Mouse model construction method for specifically tracing heart valve cells and application

Abstract

The invention discloses a construction method and application of a mouse model for specifically tracing heart valve cells, and belongs to the technical field of animal model construction. The model construction method comprises the following steps: (1) constructing a Wid1-Cre hybrid mouse before inserting a Cre recombinase coding gene into a termination codon of a mouse Wid1 gene; and (2) hybridizing the Wid1-Cre hybrid mouse with the Rosa26-tdTomato homozygous report mouse, so as to obtain the double transgenic mouse which simultaneously carries the Wid1-Cre gene and the Rosa26-tdTomato gene. According to the invention, on the basis of the expression characteristic that Wif1 is only limited to a valve area in the heart, Wif1-Cre is constructed; according to the Rosa26-tdTomato mouse model, specific tracing of heart valve cells is achieved, and an important experimental tool is provided for mechanism research of heart valve diseases and development of therapeutic drugs.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of animal model construction, and in particular to a method for constructing a mouse model for specifically tracing heart valve cells and application thereof. BACKGROUND

[0002] Heart valve disease is a class of cardiovascular system diseases that seriously threaten global public health, among which calcific aortic valve disease (CAVD) is one of the most common types. The prevalence of CAVD is as high as 25% in people over 65 years old, and this number is still rising with the intensification of population aging trend. Severe valve disease can lead to heart failure, arrhythmia and even sudden death, seriously affecting the quality of life of patients and increasing the medical burden.

[0003] Currently, the treatment of severe valve disease mainly relies on surgical intervention, such as traditional valve replacement or transcatheter aortic valve replacement (TAVR). However, these invasive treatment options are only suitable for patients in the late stage of the disease, and the risk of postoperative complications and long-term prognosis problems cannot be ignored. More importantly, as of now, there is no clinically proven drug that can effectively prevent or delay the progression of valve disease, which is mainly due to the limited understanding of the molecular pathological mechanisms of valve disease.

[0004] Heart valves are composed of various cell types, including valve endothelial cells, valve interstitial cells, etc., which together maintain the normal structure and function of the valve. Recent studies have shown that the imbalance of the microenvironment in valve tissue is a key factor in the occurrence of disease. The main bottleneck currently faced by heart valve disease research is the lack of experimental tools to specifically label valve cells. Traditional research methods mainly rely on: after inducing or wire injury to the heart valve, taking mouse heart tissue sections for immunohistochemical, fluorescent staining and other further analysis. These methods have obvious limitations: it is difficult to monitor the changes of valve cells in real time, it is impossible to trace the lineage, and it is difficult to isolate specific cell subgroups for in-depth study. Therefore, the development of a mouse model that can specifically label heart valve cells has great scientific value and clinical application prospects.

[0005] Currently, mouse models for studying heart valve disease mainly include: ApoE knockout mice: induced by high-fat diet to induce atherosclerosis and valve calcification; Notch1 gene mutant mice: simulate congenital valve disease; LDLR knockout mice: used to study valve disease caused by lipid metabolism disorders. These models have value in simulating disease, but they cannot specifically label valve cells, making it impossible to track and analyze valve cells in real time.

[0006] Previous studies have attempted to use Postn and other genes as markers (Snider P, et al . Periostin is required for maturation and extracellular matrix stabilization ofnonmineralized heart valves. Circ Res, 2008, 102: 752-760.),but these genes are expressed in multiple tissues, and are not specific to valve cells. Nfatc1 is a marker gene of heart valve endothelium (Bensimon-BritoA, et al . TGF-β Signaling Promotes Tissue Formation during Cardiac ValveRegeneration in Adult Zebrafish. Dev Cell, 2020,52(1):9-20.),but Nfatc1 is not an endocardium-specific molecular marker, it is also expressed in hematopoietic endothelial cells, and some peripheral blood immune cells (Liu K, et al . Lineage tracing clarifies the cellular origin of tissue-residentmacrophages in the developing heart. J Cell Biol, 2022,221(6): e202108093)。Some studies have constructed Wnt1-Cre;Cdh5-Nigri;R26-NLR triple-gene mice to simultaneously label and trace neural crest cells and endocardial cells in vivo, for studying the origin and dynamic changes of valve mesenchymal cells during mouse heart development (KuoLiu, et al . A dual genetic tracing system identifies diverse and dynamicorigins of cardiac valve mesenchyme. 2018,145(18): dev167775.),but Wnt1 and Cdh5 genes as markers also do not have valve specificity.

[0007] So far, there is no transgenic mouse model specifically used to label and trace heart valve cells, which seriously restricts the research of valve disease mechanisms and drug development. Therefore, developing a mouse model that can specifically label heart valve cells is a technical problem that those skilled in the art need to solve. SUMMARY

[0008] The present application aims to provide a method for constructing an animal model capable of accurately tracing heart valve cells, so as to solve the technical bottleneck of long-term lack of valve-specific markers and tracing tools in the field of heart valve disease research.

[0009] To achieve the above-mentioned purpose, the present application adopts the following technical solutions: The present application provides a method for constructing a mouse model for specifically tracing heart valve cells, comprising the following steps: (1) inserting a Cre recombinase encoding gene into the termination codon of a mouse Wif1 gene to construct a Wif1-Cre heterozygous mouse expressing Cre recombinase under the regulation of an endogenous Wif1 gene, wherein the Wif1 gene encodes Wnt inhibitory factor 1; (2) crossing the Wif1-Cre heterozygous mouse with a Rosa26-tdTomato homozygous reporter mouse to obtain F1 generation mice that are Wif1-Cre heterozygous and Rosa26-tdTomato heterozygous, and then mating mice of different genders to obtain double transgenic F2 generation or subsequent generations that are Wif1-Cre positive and Rosa26-tdTomato positive, which is the mouse model for specifically tracing heart valve cells.

