transcription: Prepare the mixture shown in Table 3 in an RNAase-free centrifuge tube.

[0118] Table 3

[0119]

[0120] Use a pipette to gently pipette 8-10 times to mix thoroughly, and centrifuge briefly to collect the liquid at the bottom of the tube.

[0121] The reaction procedure is shown in Table 4.

[0122] Table 4

[0123] 50℃ 15 min 85℃ 5 sec

[0124] The reverse transcription product can be used immediately for qPCR reaction, or stored at -20°C and used within half a year; long-term storage is recommended to be stored at -80°C after sub-packaging, and the cDNA should be avoided from repeated freezing and thawing.

[0125] 4) Real-time fluorescent quantitative PCR, the primers used are shown in Table 5.

[0126] Table 5

[0127]

[0128] Prepare the mixture shown in Table 6 in a qPCR tube.

[0129] Table 6

[0130]

[0131] Perform qPCR reaction according to the conditions shown in Table 7.

[0132] Table 7

[0133]

[0134] a) Standard program selection 10 sec; fast program minimum selection 3 sec.

[0135] b) Standard program selection 30 sec; fast program: for amplicons within 200 bp, the minimum extension time can be set to 10 sec; when more than 200 bp, the recommended extension time is 30 sec.

[0136] 5) Data processing: according to 2 -△△Ct Method, analyze the Ct value of each sample. Among them, △Ct represents: target gene Ct-internal reference Ct; △△Ct represents: the target gene △Ct in the sample to be tested-the target gene △Ct in the reference sample; relative sample initial template amount = 2 -△△Ct .

[0137] 6, flow cytometry analysis to detect DC apoptosis and necrosis rate:

[0138] Collect 3x10 5DC / tube, PBS wash sample 1 time, 1x binding buffer wash 1 time, each tube leave 100 μl 1x binding buffer to resuspend cells, set 1 tube negative control, 1 tube single staining 7-AAD, 1 tube single staining PE-Annexin V in blank control group; each experimental group add PE-Annexin V 2.5 μl / tube and 7-AAD 5 μl / tube, incubate at room temperature for 15 min in dark, wash 1 time with 1x binding buffer, add 200 μl 1x binding buffer to resuspend cells in each tube, detect apoptosis and necrosis rate of each group within 1 hour.

[0139] 7. Laser confocal microscope analysis technology detects cell necrotic apoptosis level:

[0140] 2x10 6 Cells / tube were collected in flow cytometry tubes, washed once with PBS, fixed with 4% paraformaldehyde for more than 1 h, washed 3 times with PBS, and broken with 0.3% Triton x-100 for 15 min; washed 3 times with PBS, added p-MLKL (1:200) to 1% BSA and incubated overnight, washed 3 times with PBS, added fluorescent secondary antibody (1:1000) to 1% BSA and incubated at room temperature for 1 h, washed 3 times with PBS; added p-RIPK3 (1:200) to 1% BSA and incubated overnight, washed 3 times with PBS; added fluorescent secondary antibody (1:1000) to 1% BSA and incubated at room temperature for 1 h, washed 3 times with PBS; resuspended the cells in 60 μl PBS, added 35 μl of the cell suspension to an anti-falling glass slide, and then added 5 μl of DAPI containing mounting medium, and covered with an anti-falling cover glass. The expression, localization and co-localization of p-MLKL and p-RIPK3 were observed under an inverted laser confocal microscope.

