Construction method and application of a set of gRNA, RNP complex and gene knockout zebrafish model

By designing specific gRNA and RNP complexes for delivery during the single-cell stage of zebrafish, the problems of embryotoxicity and low survival rate in the construction of zebrafish ccny and cncyl1 gene knockout models were solved. Zebrafish models with ccny, cncyl1, and ccny/ccnyl1 gene knockout were constructed for research on cyclin-related diseases.

CN120796277BActive Publication Date: 2025-12-23WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511293692.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-11
Publication Date
2025-12-23
Estimated Expiration
2045-09-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently construct zebrafish ccny and ccnyl1 gene knockout models, especially dual gene knockout models, which suffer from embryotoxicity and low survival rates. Furthermore, the homology among gene family members increases the complexity of target selection.

Method used

Design specific gRNA and RNP complexes, including Cas9 protein and gRNA with nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2, and construct ccny, cncyl1, and ccny/ccnyl1 gene knockout zebrafish models by delivering the RNP complex during the single-cell stage of zebrafish and combining it with gene sequencing screening.

Benefits of technology

We successfully constructed zebrafish models with ccny, ccnyl1, and ccny/ccnyl1 gene knockout, providing excellent animal models for research on cyclin-related diseases, helping to understand disease mechanisms and explore treatment strategies, and showing promising application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796277B_ABST
    Figure CN120796277B_ABST
Patent Text Reader

Abstract

The application discloses a set of gRNA, an RNP complex, a construction method of a gene knockout zebra fish model and application thereof, and belongs to the technical field of genetic engineering. ccny gene knockout, ccnyl1 gene knockout, ccny / ccnyl1 double gene knockout zebra fish models, which provide an animal experiment basis for cyclin-related research, provide a good animal model for fully understanding cyclin-related disease research and treatment strategy exploration, and help researchers to deeply understand cyclin-related molecular mechanisms and cell processes, ccny and ccnyl1 have a good application prospect in developmental biology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for constructing a group of gRNA, RNP complexes, and gene knockout zebrafish models, and their applications. Background Technology

[0002] Cyclin Y ( ccny ) belongs to the cyclin family and regulates the cell cycle by activating cyclin-dependent kinases (CDKs). It also participates in regulating key cellular functions such as signal transduction pathways, DNA replication and repair, and is a highly conserved member in true metazoans. ccny It plays a key role in various cancers, such as promoting proliferation in laryngeal cancer cells by regulating cell cycle progression and the MEK / ERK signaling pathway, with its expression level correlated with cell proliferation capacity; and in non-small cell lung cancer tissues and cell lines, ccny High expression of the gene, which is correlated with tumor tissue type and size. RNA interference technology inhibits its expression. ccny Expression can significantly inhibit lung cancer cell proliferation and tumorigenesis efficiency in vivo, and ccny Gene silencing causes cell cycle arrest in lung cancer cells at the G1 / S phase; similar results have been observed in rectal cancer studies. ccny High expression of this gene can promote the proliferation, migration, and invasion of rectal cancer cells; in addition... ccny It can also promote the proliferation of glioma cells and inhibit RNAi. ccny Expression of this substance can significantly inhibit its proliferation, colony formation, and cell cycle progression.

[0003] ccny Its role in neurological diseases is also being continuously revealed, such as its important role in the regulation of neuronal gene expression related to epilepsy: its knockout mouse model is more susceptible to carbamazepine-induced epilepsy, indicating... ccny It may have a protective effect against epilepsy; ccny In *Caenorhabditis elegans*, it has been found to regulate the localization of presynaptic components and act as a regulator of synaptic remodeling, participating in synaptic elimination and formation during development; furthermore, ccny Highly expressed in the mammalian brain, it is a postsynaptic protein that inhibits synaptic delivery of AMPA receptors during long-term enhancement (LTP); studies using RNA-seq technology have revealed... ccny Upregulated and downregulated RNA transcripts in hippocampal neurons mediated by this pathway are associated with multiple biological terms and pathways, including learning or memory, synaptic plasticity, actin cytoskeleton, and Alzheimer's disease (AD), suggesting... ccny Potential role in neurological disorders.

[0004] However, compared with other techniques, zebrafish embryos are transparent and small in size, requiring high-precision microinjection techniques to inject CRISPR / Cas9 components, and the precise control of injection dose and time is crucial, otherwise it may cause embryo toxicity or reduced survival rate. Secondly, the complexity of the zebrafish genome ccny and ccny Genes contain multiple exons and introns, and the homology of gene family members makes target selection more cautious to avoid off-target effects and interference with other homologous genes. In addition, double gene knockout models require simultaneous consideration of target selection and synergistic editing efficiency of two genes, increasing the complexity of experimental design.

