Duck sperm linear rate detection method based on GPX1 gene molecular marker

By detecting the polymorphism of GPX1 gene molecular markers and using PCR amplification and Sanger sequencing methods, the limitations of traditional detection methods were overcome, the genotype identification and breeding optimization of duck sperm linear velocity were achieved, and the breeding performance and breeding efficiency of breeding ducks were improved.

CN120796493APending Publication Date: 2025-10-17JIANGSU INST OF POULTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510938207.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technology cannot accurately analyze the linear velocity of duck sperm at the genetic level. Traditional detection methods are costly and difficult to screen rapidly on a large scale. The application of GPX1 gene intron SNP molecular markers in duck sperm linear velocity detection and breeding is insufficient.

Method used

By detecting the GPX1 gene molecular marker, using specific primer pairs for PCR amplification and Sanger sequencing, the G/G, G/A and A/A polymorphic genotypes were identified, and duck individuals with high sperm linear velocity were screened for use in breeding.

Benefits of technology

It has achieved efficient and low-cost linear rate genotyping of duck sperm, improved the breeding performance of breeding ducks and the efficiency of artificial insemination, and optimized breeding progress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796493A_ABST
    Figure CN120796493A_ABST
Patent Text Reader

Abstract

The invention discloses a duck sperm linear rate detection method based on a GPX1 gene molecular marker, and belongs to the technical field of biology, SNP genetic typing is performed by using a sequencing technology, the GPX1 gene molecular marker significantly related to the sperm linear rate is obtained through whole genome association analysis and screening, and in breeding, according to a breeding target, the GPX1 gene molecular marker is selected from the GPX1 gene molecular marker and the sperm linear rate. By eliminating G / A genotype and A / A genotype individuals and retaining G / G genotype individuals, the reproductive performance of the breeding ducks is improved, the artificial insemination efficiency is optimized, and the breeding progress is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a duck sperm linear velocity detection method based on a GPX1 gene molecular marker, belonging to the field of biotechnology. BACKGROUND

[0002] Duck sperm linear velocity is a core parameter for measuring the quality of male duck sperm, directly reflecting the ability of sperm to move efficiently along a straight trajectory. This indicator plays a decisive role in the successful penetration of the sperm through the zona pellucida of the oocyte and the completion of the fertilization process. The level of sperm linear velocity not only directly affects the fertilization rate and hatching rate of eggs, but also is a key factor in determining whether excellent male duck genetic resources can be efficiently transmitted, reducing breeding costs, and improving overall economic efficiency. However, duck sperm linear velocity is regulated by a variety of complex factors, with the genetic basis being the intrinsic core of determining sperm quality. There are significant differences in sperm motility performance among different breeds and even individuals within the same breed, which is closely related to key sites in their genomes that regulate sperm motility.

[0003] In the prior art, the detection of duck sperm linear velocity mainly relies on traditional sperm analysis methods, such as using a full-automatic sperm analyzer to measure sperm motility parameters. Although these methods can provide quantitative data on sperm linear velocity, they are limited to phenotypic detection and cannot perform accurate genetic analysis and selection at the genetic level. In addition, traditional methods have certain limitations in the detection process, such as high requirements for sample quantity and quality, high detection cost, and difficulty in achieving large-scale rapid screening.

[0004] In terms of genetic analysis, although some studies have used genome-wide association analysis (GWAS) to screen for gene markers related to sperm quality in other animals, relevant research in waterfowl such as ducks is still insufficient. In particular, the direct genetic association mechanism between specific variations in the GPX1 gene and sperm linear velocity, a key economic trait, has not been clearly established. As a core enzyme in the body's antioxidant defense system, glutathione peroxidase 1 (GPX1) is lacking in the prior art in terms of research and application of SNP molecular markers in the intron region of the duck GPX1 gene, especially in the detection and selection of sperm linear velocity.

[0005] Therefore, developing a duck sperm linear velocity detection method based on the genetic level, particularly using GPX1 gene intron SNP molecular markers significantly associated with sperm linear velocity for selection, has important scientific significance and application value for improving the reproductive performance of breeding ducks, optimizing artificial insemination efficiency, and accelerating breeding progress. SUMMARY

[0006] The application aims at solving the problems in the prior art, and provides a duck sperm linear speed detection method based on a GPX1 gene molecular marker, so as to improve the reproductive performance of breeding ducks, optimize artificial insemination efficiency, and accelerate breeding progress.