[0010] The Wif1-Cre positive is Wif1-Cre heterozygous or Wif1-Cre homozygous; the Rosa26-tdTomato positive is Rosa26-tdTomato heterozygous or Rosa26-tdTomato homozygous. The model genome simultaneously carries the Wif1-Cre gene and the Rosa26-tdTomato gene.

[0011] The present application researches and finds that Wif1 (Wnt inhibitory factor 1) has a highly specific expression pattern in heart tissue, which is mainly limited to the valve region, and is almost not expressed in myocardium, endocardium and other heart tissues. This specific expression pattern provides an ideal molecular target for specific labeling of valve cells. The sequence information of the Wif1 gene can be found on the NCBI website with Gene ID: 24117, and the nucleotide sequence of its transcript is shown as SEQ ID NO. 1.

[0012] Based on this, the present application proposes to insert a Cre recombinase encoding gene before the termination codon of the mouse Wif1 gene to construct a Wif1-Cre heterozygous mouse, and to realize the expression of Cre recombinase by using the promoter and regulatory elements of the endogenous Wif1 gene, so as to ensure that the expression of Cre recombinase completely follows the spatiotemporal expression pattern of Wif1, that is, the expression pattern of Cre recombinase represents the expression pattern of the endogenous Wif1 of the mouse.

[0013] The application crosses Wif1-Cre heterozygous mice with Rosa26-tdTomato homozygous reporter mice to obtain offspring mice carrying both Wif1-Cre and Rosa26-tdTomato genes, and the offspring mice will express red fluorescent protein in heart valve cells, so that fluorescent tracing can be achieved, that is, the mouse model for specifically tracing heart valve cells is obtained. Specifically, the Rosa26-tdTomato homozygous reporter mouse has a Rosa26-loxP-STOP-loxP-tdTomato (Rosa26-tdTomato) reporter gene. Rosa26 is a ubiquitous expression locus with stable expression characteristics, and the Rosa26-tdTomato reporter gene is a construct introduced into the locus, which contains a loxP site wrapped transcription termination sequence (STOP) and a downstream tdTomato reporter gene. Only under the action of Cre recombinase, the STOP sequence is removed, and the expression of tdTomato can be activated. Therefore, by monitoring the expression of fluorescent protein, the spatiotemporal expression of Wif1 in mice can be reflected, and specific tracing of heart valve cells is achieved.

[0014] In the application, the mouse used for constructing the mouse model can be a commonly used experimental mouse breed in the art, for example, C57BL / 6. The Rosa26-tdTomato homozygous reporter mouse is a publicly available biological material.

[0015] In the application, the Cre recombinase encoding gene is used for encoding Cre recombinase, and the amino acid sequence of the Cre recombinase is shown in SEQ ID NO. 2. The application can optimize the sequence of the encoding gene according to the codon preference of the host.

[0016] As a preferred, the Cre recombinase encoding gene encodes a Cre-ERT2 fusion protein. The amino acid sequence of the Cre-ERT2 fusion protein is shown in SEQ ID NO. 3.

[0017] The Cre-ERT2 fusion protein is a modified Cre recombinase, which is a fusion of Cre recombinase and estrogen receptor mutant (ERT2). The fusion protein is localized in the cytoplasm under normal conditions, and can only be translocated to the nucleus and exhibit recombinase activity under the induction of tamoxifen (Tamoxifen). Therefore, the application provides time-controllable cell tracing, which is based on the CreERT2 induction system, and can activate the Cre recombinase at a specific time point by tamoxifen (Tamoxifen) induction, so as to achieve time-specific labeling of valve cells, which is convenient for studying the changes of valve cells in different development stages or disease processes.

[0018] Preferably, the 5′ end of the Cre recombinase-encoding gene contains a 2A self-cleaving peptide coding sequence. 2A self-cleaving peptides mediate self-cleavage of polypeptide chains during protein translation. By inserting the 2A sequence, Wif1 and CreERT2 are expressed as a fusion transcript, but form two independent proteins after translation, ensuring that Wif1 protein function is not affected while achieving co-expression of Cre-ERT2.

[0019] In the present invention, the 2A self-cleaving peptide can be but is not limited to P2A (Porcine teschovirus-1 2A), and the coding sequence of the P2A self-cleaving peptide is shown in SEQ ID NO.4.

[0020] Preferably, the nucleotide sequence of the Cre recombinase encoding gene is shown in SEQ ID NO. 5. This sequence encodes a P2A-Cre-ERT2 fusion protein.

[0021] In the present invention, a Cre recombinase encoding gene can be inserted before the stop codon of the mouse Wif1 gene using biological techniques known in the art. The biological techniques may be, but are not limited to, CRISPR-Cas9 technology.

[0022] As a specific embodiment of the present invention, CRISPR-Cas9 technology was used to insert a gene encoding Cre recombinase before the translation stop codon of the mouse Wif1 gene. The CRISPR / Cas9 system, consisting of a recognition component, CRISPR, and a cutting component, Cas, enables RNA-guided DNA recognition and editing.

[0023] The CRISPR / Cas9 system uses a sequence-specific guide RNA (gRNA) to direct the endonuclease to the target site, thereby completing genome editing. To knock out or knock in different genes, gRNAs must be designed that are specific to the gene or site to achieve precise gene editing.

[0024] In the present invention, a gene knock-in was performed before the translation termination site TGA of the Wif1 gene, using the Wif1 gene transcript sequence as the target sequence and using the CRISPR Design tool to screen for a highly specific target sequence. Preferably, the target sequence is 5′-AGGGGTTCACCAGATGTAAT-3′ (SEQ ID NO. 6), with a PAM of TGG.