[0005] In addition to cyclin / CDK partners, several "orphan" cyclins and "orphan" CDKs have not yet determined their interaction partners. ccny is a newly discovered protein and one of these "orphan" cyclins. It shows a protein sequence similarity of 79% with ccny , and current studies have reported ccny and ccny have synergistic effects in function.

[0006] ccny The specific mechanism of action in different disease models and potential applications still need further exploration. Currently, there is no research report on zebrafish knockout models of ccny gene, ccny gene, ccny double gene zebrafish knockout models. At the same time, considering the potential role of cyclins in various diseases, constructing ccny zebrafish knockout models is of great significance for in-depth study of its function and exploration of disease treatment strategies. SUMMARY

[0007] In order to solve the above problems existing in the prior art, the purpose of the present application is to provide a set of gRNA, RNP complex, construction method of gene knockout zebrafish model and application thereof.

[0008] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0009] The present application provides a set of gRNA, which comprises at least one of the gRNA with nucleotide sequence as shown in SEQ ID No. 1, SEQ ID No. 2.

[0010] The present application also provides an RNP complex, which contains Cas9 protein and at least one of the gRNA with nucleotide sequence as shown in SEQ ID No. 1, SEQ ID No. 2.

[0011] The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model.

[0012] Further, the gene knockout zebrafish model is a zebrafish model with the gene knocked out. ccny The nucleotide sequence of the gRNA is shown in SEQ ID No. 1.

[0013] Further, the gene knockout zebrafish model is a zebrafish model with the gene knocked out. ccny The nucleotide sequence of the gRNA is shown in SEQ ID No. 2.

[0014] Further, the gene knockout zebrafish model is a zebrafish model with the gene knocked out. ccny and ccny The nucleotide sequence of the gRNA is shown in SEQ ID No. 1 and SEQ ID No. 2.

[0015] The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model.

[0016] The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model. ccny and ccny The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model. ccny The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model.

[0017] Or, selecting zebrafish self-crossed embryos with the gene knocked out, delivering gRNA with the nucleotide sequence shown in SEQ ID No. 2 and Cas9 protein at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model. ccny The application also provides a method for constructing a gene knockout zebrafish model, which comprises the following steps: selecting wild type zebrafish self-crossed embryos, delivering the above-mentioned RNP complex at the single cell stage, and screening by gene sequencing to obtain the gene knockout zebrafish model.

[0018] The application also provides the above-mentioned gRNA, RNP complex and construction method for use in the research field of cyclin-related diseases.

[0019] Further, the cyclin-related disease is cancer, neurodegenerative disease, cardiovascular disease, developmental disorder or autoimmune disease.

[0020] Further, the cancer is breast cancer, lymphoma, lung cancer, colon cancer or glioma; the neurodegenerative disease is Alzheimer's disease or epilepsy; the cardiovascular disease is abnormal platelet function and thrombosis; the developmental disorder is embryonic lethality; the autoimmune disease is inflammatory bowel disease.

[0021] The present application has the following beneficial effects:

[0022] The present application respectively constructs ccny gene knockout, ccny gene knockout, ccny double gene knockout zebrafish models, which provide an animal experiment basis for cyclin related research, provide a good animal model for fully understanding cyclin related disease research and treatment strategy exploration, and help researchers to deeply understand ccny and ccny related molecular mechanisms and cellular processes, provide a theoretical basis for developmental biology, and have good application prospects.

[0023] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and conventional means in the art, other various forms of modifications, replacements or changes can be made without departing from the above technical idea of the present application.

[0024] The above content of the present application will be further described in detail through the specific embodiments in the form of examples. However, this should not be understood as the scope of the above subject matter of the present application being limited to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0025] ccny For ccny gene knockout strategy.

[0026] ccny For ccny gene knockout strategy.

[0027] ccny For ccny Gene knockout zebrafish PCR fragment identification gel electrophoresis results.

[0028] ccny For ccny Gene knockout zebrafish PCR fragment identification gel electrophoresis results.

[0029] ccny For ccny Gene knockout zebrafish model construction success (-33bp+12bp) sequencing results.

[0030] ccny Forccny Fig. 11 is a sequencing result diagram of a zebrafish model constructed by gene knockout (-12bp+10bp). DETAILED DESCRIPTION

[0031] The raw materials and equipment used in the present application are known products, which can be obtained by purchasing commercially available products.