[0007] In order to achieve the above-mentioned purpose, the application is implemented by the following technical scheme: application of a reagent for detecting a GPX1 gene molecular marker in detecting the linear speed of duck sperm, wherein the molecular marker is located at the 15820062th base of chromosome 13 of a duck reference genome GCF_015476345.1_ZJU1.0 version, and the base mutation is G or A, such as the 59th base shown in sequences SEQ ID NO: 3 or SEQ ID NO: 4; the molecular marker site has G / G, G / A and A / A polymorphisms.

[0008] Further, the linear speed of sperm of a duck with a G / G genotype is higher than that of a duck with a G / A genotype and a duck with an A / A genotype, and the linear speed of sperm of a duck with a G / A genotype is higher than that of a duck with an A / A genotype.

[0009] Further, the reagent comprises a primer pair, and the primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2.

[0010] Further, the method of the application comprises the following steps:

[0011] Step S1: a duck DNA sample to be detected is subjected to PCR amplification by using a duck DNA specific primer pair to obtain an amplification product; the duck DNA specific primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2;

[0012] Step S2: the amplification product is subjected to Sanger sequencing;

[0013] Step S3: the molecular marker genotype of the target site is determined according to the sequencing result of step S2.

[0014] Further, in step S1, the reaction system for PCR amplification has a final concentration of 25 μl, and specifically comprises:

[0015]

[0016] The reaction conditions for PCR amplification are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, a total of 30 cycles; 72℃ extension for 2 min; and 20℃ storage.

[0017] Further, the length of the amplification product is 198bp, and the duck reference genome GCF_015476345.1_ZJU1.0 version 13 chromosome contains the base at position 15820062.

[0018] Further, in step S3, the judgment standard is that the sperm linear velocity of the duck with G / G genotype is higher than that of the duck with G / A genotype and A / A genotype, and the sperm linear velocity of the duck with G / A genotype is higher than that of the duck with A / A genotype.

[0019] The application detects the genotype of the sperm linear velocity of the duck by the GPX1 gene molecular marker, and finds that the sperm linear velocity of the individual with G / G genotype at the age of 43 weeks is higher than that of the individual with G / A genotype and A / A genotype, and the sperm linear velocity of the individual with G / A genotype is higher than that of the individual with A / A genotype. By taking the genomic DNA of the duck to be detected as a template, the specific primer pair is used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can realize the selection of the high and low sperm linear velocity of the duck. In breeding, according to the breeding target, the individuals with G / A genotype and A / A genotype are eliminated, and the individuals with G / G genotype are retained.

[0020] The application has the following beneficial effects: the sperm linear velocity of the duck can be efficiently and quickly identified by the method of the application, which provides a scientific basis for early selection of high-quality male ducks. In addition, the detection method disclosed by the application is simple and easy to operate, and can be carried out in the laboratory, and can also be applied to genomic breeding technology.

[0021] Firstly, the problem that the traditional detection method cannot accurately analyze the sperm linear velocity of the duck from the genetic level and is difficult to meet the demand of modern breeding for genetic improvement is solved; secondly, the blank in the application of the existing gene marker technology in the sperm linear velocity of the duck is filled, and an effective molecular marker is provided for rapid screening and breeding; finally, the detection efficiency is improved, the problems of cost control and large-scale application are solved, and efficient and low-cost selection of breeding ducks is realized. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 is the Manhattan plot of the GWAS analysis of the sperm linear velocity of the duck at the age of 43 weeks.

[0023] Figure 2 is the Sanger sequencing result of the PCR amplification product of the three genotypes.

[0024] Figure 3 is the phenotype distribution map of the chr13:15820062 molecular marker of the three genotypes.