[0141] 8. Peripheral immunosuppression state of sepsis mice:

[0142] After the peripheral blood mononuclear cells (PBMCs) of sepsis mice were isolated, 1x10 6 PBMCs / tube were collected in flow cytometry tubes, added FITC anti-mouse CD4 antibody and BV510 anti-mouse CD3 antibody each 1 μl under dark conditions, incubated at room temperature for 30 min, resuspended the cells with 500 μl 1x fixation / breaking buffer, mixed and incubated at 4°C overnight. Washed the cells 2 times with 1x FOPX3 breaking buffer, added PE anti-mouse FOXP3 antibody, incubated at room temperature for 45 min in dark. Washed the cells 2 times with 1x breaking buffer, centrifuged at 1500 rpm for 5 min, discarded the supernatant, resuspended the cells with 1x breaking buffer and detected on the machine. Analyzed CD3 +T cells and CD3 + CD4 + T cell proportion in PBMCs and CD4 in different samples + FOXP3 + T(Treg) cell proportion in CD3 + T cells.

[0143] 9. ELISA detection of serum cytokine content:

[0144] At 24 hours after CLP, mouse eyeball blood was collected, and after standing for 1 hour, centrifuged at 7500g for 10 min, and the supernatant was carefully aspirated. According to the ELISA kit instructions, the contents of IL-2, IL-4, IL-10, TGF-β and IFN-γ in the serum were detected to evaluate the peripheral immunosuppression state.

[0145] 10. The organ damage microscopic scoring criteria are shown in Table 8.

[0146] Table 8

[0147]

[0148] Example 1: ATF6 gene knockout

[0149] The CRISPR / Cas9 gene editing technology was used to construct an ATF6 full knockout mouse model. The ATF6 gene (NCBI ID226641, NM_001081304; ENSEMBL: ENSMUSG0000000026663) is located on mouse chromosome 1. Sixteen exons were determined, including the start codon ATG in exon 1 and the stop codon TAG in exon 16 (Transcript Atf6-201: Ensmust000000000027974). Exons 2-4 were targeted sites (see Figure 1 ), which contains a 266bp coding sequence. The effective knockout region is about 6.1kb in size.

[0150] Specific implementation steps: according to the structure of ATF6 gene, design and clone sgRNA expression vector; wherein, the target site sequence of sgRNA is as follows:

[0151] sgRNA1: CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1)

[0152] sgRNA2: GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

[0153] In vitro transfection of Cas9 mRNA and sgRNA; fertilized egg injection, transplantation. The born mice are genetically identified by gene sequencing, and the F1 generation knockout mice are screened. The F1 generation is crossbred to the F2 generation, and the expression of the target gene and protein is detected by gene sequencing and Western blot analysis technology, and the homozygous mice are further screened. The exemplary results are shown in the figures, Figure 2 Mice numbered 61-70 are all mice successfully knocked out of ATF6.

[0154] Example 2: Construction of sepsis model and expression of ATF6

[0155] The construction of the sepsis animal model uses standard CLP surgery to replicate the animal sepsis model, and SPF, male, 6-8 weeks, 20-25g C57B / 6J mice are used for experiments. The mice are adaptively fed in a SPF animal laboratory barrier environment for 3 days (temperature: 20-26℃; daily temperature difference: ≤4℃; relative humidity 40%-70%). The mice are fasted for 12 hours before the experiment, and the sepsis model caused by CLP is constructed; 0.3% sodium pentobarbital solution (10ml / kg) is used to anesthetize the mice by intraperitoneal injection with a 1ml syringe; after anesthesia, the mice are fixed in a supine position on the operation board, the mouse abdomen is disinfected with iodophor, a longitudinal incision is made along the abdominal white line about 1cm below the xiphoid process with ophthalmic scissors, and the cecum is fully exposed and ligated with a suture about 1cm from the distal end of the cecum under direct vision. Then a 22G puncture needle is used to puncture the distal end of the cecum once, avoiding blood vessels, and the cecum is squeezed to make the feces overflow, then the cecum is returned to its original position, the abdominal incision is sutured, and iodophor is used for disinfection. Finally, 1ml of 0.9% normal saline is injected subcutaneously at the back of the mouse neck using a 5ml syringe for fluid resuscitation, and the mouse is kept warm after the operation. The sham operation group of mice only undergoes anesthesia, laparotomy, separation and exposure of the cecum, and then the cecum is returned to its original position, the abdominal incision is sutured and disinfected.