[0025] Specifically, the method for constructing the Wif1-Cre heterozygous mouse comprises the following steps: a, construction of a gRNA in vitro transcription template and preparation of gRNA: a target fragment containing a PAM structure is selected from a protein coding region of a Wif1 gene, the target sequence is 5'-AGGGGTTCACCAGATGTAATTGG-3', a double-stranded sgRNA insertion fragment is prepared by annealing a synthesized sense strand and an antisense strand, the double-stranded sgRNA insertion fragment is inserted into a gRNA expression vector to construct a recombination plasmid, and then gRNA is prepared by in vitro transcription and purification; b, construction of a Donor vector: taking a mouse Wif1 gene insertion site as the center, a sequence of 1000-1200 bp above and below the insertion site is taken as a 5' homologous arm and a 3' homologous arm, primers are designed, and the 5' homologous arm sequence and the 3' homologous arm sequence are obtained by PCR amplification using mouse genomic DNA as a template; the 5' homologous arm sequence, a Cre recombinase coding gene fragment and the 3' homologous arm sequence are sequentially inserted into a cloning vector by Gibson assembly to prepare the Donor vector; c, Cas9 mRNA is prepared by in vitro transcription and purification after linearization of a Cas9 mRNA expression plasmid; d, the gRNA, the Donor vector and the Cas9 mRNA are microinjected into a fertilized egg of a C57BL / 6 mouse, and then transplanted into a pseudopregnant female mouse, F0 generation mice are born, and Wif1-Cre heterozygous F0 generation mice are screened out by gene identification, and then the Wif1-Cre heterozygous F0 generation mice are mated with wild-type C57BL / 6 mice, and Wif1-Cre heterozygous mice are screened out from F1 generation by gene identification.

[0026] Preferably, in step a, the gRNA expression vector is a pUC57-T7-sgRNA vector.

[0027] Preferably, the nucleotide sequence of the sense strand is 5'-caccGAGGGGTTCACCAGATGTAAT-3', and the nucleotide sequence of the antisense strand is 5'-aaacATTACATCTGGTGAACCCCTC-3'. The "cacc / aaac" is a cohesive end suitable for BbsI enzyme digestion of the pUC57-T7-sgRNA vector. The pUC57-T7-sgRNA vector linearized by BbsI enzyme digestion is connected with the double-stranded sgRNA insertion fragment to construct a recombination plasmid.

[0028] Preferably, in step b, the cloning vector is a pBluescript II SK(-) vector.

[0029] Preferably, the nucleotide sequences of the primer pair used for amplifying the 5' homologous arm fragment are as follows: F: CTGCAGGAATTCGATCTCACAAATCCTACTGATAGGCATC (SEQ ID NO. 7); R: CGTGGCTCCGCTTCCCCAGATGTAATTGGATTCAGGTGG (SEQ ID NO. 8); The nucleotide sequence of the primer pair used for amplifying the 3' homologous arm fragment is: F: CCTGCCACAGCTTGATGAACCCCTACCCCACCATC (SEQ ID NO. 9); R: ATCGATAAGCTTGATCTAACGGTGAGTCTTGCAGGC (SEQ ID NO. 10).

[0030] Preferably, the nucleotide sequence of the Cre recombinase-encoding gene fragment is as shown in SEQ ID NO. 5.

[0031] Preferably, in step c, the Cas9 mRNA expression plasmid is a pT3TS-nCas9n vector.

[0032] In step d, the CRISPR-Cas9 system and the Donor vector are microinjected into fertilized eggs of C57BL / 6 mice, and the fertilized eggs are transplanted into pseudopregnant female mice, or the fertilized eggs are cultured into embryos and then transplanted into pseudopregnant female mice, and the mice are allowed to become pregnant and give birth. The F0 generation mice born by the recipient mice are toe-clipped at 14 days, and genomic DNA is extracted for genetic identification, and Wif1-Cre heterozygous mice are screened. Then, the F0 generation Wif1-Cre heterozygous mice are mated with wild type, and the F1 generation mice born are toe-clipped, and genomic DNA is extracted for genetic identification, and F1 generation Wif1-Cre heterozygous mice that can be stably inherited are screened.

[0033] In step (2), Wif1-Cre heterozygous mice are mated with Rosa26-loxP-STOP-loxP-tdTomato reporter mice to obtain F1 generation, toe-clipped, and genomic DNA is extracted for genetic identification, and Wif1-Cre heterozygous and Rosa26-tdTomato heterozygous mice are screened, and the different gender mice are mated with each other after sexual maturation to obtain F2 generation, toe-clipped, and genomic DNA is extracted for genetic identification, and double transgenic mice (Wif1-Cre; Rosa26-tdTomato) that can be stably inherited and carry Wif1-Cre gene and Rosa26-tdTomato gene are screened.

[0034] In the present application, F2 generation or subsequent generations can continue to be mated to obtain Wif1-Cre; Rosa26-tdTomato mice, i.e. a mouse model for specifically tracing heart valve cells.

[0035] As preferred, PCR amplification technique is used to identify whether the Cre recombinase coding gene is inserted before the termination codon of the Wifl gene and whether the Rosa26-tdTomato gene is contained in the offspring mice.

[0036] The primers for identifying the insertion of the Cre recombinase coding gene are composed of primer pair 1 for identifying the wild type and primer pair 2 for identifying the mutant type; The nucleotide sequences of primer pair 1 are 5'-CTGTGAATAATTTTGCAGGGTATGG-3'(SEQ ID NO. 11) and 5'-GCCC CATCAA AACTGAACTGTCTA-3'(SEQ ID NO. 12), respectively; The nucleotide sequences of primer pair 2 are 5'-CTGTGAATAATTTTGCAGGGTATGG-3'(SEQ ID NO. 11) and 5'-TGAACATGTCCATCAGGTTCTTGC-3'(SEQ ID NO. 13), respectively; The length of the amplification product of primer pair 1 is 695 bp, and the length of the amplification product of primer pair 2 is 300 bp.

[0037] Specifically, the genomic DNA of the offspring mice is used as a template, and the above primers are used for PCR amplification. The amplification product is subjected to agarose gel electrophoresis, and the genotype of the offspring is determined according to the electrophoresis result. Specifically, the wild type produces only a 695 bp band; the Wifl-Cre homozygous mouse produces only a 300 bp band; and the Wifl-Cre heterozygous mouse produces two bands, each of which is 695 bp and 300 bp.