[0025] Upstream primer (SEQ ID NO: 1): 5'-CGGTAAGAAACGAAACTG-3'

[0026] Downstream primer (SEQ ID NO: 2): 5'-AACAGAGCCTCACAGCAC-3'

[0027] SEQ ID NO: 3

[0028] CGGTAAGAAACGAAACTGCTACAAAATCAATGTGCTTCATGTGAAATGTGGGAGAAGGGGGGCAGCTTTCAAATGAAGTGAAGCTGTGTCTAGTGAGCTCGTGGGCTGGATTTCTTGCCGGTGCTCCTTGCAAGGTTGGTTGCTGCTGGCCAAGGCATGGGGGGGGGGTTAAAACTACCTGTGCTGTGAGGCTCTGTT

[0029] SEQ ID NO: 4

[0030] CGGTAAGAAACGAAACTGCTACAAAATCAATGTGCTTCATGTGAAATGTGGGAGAAGGAGGGCAGCTTTCAAATGAAGTGAAGCTGTGTCTAGTGAGCTCGTGGGCTGGATTTCTTGCCGGTGCTCCTTGCAAGGTTGGTTGCTGCTGGCCAAGGCATGGGGGGGGGGTTAAAACTACCTGTGCTGTGAGGCTCTGTT DETAILED DESCRIPTION

[0031] The application will be further described in conjunction with the examples below, but not as a basis for limiting the application.

[0032] Example 1

[0033] This example measures the sperm linear velocity of Shanmagong duck at 43 weeks of age, uses sequencing technology for SNP genotyping, and selects GPX1 gene molecular markers significantly related to sperm linear velocity by whole genome association analysis, and the results are shown in Figure 1

[0034] This example identifies and applies the GPX1 gene molecular marker related to the linear velocity of duck sperm by the following experiments

[0035] 1. Phenotype determination and genotype detection

[0036] ​(1) Experimental materials and sperm linear velocity phenotype determination

[0037] A total of 411 male ducks were selected as experimental animals and housed under identical conditions with free access to food and water. Semen was collected at 43 weeks of age, and sperm linear velocity was measured using an automated sperm analyzer. This phenotypic data was used to measure sperm linear velocity.

[0038] (2) Extraction of genomic DNA

[0039] Blood was collected from the sub-wing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0040] (3) PCR amplification

[0041] The above-extracted genomic DNA was used as a template to amplify a fragment containing the SNP molecular marker at base 15820062 of duck chromosome 13.

[0042] Upstream primer: 5'-CGGTAAGAAACGAAACTG-3' (SEQ ID NO: 1)

[0043] Downstream primer: 5'-AACAGAGCCTCACAGCAC-3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) is:

[0044]

[0045]

[0046] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 60 sec; extension at 72°C for 2 min; and storage at 20°C. 10 μl of the sample was used for agarose detection, and a single target band with a length of 198 bp was amplified, the sequence of which is shown in SEQ ID NO: 3 or SEQ ID NO: 4, and contains base 15820062 of duck chromosome 13.

[0047] (4) Sequencing verification and genotyping

[0048] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram was as follows: Figure 2 shown.

[0049] (5) Phenotypic determination of fertilization rate and hatching rate of fertilized eggs of different genotypes

[0050] From the 411 genotyped Shanma male ducks, randomly select 6 individuals of each G / G, G / A and A / A genotypes (a total of 18 individuals), and require the individuals to be healthy and similar in weight (±5%). 180 Shanma female ducks of 300 days old with egg laying rate of more than 90% for 3 consecutive weeks were selected, and the female ducks were randomly divided into 3 groups, 60 in each group, and were paired with G / G, G / A and A / A genotype male ducks respectively. All female ducks were fed with unified complete feed in the same environment, and the water was free. The male ducks were pre-fed for 2 weeks to adapt to the environment. The semen of the male ducks was collected and mixed with the semen of 6 male ducks of the same genotype group, and the female ducks were artificially inseminated with a dose of 0.05 mL per duck (containing sperm number ≥3×10^7). After continuous insemination for 5 days, the eggs were collected for 3 weeks. The fertilization rate = (fertilized egg number / total incubation egg number) × 100%; the fertilized egg hatching rate = (number of hatched ducklings / fertilized egg number) × 100%.