[0156] The postoperative animals exhibit clinical symptoms of sepsis, such as changes in body temperature (fever or hypothermia), rapid heart rate, rapid breathing, etc.; changes in biochemical indicators in the blood, such as elevated white blood cell count, elevated C-reactive protein (CRP) levels, etc., indicating the presence of infection and inflammation; changes in organ function, such as elevated renal function indicators (creatinine, urea nitrogen), changes in liver function indicators (ALT, AST), etc.; postoperative sampling of tissues such as heart, lung, liver, kidney, etc. shows sepsis-related pathological changes such as inflammatory cell infiltration, tissue damage, etc.; within 7 days after model construction, the animals meet the expected characteristics of the sepsis model, i.e. a 50%-70% mortality rate 7 days after the operation, with a peak of 24-48 hours after the operation. The above results show that the sepsis model is successfully constructed.

[0157] The expression of ATF6 protein in DC cells of the sepsis model group and the sham operation group was detected 24 hours after the modeling was successful. The results showed that there was a significant increasing trend Figure 3A Further, sepsis patients and healthy controls were collected (see Table 9 for information of the subjects) Figure 3B and Table 9), the same phenomenon was observed in the peripheral blood DCs of the sepsis patients, and the expression level of ATF6 mRNA in the peripheral blood DCs of the sepsis patients was significantly higher than that of the healthy controls Figure 3C .

[0158] Table 9: Introduction of healthy controls

[0159] Number Gender Age 1 Female 29 2 Male 41 3 Female 41

[0160] Example 3: Reducing the expression level of ATF6 alleviates sepsis by reducing DC pan-apoptosis

[0161] The same number of WT mice and ATF6- / - mice (constructed in Example 1) were used to construct sepsis models and sham operation models by the method of Example 2.

[0162] Transmission electron microscopy observation of DC structure showed that compared with the sham operation group, the organelles such as endoplasmic reticulum and mitochondria of the DCs of the WT mice in the sepsis group appeared structural disorder and significant edema, even vacuolization, and the nucleus was shrunk, while the above phenomena of the DCs of the ATF6- / - mice were reduced under sepsis exposure Figure 4 .

[0163] At the same time, flow cytometry was used to detect the apoptosis and necroptosis of DCs after CLP and under LPS (1 μg / ml) stimulation, and it was found that the WT mice showed significant pan-apoptosis under sepsis exposure, while the proportion of pan-apoptosis of the DCs of the ATF6- / - mice was significantly lower than that of the WT mice Figure 5 .

[0164] Further, Western blot and laser confocal microscopy were used to find that the pan-apoptosis activation and related protein expression of the DCs of the ATF6- / - mice under sepsis exposure were significantly lower than those of the WT mice Figure 6 , indicating that ATF6, as one of the main effector pathways of the unfolded protein response activated by endoplasmic reticulum stress during sepsis, is an important target for mediating pan-apoptosis. In particular, it can be seen from Figure 6 that Casp1-p12, Casp1-p10 have no trend, Casp11-p25 has a trend, GSDMD-N has no trend, and GSDME-N has a trend, indicating that it is likely to affect pyroptosis of the non-canonical pathway, rather than pyroptosis of the non-canonical pathway.

[0165] Example 4: Reducing the expression level of ATF6 alleviates the peripheral immune suppression state under sepsis

[0166] WT mice and ATF6- / - mice (constructed in Example 1) were taken in the same number, and a sepsis model and a sham operation group model were constructed using the method of Example 2.