[0038] The primers for identifying the introduction of the Rosa26-tdTomato gene are composed of primer pair 3 for identifying the wild type and primer pair 4 for identifying the mutant type; The nucleotide sequences of primer pair 3 are 5'-AAGGGAGCTGCAGTGGAGTA-3'(SEQ ID NO. 14) and 5'-CCGAAAATCTGTGGGAAGTC-3'(SEQ ID NO. 15), respectively; The nucleotide sequences of primer pair 4 are 5'-GGCATTAAAGCAGCGTATCC-3'(SEQ ID NO. 16) and 5'-CTGTTCCTGTACGGCATGG-3'(SEQ ID NO. 17), respectively.

[0039] The length of the amplification product of primer pair 3 is 297 bp, and the length of the amplification product of primer pair 4 is 196 bp.

[0040] Specific method is: taking the genomic DNA of the offspring mice as a template, using the above primer to carry out PCR amplification, and carrying out agarose gel electrophoresis on the amplification product, and judging the genotype of the offspring according to the electrophoresis result. Specifically, wild type: only a 297 bp band is produced; Rosa26-tdTomato homozygous mice: only a 196 bp band is produced; Rosa26-tdTomato heterozygous mice: two bands are produced, each being 297 bp and 196 bp.

[0041] The application provides a mouse model for specifically tracing heart valve cells prepared by the above construction method. The mouse model provided by the application can specifically trace heart valve cells, and therefore, the model can be used to establish a heart valve disease model, and provide an experimental tool for mechanism research and therapeutic drug development of heart valve diseases.

[0042] Specifically, the application provides application of the mouse model for specifically tracing heart valve cells prepared by the above construction method in construction of a heart valve disease model.

[0043] In the application, the heart valve disease can be, but is not limited to, calcified aortic valve disease. Specifically, the modeling method can use high-fat diet induction or guide wire injury to the heart valve.

[0044] As a specific embodiment of the application, a method for modeling calcified aortic valve disease by guide wire injury to the heart valve comprises the following steps: taking 8-week-old Wif1-Cre;Rosa26-tdTomato double transgenic mice, first inducing by Tamoxifen, then inserting a guide wire into the aortic valve through the common carotid artery, repeatedly stretching the guide wire to cause mechanical injury to the valve, and suturing the wound after the operation to form the calcified aortic valve disease model.

[0045] The application also provides application of the heart valve disease model, for example, using the heart valve disease model to screen drugs for preventing or treating heart valve diseases, or identifying biomarkers for diagnosing heart valve diseases.

[0046] The application uses the above model as a research tool to further explore the pathogenesis and progression process of calcified aortic valve disease and other valve diseases; and provides a reliable in vivo research platform for drug screening, targeted treatment and biomarker development of heart valve diseases.

[0047] The application has the following beneficial effects: (1) Valve cell specific marker: By using the expression characteristics of Wif1 in the heart, which is limited to the valve region, the application inserts the Cre recombinase coding gene before the stop codon of the mouse Wif1 gene, and uses the promoter and regulatory elements of the endogenous Wif1 gene to ensure that the expression of Cre recombinase completely follows the spatial and temporal expression pattern of Wif1; then crossbred with Rosa26-tdTomato reporter mice to obtain offspring mice carrying Wif1-Cre gene and Rosa26-tdTomato gene, and use the Cre system to specifically express tdTomato fluorescent protein driven by the Wif1 promoter, thereby tracing the heart valve cells. The mouse model constructed by the method of the application realizes highly specific labeling of valve cells, avoiding the interference of other tissue cells.

[0048] (2) Cell sorting and molecular characteristic analysis: The application realizes specific labeling of valve cells, which can be separated by fluorescence activated cell sorting technology to separate tdTomato positive valve cells, and can be used for transcriptome and proteome analysis to further study the molecular characteristics and functions of valve cells.

[0049] (3) Drug efficacy evaluation tool: The application provides an in vivo platform for evaluating the effect of potential therapeutic drugs for valve diseases, which can directly observe the effect of drugs on valve cells.

[0050] (4) Valve-specific gene function research: The application can provide an experimental tool for valve cell gene function research, which can be combined with conditional gene knockout technology to specifically study the function of certain genes in valve cells without affecting other tissue cells. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1 It is a schematic diagram of the principle of using CRISPR-Cas9 technology to edit Wif1 gene.

[0052] Figure 2 It is a DNA identification electrophoresis map of F1 generation mice in Example 1. In the figure, M is a DNA marker (DL1000 DNA marker: 1000bp\700bp\500bp\400bp\300bp\200bp\100bp); 1-14 are F1 generation mice.

[0053] Figure 3 It is a Rosa26-tdTomato electrophoresis map of F2 generation mice in Example 2. In the figure, M is a DNA marker (DL1000 DNA marker: 1000bp\700bp\500bp\400bp\300bp\200bp\100bp), and 1-27 are F2 generation mouse samples.

[0054] Figure 4 Electrophoresis results of Wif1-P2A-CreERT2 for F2 generation mice in Example 2. M is DNA marker (DL1000 DNA marker: 1000bp\700bp\500bp\400bp\300bp\200bp\100bp), N is negative control, WT is C57BL / 6 wild type mouse (negative control), and 1-27 are individual samples of F2 generation mice.

[0055] Figure 5 Fluorescence images of heart sections of Wif1-P2A-CreERT2; Rosa26-tdTomato mice. The part inside the dotted line in the left image is the aortic valve of the heart, and the right image is an enlarged view of part of the valve and myocardium. Blue is DAPI, and red is tdTomato-labeled cells.

[0056] Figure 6 Fluorescence images of heart sections of mice in Example 3. The left image is the heart valve of a sham-operated mouse, and the right image is the heart valve of a wire-drag injured mouse.