[0032] In the following experiments, if the temperature is not specified, it means that the reaction is carried out under normal temperature conditions, and the normal temperature is room temperature, which is 25±5°C.

[0033] Example 1: ccny Construction of a gene knockout zebrafish model

[0034] 1. Culture of embryos

[0035] Zebrafish embryos were raised at 28.5 °C and in compliance with the Institutional Animal Care and Use Committee (IACUC) protocol for fish maintenance and feeding, which was approved by the Animal Care and Use Committee of West China Hospital of Sichuan University (NO. 20220422003).

[0036] 2. Modeling method

[0037] 2.1 Construction of the model

[0038] ccny The gene knockout strategy is shown in ccny The gene knockout strategy is shown in ccny The gene knockout strategy is shown in ccny The gene knockout strategy is shown in

[0039] According to the gene sequence reference provided in NCBI, the zebrafish ccny gene (NCBI Gene ID: 557738; reference sequence: NC_007135.7) is located on chromosome 24 of zebrafish, and 3 exons have been identified, among which the start codon ATG is located in exon 1 and the stop codon TAA is located in exon 12 (transcript: ENSDARG00000063677); the zebrafish ccny gene (NCBI Gene ID: 767752; reference sequence: NC_007120.7) is located on chromosome 9 of zebrafish, and 10 exons have been identified, among which the start codon ATG is located in exon 1 and the stop codon TAA is located in exon 10 (transcript: ENSDARG00000099692).

[0040] 2.2 Design of gRNA expression vector for the model using CRISPR-Cas9 technology

[0041] ccnyConstruction of gene knockout vector: design through the online website http: / / crispor.tefor.net / , confirm ccny The gRNA target sequence of the gene is 5'-AGCCCAGAAACTGGAGGTATGGG-3' (SEQ ID No. 1), and is synthesized in GenScript Company. The method of fragment amplification→ ligation (skeleton + fragment) / transformation→ bacterial detection→ positive clone plasmid extraction→ enzyme digestion identification→ sending for testing→ preparing injection plasmid is used for constructing the donor vector, and the vector selected in the application is the universal vector pMD-18T.

[0042] ccny Construction of gene knockout vector: refer to the above ccny The difference between the construction methods of the gene knockout vector is that ccny The gRNA target sequence of the gene is 5'-CCGAGCTGGACATTTGCCCATCT -3' (SEQ ID No. 2).

[0043] 2.3 Preparation of gRNA

[0044] According to the gRNA expression vector template constructed in step 2.2, the gRNA is transcribed and purified by using an in vitro transcription kit.

[0045] 2.4 Zebrafish embryo injection

[0046] ccny : select wild type zebrafish inbred embryos in good condition, co-inject gRNA (100 pg / µl) and Cas9 protein (200 pg / µl) at the single cell stage, inject 1 nl into single embryo. ccny

[0047] ccny : select wild type zebrafish inbred embryos in good condition, co-inject gRNA (100 pg / µl) and Cas9 protein (200 pg / µl) at the single cell stage, inject 1 nl into single embryo. ccny

[0048] : crossbreed the identified zebrafish strain ccny (+ / -) to obtain zebrafish model ccny (- / -). Select wild type zebrafish inbred embryos in good condition, co-inject gRNA (100 pg / µl) and Cas9 protein (200 pg / µl) at the single cell stage, inject 1 nl into single embryo. ccny ccny ccny

[0049] 2.5 Model detection ​​​​

[0050] F0 generation zebrafish were taken, and the tail fin genomic DNA was extracted one by one, and the genotype was detected by PCR and sanger sequencing.

[0051] CCNY:

[0052] Forward primer: 5'- CTTGATGTCAAGCCAGGTTATG -3' (SEQ ID No. 3);

[0053] Reverse primer: 5'- ATGTCTTTGAGGATCTGGCAAT -3' (SEQ ID No. 4).

[0054] CCNYL1:

[0055] Forward primer (MT, mutant) 5'- GGCTGTTGACGTACGCTGT -3' (SEQ ID No. 5);

[0056] Forward primer (WT, wild type) 5'- GGCTGTTGACGTACGCCGA -3' (SEQ ID No. 6);

[0057] Reverse primer 5'- CATGTCCTCCACAGTGATGTCT -3' (SEQ ID No. 7).

[0058] The PCR conditions were: 95℃ 3 min pre-denaturation, 95℃ 15 s, 60℃ 15 s, 72℃ 30 s, 30 cycles; 72℃ 5 min additional extension. The PCR product was subjected to gel electrophoresis experiment and sanger sequencing, and the F0 generation zebrafish was identified, and the successful construction ccny (+ / -), ccny (+ / -), ccny (- / -); ccny (+ / -) zebrafish. The results of gel electrophoresis experiment are shown in ccny , 4 The results of sanger sequencing are shown in ccny , 6 .