[0167] The results of flow cytometry analysis showed that the proportion of CD3 + T cells in the PBMC of the ATF6- / - group was significantly increased compared with the WT group Figure 7 A), the proportion of CD4 + T cells was also increased Figure 7 B), and the proportion of Tregs in T cells was reduced Figure 7 C). The serum IL-2 and IFN-γ levels in the ATF6- / - sepsis group were significantly higher than those in the control sepsis group, while the anti-inflammatory cytokines IL-4, IL-10 and TGF-β contents were reduced, and the IFN-γ / IL-4 ratio was increased, indicating that the peripheral immune suppression state of the ATF6- / - sepsis mice was reduced compared with the WT group Figure 7 D). The above results suggest that the knock-out of ATF6 gene in DCs can effectively protect the antigen presentation ability and the activation effect on T cell immune response in sepsis.

[0168] Example 5: Reducing the expression level of ATF6 alleviates organ damage in sepsis

[0169] WT mice and ATF6- / - mice (constructed in Example 1) were taken in the same number, and a sepsis model and a sham operation group model were constructed using the method of Example 2.

[0170] It was found by HE staining that the damage degree of heart, lung, liver and kidney tissues in the WT sepsis mice was significantly higher than that in the ATF6- / - mice Figure 8 A). Further analysis of the survival rate showed that the sham operation group animals of the WT mice and the ATF6- / - mice were all alive, and the mortality rate of the ATF6- / - mice after CLP was significantly reduced compared with the WT mice, and the death peak time was moved forward Figure 8 B). This indicates that the deletion of ATF6 gene in DCs can alleviate the multiple organ damage in sepsis animals, thereby affecting the survival rate of the animals.

[0171] The foregoing description of specific exemplary embodiments of the application is intended to be illustrative only and is not intended to be limiting as to the scope of the application. Many changes and modifications can be suggested to one skilled in the art, and it is intended that the scope of the application encompass such changes and modifications as long as they come within the scope of the appended claims and their equivalents. The examples were chosen and described in order to explain the principles of the application and the practical application thereof and to enable one skilled in the art to best utilize the application, and various exemplary embodiments with various modifications as are suited to the particular use contemplated. It is intended that the scope of the application be defined by the following claims and their equivalents.

Claims

1. A dendritic cell with knockout or knockdown of activating transcription factor 6 (ATF6), characterized in that Targeting exons 2-4 of the ATF6 gene for knockout or knockdown.

2. A method for constructing a non-human animal for knocking out or knocking down ATF6, characterized in that: The construction method includes targeting exons 2-4 of the ATF6 gene for knockout or knockdown.

3. The construction method according to claim 2, characterized in that The target sequence of the sgRNA used in the construction method includes CTTGCCAAGCGTCCACTTTTTGG (SEQ ID NO: 1) and / or GAATACCTGATTTAAGTAATGGG (SEQ ID NO: 2).

4. The construction method according to claim 2 or 3, characterized in that The non-human animal is a non-human mammal, preferably a rodent, such as a rat or a mouse.

5. Use of a non-human animal obtained by knocking out or knocking down ATF6 or the construction method according to any one of claims 2 to 4, or the dendritic cell according to claim 1, in studying the mechanism of the pan-apoptosis pathway of dendritic cells, or in preparing a drug for treating and / or preventing diseases related to pan-apoptosis.

6. The use according to claim 5, characterized in that The diseases associated with pan-apoptosis include nervous system diseases, digestive system diseases, cardiovascular diseases, infectious diseases and tumors.

7. Use of a dendritic cell comprising knocking out or knocking down activating transcription factor 6 (ATF6) or claim 1 in the preparation of a medicament for treating and / or preventing sepsis.

8. The use according to claim 7, characterized in that Knockout or knockdown of ATF6 can treat and / or prevent sepsis by reducing pan-apoptosis of dendritic cells.

9. The use according to claim 7 or 8, characterized in that The sepsis includes one or more of liver damage, lung damage, kidney damage or heart damage caused by sepsis.

10. Use of ATF6 knockout or knockdown or the dendritic cells according to claim 1 in the preparation of a medicament for treating and / or preventing liver injury, lung injury, kidney injury or heart injury caused by sepsis.

Images