[0057] Figure 7 Figure 6 Fluorescence statistics of sham-operated and wire-drag injured groups. The * symbol indicates the difference between the sham-operated and injured groups by unpaired t-test, **** indicates P <0.0001. DETAILED DESCRIPTION

[0058] Wnt inhibitory factor 1 (Wif1) is a secreted glycoprotein that can bind Wnt ligands and inhibit the activation of the Wnt signaling pathway. Studies have found that Wif1 has a highly specific expression pattern in heart tissue, mainly limited to the valve area, and almost no expression in myocardium, endocardium and other heart tissues. In the valve tissue of CAVD patients, Wif1 expression is significantly reduced, and is negatively correlated with the degree of valve calcification, suggesting that it is closely related to disease progression. This specific expression pattern provides an ideal molecular target for specific labeling of valve cells. The present application constructs a mouse model that specifically disappears heart valves based on the above research findings.

[0059] The technical solutions of the present application will be further specifically described below through specific embodiments. It should be understood that the implementation of the present application is not limited to the following examples, and any form of variation and / or change of the present application will fall within the scope of protection of the present application.

[0060] ​In the present application, the equipment and raw materials used, unless specified otherwise, can be purchased from the market or commonly used in the art. The methods in the following examples, unless specified otherwise, are conventional methods in the art.

[0061] The nucleotide sequence is from left to right, 5' end to 3' end.

[0062] Example 1: Construction of Wif1-P2A-CreERT2 gene knock-in mouse This example provides a method for constructing a Wif1-P2A-CreERT2 gene knock-in mouse model based on the CRISPR / Cas9 system, the strategy of which is shown in Figure 1 That is, using gene knock-in strategy, P2A-CreERT2 expression sequence is accurately inserted before the stop codon of mouse Wif1 gene, to construct Wif1-P2A-CreERT2 gene knock-in mouse. The specific design contains the following key elements: a, CRISPR / Cas9 system: composed of recognition component CRISPR and cutting component Cas, which can complete RNA-directed DNA recognition and editing. The CRISPR / Cas9 technology system uses a sequence-specific guide RNA molecule (guide RNA, gRNA) to guide endonuclease to the target site, thereby completing genome editing. For knockout / knock-in of different genes, gRNA specific to the gene or corresponding site needs to be designed to achieve precise gene editing effect.

[0063] b, Wif1 gene promoter region: using the promoter and regulatory elements of endogenous Wif1 gene to ensure that the expression of CreERT2 completely follows the spatiotemporal expression pattern of Wif1; c, P2A self-cleavage peptide: P2A (Porcine teschovirus-1 2A) is a self-cleavage peptide sequence, which mediates the self-cleavage of polypeptide chains during protein translation. By inserting the P2A sequence, Wif1 and CreERT2 are expressed as a fusion transcript, but form two independent proteins after translation, ensuring that the function of Wif1 protein is not affected while achieving co-expression of CreERT2; d, CreERT2 gene: encoding a modified Cre recombinase, which is fused with estrogen receptor mutant (ERT2). The fusion protein is localized in the cytoplasm under normal conditions, and can only translocate to the nucleus and exert recombinase activity under tamoxifen induction.

[0064] The method for constructing Wif1-P2A-CreERT2 gene knock-in mice is as follows: a P2A-CreERT2 element is inserted before the translation termination site TGA of the Wif1-201 transcript by using a CRISPR / Cas9 system, the length of the inserted element is about 2.1 kb, and CreERT2 is expressed under the regulation of the endogenous Wif1 gene. The method specifically comprises the following steps: 1. Obtain the sequence of the mouse Wif1 gene (Gene ID: 24117) through the NCBI website, select the transcript Wif1-201 (ENSMUST00000020439.11) sequence as the target sequence, and the nucleotide sequence is shown as SEQ ID NO. 1, wherein the 340th-1479th is the CDS region; use the CRISPRDesign tool (http: / / crispr.mit.edu / ) to screen a high-specificity target sequence (20 nt: AGGGGTTCACCAGATGTAAT, PAM is TGG).

[0065] Subsequently, PAGE-purified oligonucleotide chains (sense: 5'-caccGAGGGGTTCACCAGATGTAAT-3', antisense: 5'-aaacATTACATCTGGTGAACCCCTC-3') are synthesized, wherein "cacc / aaac" is a sticky end suitable for BbsI enzyme digestion site.

[0066] Annealing reaction system (10 μL): 1 μL of positive strand (100 μM) + 1 μL of negative strand (100 μM) + 1 μL of 10×T4 Ligation Buffer + 0.5 μL of T4 PNK + 6.5 μL of ddH2O.

[0067] After 37°C phosphorylation for 30 minutes and 95°C denaturation for 5 minutes, natural cooling is performed to form a double-stranded sgRNA insertion fragment.

[0068] 2. Construct the Donor vector, specifically: select the gRNA cleavage point as the center, and take about 1000 bp above and below as the 5' homologous arm and the 3' homologous arm. Design primers, use mouse gDNA as a template, and PCR amplification to obtain the 5' homologous arm and the 3' homologous arm sequences.

[0069] 5' homologous arm primers: F: CTGCAGGAATTCGATCTCACAAATCCTACTGATAGGCATC; R: CGTGGCTCCGCTTCCCCAGATGTAATTGGATTCAGGTGG; 3' homology arm primers: F: CCTGCCACAGCTTGATGAACCCCTACCCCACCATC; R: ATCGATAAGCTTGATCTAACGGTGAGTCTTGCAGGC.

[0070] P2A-CreERT2 sequence was artificially synthesized (nucleotide sequence as shown in SEQ ID NO. 5). The 5' homology arm, P2A-CreERT2, 3' homology arm were inserted into the linearized pBluescript II SK(-) (EcoRV, 5 µg) backbone in turn by Gibson Assembly. The recombinant plasmid was transformed into DH5α competent cells, and the clones were cultured on LB-kanamycin plates. Single colonies were picked for PCR identification of the inserted fragment and sequencing to confirm sequence accuracy. Positive clones were selected, expanded and cultured to improve the purity of the plasmid. The Endotoxin-free Plasmid Kit was used for purification, and the A 260 / A 280 The ratio was used to determine the concentration and purity.