[0051] 2. Result analysis

[0052] 411 Shanma male ducks of 43 weeks old with clear linear velocity index record were selected for correlation analysis. R 4.0 software t.test test function was used for statistical test, and the genotype and sperm linear velocity of the test duck group were statistically tested by selecting the average value comparison mode between each other. P<0.05 indicates significant difference, and P<0.01 indicates extremely significant difference. The results are shown in Table 1 and Figure 3 As shown in Table 1 and Figure 1, among the detected individuals, there were 154 G / G genotypes, 122 G / A genotypes and 135 A / A genotypes, and the sperm linear velocity of the three genotypes at 43 weeks old was significantly different (P<0.01). The average value of the sperm linear velocity of the G / G genotype at 43 weeks old was 25.215, which was significantly higher than that of the G / A and A / A genotypes (P<0.01), 1.868 higher than that of the G / A genotype and 4.048 higher than that of the A / A genotype. The average value of the sperm linear velocity of the G / A genotype was 23.347, which was significantly higher than that of the A / A genotype (P<0.01), 2.18 higher than that of the A / A genotype. The average value of the fertilization rate of the G / G genotype was 93.9%, and the average value of the fertilized egg hatching rate was 91.8%, which was significantly higher than that of the G / A and A / A genotypes (P<0.05). The results show that the duck GPX1 molecular marker is significantly related to the sperm linear velocity of the duck, and affects the fertilization rate and the fertilized egg hatching rate. According to the actual breeding goal, G / G genotype individuals can be selected to improve the sperm linear velocity, fertilization rate and fertilized egg hatching rate of the duck, and the breeding efficiency can be improved.

[0053] Table 1. Correlation analysis of molecular marker at base 15820062 on chromosome 13 and sperm linear velocity

[0054] Genotype Number / animal Sperm linear velocity at 43 weeks Standard deviation CV G / G 154 25.215 a ]]> 1.103 4.37% G / A 122 23.347 b ]]> 0.942 4.03% A / A 135 21.167 c ]]> 1.134 5.36%

[0055] Table 2. Association analysis of molecular marker at base pair 15820062 on chromosome 13 with fertilization rate

[0056] Genotype Fertilization rate Standard deviation CV G / G 93.9% a ]] 0.7 0.745% G / A 92.3% b ]] 0.6 0.643% A / A 90.5% c ]] 0.8 0.865%

[0057] Table 3. Association analysis of molecular marker at base pair 15820062 on chromosome 13 with hatching rate of fertilized eggs

[0058] Genotype Hatchability of fertilized eggs Standard deviation CV G / G 91.8% a ]]> 0.7 0.767% G / A 90.1% b ]] 0.6 0.662% A / A 88.7% c ]] 0.6 0.669%

[0059] Note: The same column data with the same letter indicates no significant difference, and different letters indicate significant difference (P <0.05).

[0060] The above shows and describes the basic principles, main features and advantages of the present application. However, the above description is only a specific embodiment of the present application, and the technical features of the present application are not limited to this. Any other implementation derived by those skilled in the art without departing from the technical solution of the present application should be covered in the patent scope of the present application.

Claims

1. The use of a reagent for detecting GPX1 gene molecular markers in detecting duck sperm linear velocity, characterized in that: The molecular marker is located at base 15820062 of chromosome 13 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the molecular marker site has G / G, G / A and A / A polymorphisms.

2. The use according to claim 1, characterized in that The sperm linear velocity of G / G genotype ducks was higher than that of G / A and A / A genotype ducks, and the sperm linear velocity of G / A genotype ducks was higher than that of A / A genotype ducks.

3. The use according to claim 1, characterized in that The reagent includes a primer pair, which includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

2.

4. The use according to claim 1, characterized in that The method of application comprises the following steps: Step S1, performing PCR amplification on a duck DNA sample to be tested using a duck DNA-specific primer pair to obtain an amplified product; the duck DNA-specific primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; Step S2, performing Sanger sequencing on the amplified product; Step S3: Determine the molecular marker genotype of the target site based on the sequencing results of step S2.

5. The use according to claim 4, characterized in that In step S1, the final concentration of the PCR amplification reaction system is 25 μl, specifically: The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

6. The use according to claim 4, characterized in that The amplified product is 198 bp in length and contains the 15820062nd base on chromosome 13 of the duck reference genome GCF_015476345.1_ZJU1.0 version.

7. The use according to claim 4, characterized in that In step S3, the judgment standard is that the sperm linear velocity of ducks with G / G genotype at the SNP site is higher than that of ducks with G / A genotype and A / A genotype, and the sperm linear velocity of ducks with G / A genotype is higher than that of ducks with A / A genotype.