[0059] 2.5 Survival rate observation of offspring

[0060] The successfully constructed ccnyl1 (- / -); ccny (+ / -) zebrafish lines were self-crossed, and the survival rate of offspring was counted, and the results are shown in Table 1. The embryonic genotype was identified, and the results are shown in Table 2.

[0061] It is well known to those skilled in the art that when ccny and ccnyWhen both are knocked out (i.e. double homozygous), embryonic development is arrested and the embryo dies. For example, it has been shown that, ccny , ccny Gene single knockout mouse embryos can all survive, while double gene knockout dies at early development E16.5 (Zeng L, Cai C, Li S, Wang W, Li Y, Chen J, Zhu X, Zeng YA. Essential Roles of Cyclin Y-Like 1 and Cyclin Y in Dividing Wnt-Responsive Mammary Stem / Progenitor Cells. PLoS Genet. 2016 May 20;12(5):e1006055. doi: 10.1371 / journal.pgen.1006055. PMID: 27203244; PMCID:PMC4874687.). ccny (- / -); ccny (+ / -) selfed embryo population, compared with wild type (AB group in the figure) selfed embryo population, ccny (- / -); ccny (+ / -) selfed embryo population, compared with wild type (AB group in the figure) selfed embryo population,

[0062] Table 1 ccny (- / -); ccny (+ / -) selfed embryo population, compared with wild type (AB group in the figure) selfed embryo population,

[0063]

[0064] Note: AB1-3 are three groups of wild type selfed embryo repeats, ccny1-3 are ccny (- / -); ccny (+ / -) selfed embryo population, compared with wild type (AB group in the figure) selfed embryo population,

[0065] Table 2 Genotype identification of 8-11 dpf ccny (- / -); ccny (+ / -) selfed embryo population, compared with wild type (AB group in the figure) selfed embryo population,

[0066]

[0067] Note: Table 2 is the result of different days of samples in the same batch of zebrafish, and the statistical result is used to judge whether the group meets Mendelian segregation law.

[0068] The above results show that the present application successfully constructs ccny (- / -); ccny (- / -) zebrafish.

[0069] In summary, the present application respectively constructs ccny gene knockout, ccny gene knockout, ccny double gene knockout zebrafish model, which provides the basis for animal experiments for cyclin related research, provides a good animal model for fully understanding cyclin related disease research and treatment strategy exploration, and helps researchers to deeply understand ccny and ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny ccny cc related molecular mechanisms and cellular processes, provides a theoretical basis for developmental biology, and has good application prospect.

Claims

1. A method for constructing a gene knockout zebrafish model, characterized by, The gene knockout zebrafish model is a zebrafish model in which ccny and ccnyl1 genes are knocked out, and the construction method comprises the following steps: The zebrafish in which the ccnyl1 gene is knocked out is self-crossed to obtain embryos, gRNA and Cas9 protein with a nucleotide sequence as shown in SEQ ID No. 1 are delivered at the single-cell stage, and gene sequencing screening is performed, and thus the zebrafish in which the ccnyl1 gene is knocked out is obtained; wherein the construction method of the zebrafish in which the ccnyl1 gene is knocked out comprises the following steps: wild-type zebrafish self-crossed embryos are selected, gRNA with a nucleotide sequence as shown in SEQ ID No. 2 is delivered at the single-cell stage, and gene sequencing screening is performed, and thus the zebrafish in which the ccnyl1 gene is knocked out is obtained.

2. Application of the construction method of claim 1 in research on cyclin-related diseases; the cyclin is a protein encoded by the ccny and ccnyl1 genes in claim 1.

3. Use according to claim 2, characterized in that, The cyclin-related disease is cancer, a neurodegenerative disease, a cardiovascular disease, a developmental disorder or an autoimmune disease.

4. Use according to claim 3, characterized in that, The cancer is breast cancer, lymphoma, lung cancer, colon cancer or glioma; the neurodegenerative disease is Alzheimer's disease or epilepsy; the cardiovascular disease is abnormal platelet function and thrombosis; the developmental disorder is embryonic lethality; and the autoimmune disease is inflammatory bowel disease.

Citation Information

Patent Citations

  • Composition for the treatment of growth media

    GB767752A

  • Construction method of gata6 gene knockout zebrafish model

    CN115261360A