[0071] Construction of gRNA in vitro transcription template and preparation of gRNA, specifically: the gRNA expression vector pUC57-T7-sgRNA (Addgene #51132) was linearized by BbsI enzyme digestion and then connected with annealed sgRNA fragments (10 µL reaction system: 50 ng linearized vector + 1 µL annealed oligonucleotide (1:250 dilution) + 1 µL 10×T4 Ligase Buffer + 0.5 µL T4 DNA ligase, 16℃, 30 minutes), the recombinant plasmid was transformed into DH5α competent cells, and the clones were cultured on LB-kanamycin plates. The clones were picked for PCR identification and sequencing to verify the correctness of the gRNA. Positive clones were selected, expanded and cultured to improve the purity of the plasmid. The MEGAshortscript T7 kit was used for in vitro transcription of sgRNA, the transcription product was treated with DNase I to remove the DNA template, and then the RNA purification kit (MEGAclear™ Transcription Clean-Up Kit, Thermo Fisher Scientific) was used to purify the gRNA. The quality and concentration of the gRNA were detected by gel electrophoresis and spectrophotometer.

[0072] The Cas9 mRNA expression plasmid pT3TS-nCas9n (Addgene #46757) was linearized with XbaI and transcribed in vitro using the mMESSAGE mMACHINE T3 ULTRA kit, and a Poly(A) tail was added to enhance stability. The transcription product was purified using the MEGAclear™ Transcription Clean-Up Kit after DNA template removal by DNase I treatment. The quality and concentration of the Cas9 mRNA were detected by a spectrophotometer.

[0073] 3. Select 6-week-old C57BL / 6 mice as donor mothers, superovulate them, and mate them with 10-week-old C57BL / 6 male mice. The donor C57BL / 6 mothers with vaginal plugs are used for zygote collection as embryo transfer donors. The purified Cas9 mRNA, gRNA, and Donor plasmid are microinjected into zygotes of C57BL / 6J Gpt background mice; select 10-20 well-formed zygotes that survive after injection for culture into embryos, and then transfer them to pseudopregnant ICR female mice. Wait for the mice to become pregnant and give birth. The F0 generation mice born by the recipient mice are numbered by toe clipping at 14 days, and genomic DNA is extracted for PCR and sequencing identification to confirm the genotype. The positive F0 generation mice (Wif1-P2A-CreERT2 heterozygous mice) are mated with wild-type background mice after sexual maturity, and the F1 generation mice born are numbered by toe clipping at 14 days, and genomic DNA is extracted for identification.

[0074] 4. The genotype identification method of the mice is as follows: the mouse toes are stored in a -20ºC refrigerator. Mouse genomic DNA is extracted using alkaline lysis. When extracting DNA, add 75 µL of 25 mM NaOH / 2 mM EDTA solution, heat in a metal bath at 96ºC for 1 hour, cool to 15ºC (on ice), add 75 µL of 40 mM Tris HCl (pH 5.5), and centrifuge at 4000 rpm for 3 minutes. The supernatant is the DNA solution. DNA amplification is performed according to the following PCR reaction system and PCR program.

[0075] PCR reaction system (total volume 12 µL): 2×Taq PCR Master Mix 6 µL, primer F 0.6 µL, primer R1 0.6 µL, primer R2 0.6 µL, ddH2O 2.2 µL, DNA extraction solution 2 µL.

[0076] The primer sequences are as follows: F: CTGTGAATAATTTTGCAGGGTATGG; R1: GCCCCATCAAAACTGAACTGTCTA; R2: TGAACATGTCCATCAGGTTCTTGC.

[0077] PCR program: Step 1, 94°C for 5 min; Step 2, 94°C for 30 s, 65°C for 30 s, 68°C for 30 s, repeat for 10 cycles; Step 3, 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, repeat for 28 cycles; Step 4, 72°C for 5 min; Step 5, 4°C for storage.

[0078] The amplification products were subjected to agarose gel electrophoresis. A 2% agarose solution was prepared using a TAE buffer solution. 5 μL of EB solution was added to every 100 mL of the solution, and after mixing, it was poured into the gel tank. After complete solidification, DNA samples and 1000 DNA Ladder were added in sequence, and electrophoresis was performed at 180 V for about 30 min. After the gel was taken out, it was placed in a gel imager for exposure and recording of the band position, thereby determining the genotype of the mouse. The genotype results are as follows: wild-type mouse: F+R1 primer, a band of 695 bp is generated; Wif1-P2A-CreERT2 homozygous mouse: F+R2 primer, a band of 300 bp is generated. Wif1-P2A-CreERT2 heterozygous mouse: F+R1 primer and F+R2 primer, two bands of 695 bp and 300 bp are generated, respectively.

[0079] The results are shown in Table 1. Figure 2 Table 1: Genotype identification of Wif1-P2A-CreERT2 heterozygous mice

[0080] Example 2: Construction of Wif1-P2A-CreERT2; Rosa26-tdTomato mice Rosa26-loxP-STOP-loxP-tdTomato (Rosa26-tdTomato) reporter gene: Rosa26 is a ubiquitous expression locus with stable expression characteristics. A construct containing a loxP site-wrapped transcription termination sequence (STOP) and a downstream tdTomato reporter gene is introduced into the locus. Only under the action of Cre recombinase, the STOP sequence is removed, and the expression of tdTomato is activated.

[0081] This example will be constructed Wif1-P2A-CreERT2 hybrid mice with Rosa26-tdTomato homozygous reporter mice, PCR genotyping screening to obtain Wif1-P2A-CreERT2; Rosa26-tdTomato double transgenic mice. The specific method is as follows: 1, Rosa26-tdTomato mice (Ai9 mice) purchased from the Jackson Laboratory in the United States. Rosa26-tdTomato homozygous mice and Wif1-P2A-CreERT2 hybrid mice were mated, and the F1 generation mice born at 14 days were numbered by cutting the toes, and the genomic DNA was extracted for PCR and sequencing identification to confirm the genotype. Positive F1 generation mice of different sexes (Wif1-P2A-CreERT2 hybrid; Rosa26-tdTomato hybrid mice) were mated after sexual maturity, and the F2 generation mice born at 14 days were numbered by cutting the toes, and the genomic DNA was extracted for identification.

[0082] Gene verification: specific primers were designed to detect Wif1-P2A-CreERT2 gene knock-in, and specific primers were designed to detect Rosa26tdTomato reporter gene, and the expected band was verified by agarose gel electrophoresis. The genotype identification method of the mouse is the same as that of Example 1, and the DNA amplification is carried out according to the following PCR reaction system.

[0083] PCR reaction system (total volume 12 μL): 2×Taq PCR Master Mix 6 μL, primer 1 0.6 μL, primer 2 0.6 μL, primer 3 0.6 μL, primer 4 0.6 μL, ddH2O 1.6 μL, DNA extraction solution 2 μL.

[0084] The primer sequences are as follows: Rosa26tdTomato WT F1: AAGGGAGCTGCAGTGGAGTA; Rosa26tdTomato WT R1: CCGAAAATCTGTGGGAAGTC; Rosa26tdTomato Mutant F2: GGCATTAAAGCAGCGTATCC; Rosa26tdTomato Mutant R2: CTGTTCCTGTACGGCATGG; Wif1 F: CTGTGAATAATTTTGCAGGGTATGG; Wif1 WT R1: GCCCCATCAAAACTGAACTGTCTA; Wif1 Mutant R2: TGAACATGTCCATCAGGTTCTTGC.

[0085] Genotype result interpretation: (Wif1-P2A-CreERT2) Wild type mice: F+R1 primers, a band of 695 bp is produced; Wif1-P2A-CreERT2 homozygous mice: F+R2 primers, a band of 300 bp is produced. Wif1-P2A-CreERT2 heterozygous mice: F+R1 primers and F+R2 primers, two bands of 695 bp and 300 bp are produced respectively. (Rosa26-tdTomato) Wild type mice: F1+R1 primers, a band of 297 bp is produced; Rosa26-tdTomato homozygous mice: F2+R2 primers, a band of 196 bp is produced. Rosa26-tdTomato heterozygous mice: F1+R1 primers and F2+R2 primers, two bands of 196 bp and 297 bp are produced respectively.

[0086] The electrophoresis results of F2 generation mice are shown in Figure 3 and Figure 4 Mice numbered 10, 13, 15, 17, 18, 20, 21, 23, 24, 25, 27 are Wif1-P2A-CreERT2; Rosa26-tdTomato mice that can be stably inherited (of which mice numbered 18, 20, 25, 27 are Wif1-P2A-CreERT2; Rosa26-tdTomato homozygous mice), which are used for subsequent breeding and application in research of CAVD and other valve diseases.

[0087] 2. Function verification using Tamoxifen induction activation scheme: Preparation of Tamoxifen solution: 600 μL of absolute ethanol is added to 50 mg of Tamoxifen, which is oscillated for 20 minutes using a shaker, then 4.4 mL of corn oil is added, and after mixing, it is placed in a 37°C water bath ultrasonic instrument for ultrasonic assisted dissolution for 60 minutes. Adult mice (8 weeks old) are injected intraperitoneally with Tamoxifen (75 mg / kg body weight) every other day for 14 days (a total of 7 times).

[0088] Heart sampling and processing: 2 days after the last injection of Tamoxifen, the mice are anesthetized and perfusion fixed, the heart is quickly separated, washed with cold PBS, and embedded in OCT compound for frozen sectioning. Frozen sectioning: The OCT-embedded tissue is quickly frozen at -80°C, sectioned at -20°C, and the thickness is 10 μm. Direct fluorescence observation: The frozen section is stained with DAPI, then directly mounted, imaged and observed under a fluorescence microscope.

[0089] The results are shown in Figure 5As shown, in the heart tissue, red fluorescence was only observed in the valve area, and there were no myocardial and vascular areas. It was proved that the Wif1-P2A-CreERT2; Rosa26-tdTomato mouse was a valve-specific tracing mouse.

[0090] Example 3: Application of Wif1-P2A-CreERT2; Rosa26-tdTomato mouse in CAVD disease This example is based on the Wif1-P2A-CreERT2; Rosa26-tdTomato mouse to establish a CAVD model induced by guide wire injury: 8-week-old mice were first induced by Tamoxifen, and a guide wire was inserted into the aortic valve through the common carotid artery to cause mechanical damage to the valve by repeatedly stretching the guide wire. Two weeks and four weeks after the guide wire injury, the mouse heart was taken for frozen section, and the change of the number of tdTomato positive valve cells in the disease process was observed under a fluorescence microscope. The specific process is as follows: 1. The Wif1-P2A-CreERT2; Rosa26-tdTomato double transgenic mice at 8 weeks of age were injected intraperitoneally with Tamoxifen (75 mg / kg / day, every other day for 14 days, a total of 7 times) to specifically label the heart valve Wif1+ cells as tdTomato fluorescent signal positive, and then the right common carotid artery was exposed under isoflurane inhalation anesthesia, a 0.014-inch guide wire was inserted into the aorta through the common carotid artery, and the guide wire was repeatedly stretched 50 times through the aortic valve to cause mechanical damage to the valve. After the operation, the wound was sutured, and the sham operation group only underwent vascular exposure operation. Two weeks and four weeks after the operation, the sample was obtained by heart perfusion, washed with cold PBS, and embedded in OCT compound for frozen section. After preparing 10 μm thick sections, the nucleus was stained with DAPI and then directly mounted. Fluorescence microscope imaging was used to observe the tdTomato positive cells.

[0091] The results are shown in Figure 6 The mouse heart valve of the sham operation group showed red fluorescently labeled valve cells. The mouse heart valve of the guide wire injury group showed no obvious red fluorescence.

[0092] 2. Image J software was used to analyze the density of tdTomato positive cells (cells / mm 2 ) in each valve section, and finally GraphPad Prism 9.0 was used for statistical processing. The difference between the sham operation group and the injury group was compared by unpaired t test (the data are represented as mean ± SEM, P <0.0001), and the results are shown in Figure 7

[0093] Combined with the fluorescence image (see Figure 6 ) and the column chart (see​Figure 7 )It is disclosed that the number of valve cells in CAVD process decreases significantly with pathological progression, verifying the correlation between mechanical stress-induced valve cell loss and calcification development.

[0094] In conclusion, the Wif1-P2A-CreERT2; Rosa26-tdTomato mouse model is successfully constructed, and the specific tracing of heart valve cells is realized, which provides an important experimental tool for the mechanism research and treatment drug development of heart valve diseases.

Claims

1. A method for constructing a mouse model for specifically tracing heart valve cells, characterized in that: The following steps are involved: (1) The Cre recombinase encoding gene was inserted before the stop codon of the mouse Wif1 gene to construct Wif1-Cre heterozygous mice expressing Cre recombinase under the regulation of the endogenous Wif1 gene, wherein the Wif1 gene encodes Wnt inhibitory factor 1; (2) Wif1-Cre heterozygous mice are hybridized with Rosa26-tdTomato homozygous reporter mice to obtain F1 generation mice that are both Wif1-Cre heterozygous and Rosa26-tdTomato heterozygous. Mice of different sexes are then mated to obtain Wif1-Cre-positive and Rosa26-tdTomato-positive double transgenic F2 generation or subsequent generations, which is the mouse model for specific tracing of cardiac valve cells.

2. The construction method according to claim 1, wherein The Cre recombinase encoding gene encodes a Cre-ERT2 fusion protein.

3. The construction method according to claim 1, wherein The 5' end of the Cre recombinase encoding gene contains a 2A self-cleaving peptide encoding sequence.

4. The construction method according to any one of claims 1 to 3, wherein: In step (1), the CRISPR-Cas9 technology is used to insert the Cre recombinase encoding gene before the translation stop codon of the mouse Wif1 gene.

5. The construction method according to claim 4, wherein: The method for constructing the Wif1-Cre heterozygous mouse comprises: a. Construction of gRNA in vitro transcription template and gRNA preparation: A target fragment containing a PAM structure was selected from the protein coding region of the Wif1 gene. The target sequence was 5′-AGGGGTTCACCAGATGTAATTGG-3′. The sense and antisense strands were synthesized and annealed to produce a double-stranded sgRNA insert. This was then inserted into a gRNA expression vector to construct a recombinant plasmid. The gRNA was then produced by in vitro transcription and purification. b. Construction of Donor vector: Centering the insertion site in the mouse Wif1 gene, 1000-1200 bp of sequence upstream and downstream were selected as the 5' homology arm and 3' homology arm, primers were designed, and mouse genomic DNA was used as a template. PCR amplification was performed to obtain the 5' homology arm sequence and 3' homology arm sequence. The 5' homology arm sequence, the gene fragment encoding the Cre recombinase, and the 3' homology arm sequence were sequentially inserted into the cloning vector by Gibson assembly to produce the Donor vector. c. Cas9 mRNA was obtained by linearizing the Cas9 mRNA expression plasmid and then transcribed and purified in vitro; d. The gRNA, Donor vector, and Cas9 mRNA were microinjected into fertilized eggs of C57BL / 6 mice and then transplanted into pseudopregnant female mice. The recipient mice gave birth to the F0 generation, and Wif1-Cre heterozygous F0 mice were screened by genetic identification. These mice were then mated with wild-type C57BL / 6 mice, and Wif1-Cre heterozygous mice were screened by genetic identification from the F1 generation.

6. The construction method according to claim 5, wherein: In step a, the gRNA expression vector uses the pUC57-T7-sgRNA vector; in step b, the cloning vector uses the pBluescript II SK(-) vector, and the nucleotide sequence of the Cre recombinase encoding gene fragment is shown in SEQ ID NO.5; in step c, the Cas9 mRNA expression plasmid uses the pT3TS-nCas9n vector.

7. The construction method according to claim 6, wherein: PCR amplification technology was used to identify whether the Cre recombinase encoding gene was inserted before the stop codon of the Wif1 gene in the offspring mice and whether it contained the Rosa26-tdTomato gene; The primers for identifying the insertion of the Cre recombinase encoding gene consist of primer pair 1 for identifying the wild type and primer pair 2 for identifying the mutant type. The nucleotide sequences of primer pair 1 are 5′-CTGTGAATAATTTTGCAGGGTATGG-3′ and 5′-GCCCCATCAAAACTGAACTGTCTA-3′, respectively; the nucleotide sequences of primer pair 2 are 5′-CTGTGAATAATTTTGCAGGGTATGG-3′ and 5′-TGAACATGTCCATCAGGTTCTTGC-3′, respectively. The identification primers for the Rosa26-tdTomato gene introduction consist of primer pair 3 for identifying the wild type and primer pair 4 for identifying the mutant type. The nucleotide sequences of primer pair 3 are 5′-AAGGGAGCTGCAGTGGAGTA-3′ and 5′-CCGAAAATCTGTGGGAAGTC-3′, respectively; the nucleotide sequences of primer pair 4 are 5′-GGCATTAAAGCAGCGTATCC-3′ and 5′-CTGTTCCTGTACGGCATGG-3′, respectively.

8. Use of a mouse model of specifically traced heart valve cells prepared by the construction method according to any one of claims 1 to 7 in constructing a heart valve disease model.

9. The use according to claim 8, characterized in that The heart valve disease is calcific aortic valve disease.

10. Use of the heart valve disease model prepared by the application according to claim 8 or 9, characterized in that: The heart valve disease model is used to screen drugs for preventing or treating heart valve disease, or to identify biomarkers for diagnosing heart valve disease.

Images