SNP (Single Nucleotide Polymorphism) molecular marker, primer pair, kit and detection method for g.64930 site of PPARG (Peroxisome Peroxisome Activated Receptor Gene) gene of Anhui local variety cattle and application of SNP molecular marker
Through the SNP molecular marker and primer pair at the g.64930 site of the PPARG gene in Anhui local cattle breeds, the problem of identifying meat color brightness and muscle pH traits in breeding was solved, efficient and accurate breeding selection was achieved, and the ability to identify meat quality traits was significantly improved.
Patent Information
- Application Number
- CN202510989238.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies in Anhui local cattle breeding have problems of low efficiency and low accuracy, making it difficult to effectively select high-quality beef cattle, especially due to the lack of accurate molecular markers for meat color brightness and muscle pH traits.
Provided are a SNP molecular marker at the g.64930 site of the PPARG gene of an Anhui local breed of cattle and a specific primer pair thereof. PCR amplification and Sanger sequencing are used to detect beef color brightness and muscle pH traits, and the molecular marker is used for selective breeding.
It has achieved accurate identification of beef meat color brightness and muscle pH traits, improved the accuracy and efficiency of breeding, and can significantly distinguish the meat quality characteristics of GG and GT genotype individuals.
Smart Images

Figure CN120796498A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of gene detection technology, and specifically relates to a kind of Anhui local breed cattle PPARG A SNP molecular marker, primer pair, kit, detection method and application of the gene g.64930 site. Background Art
[0002] Anhui Province, located in the heart of the Central Plains Beef Cattle Belt and one of my country's major beef cattle producing areas, boasts significant advantages in beef cattle breeding. Anhui's local breeds, such as Wandong, Wannan, and Dabieshan cattle, are dual-purpose cattle, characterized by tolerance to roughage, heat, and disease, easy fattening, and tender meat. However, during breed improvement and utilization, some herds have gradually declined, necessitating the development of efficient molecular breeding technologies. Furthermore, the quality of meat produced by Anhui's local breeds still lags behind the high-quality, premium beef demanded by the market, necessitating further efforts to select and breed high-quality breeds.
[0003] Peroxisome proliferator-activated receptors (PPARs) PPARG ) is a member of the nuclear hormone receptor superfamily and is one of the key molecules regulating adipocyte differentiation and metabolism in the body. PPARG It plays an indispensable role in the differentiation of adipose tissue. PPARG Gene polymorphisms are associated with meat quality traits, such as PPARG The Q448H mutation site of the gene is significantly correlated with the backfat thickness and water holding capacity of Qinchuan cattle and the unsaturated fatty acids of Korean beef cattle, indicating that PPARG The gene can be used as a candidate gene for meat quality breeding.
[0004] Compared to traditional phenotypic selection, which suffers from low efficiency and accuracy in animal breeding, single nucleotide polymorphisms (SNPs) offer numerous, widespread, stable, high-throughput, and easily automated detection capabilities, enabling more accurate mapping of genetic diversity among individuals. They are currently a widely used molecular genetic marker in animal genetics and breeding.
[0005] In view of the above technical problems, the present invention provides a molecular marker closely related to the brightness of beef meat color and muscle pH traits, which can be used to selectively breed high-quality beef cattle.
[0006] The specific technical solutions provided by the present invention are as follows: The first aspect of the present invention provides an Anhui local breed cattle PPARG The SNP molecular marker at the gene g.64930 site is located at PPARGThe gene g.64930 locus has a nucleotide sequence as shown in SEQ ID NO. 1 and SEQ ID NO. 2, when the base at the 118th position from the 5' end of the molecular marker is G, the beef color brightness is higher than when the base at the 118th position from the 5' end of the molecular marker is T, and the muscle pH is lower than when the base at the 118th position from the 5' end of the molecular marker is T.
[0007] In a second aspect of the present application, a primer pair for specifically amplifying the molecular marker is provided, which includes a forward primer and a reverse primer, The forward primer is 5'-TGTAACTCAACCTCCTGTT-3'; The reverse primer is 5'-AAGATGCTGTCAGTGAACT-3'.
[0008] In a third aspect of the present application, a method for detecting the Anhui local breed of cattle is provided, PPARG The kit for detecting the SNP molecular marker of the gene g.64930 locus includes the primer pair.
[0009] As a preferred embodiment of the present application, the kit further includes 2x Taq PCR Master mix and deionized water.
[0010] In a fourth aspect of the present application, the use of the molecular marker or the primer pair in identifying the beef color brightness trait is provided.
[0011] In a fifth aspect of the present application, the use of the molecular marker or the primer pair in identifying the beef muscle pH trait is provided.
[0012] In a sixth aspect of the present application, a method for detecting the Anhui local breed of cattle is provided, PPARG The method for detecting the SNP molecular marker of the gene g.64930 locus includes the following steps: Extracting the genomic DNA of the blood of the Anhui local breed of cattle; Using the genomic DNA as a template and performing PCR amplification by using the primer pair of claim 2; After the amplification product is sequenced by Sanger, the sequence is compared with the bovine gene sequence published in the NCBI database to determine the genotypes: GG and GT genotypes. PPARG
[0013] In a seventh aspect of the present application, a method for detecting or identifying the beef color brightness and muscle pH traits is provided, which includes the following steps: detecting the genotype of the gene g.64930 locus in claim 1, the beef color brightness of the GG genotype individual is higher than that of the GT genotype, and the pH of the GT genotype individual is higher than that of the GG genotype. PPARG
[0014] As a preferred embodiment of the present application, the PCR reaction procedure is: 94-95℃ pre-denaturation for 5min-5min30s; 94℃ denaturation for 30s, 54-55℃ annealing for 30-45s, 70-75℃ extension for 30-45s, 30-40 cycles, 70-75℃ keeping for 10min.
[0015] As a preferred embodiment of the present application, the PCR amplification system contains, per 25μL: 2×Taq PCR Master mix 12.5μL, DNA template 2μL, each of upstream and downstream primers 1μL (100ng / μL), deionized water 8.5μL.
[0016] As a preferred embodiment of the present application, the beef is derived from Wadong cattle, Wannan cattle, Dabianshan cattle, Dongliu water buffalo or Jianghuai water buffalo.
[0017] More preferably, the beef is derived from Dabianshan cattle.
[0018] Compared with the prior art, the present application has the following beneficial effects: The present application uses DNA sequencing technology to analyze the polymorphism of five breeds of local cattle in Anhui province. PPARG The research finds that the SNP site g.64930G>T is screened at the 7th exon of the gene. PPARG Further using the least square fitting linear model, the correlation between the polymorphic site of the gene and the meat quality traits of Dabianshan cattle is analyzed. 。 The results show that the g.64930G>T site of the gene is significantly correlated with meat color brightness (L*) and pH (P<0.05), and the GG genotype individuals are significantly higher than the GT genotype in meat color brightness (L*) (P<0.05). PPARG The GT genotype individuals are significantly higher than the GG genotype in pH (P<0.05). PPARG P< P BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is the result of genomic DNA extraction; Figures 2-5 is the result of genomic DNA extraction; PPARG is the result of genomic DNA extraction; Figure 6 is the result of genomic DNA extraction; PPARG is the result of genomic DNA extraction. DETAILED DESCRIPTION
[0020] The technical solutions of the present application are further described in detail below in combination with the drawings and specific embodiments.
[0021] Meat quality evaluation indicators include color, pH, water holding capacity, drip loss, and marbling. Color is a key factor influencing the sales of fresh beef, with consumers typically viewing bright red and cherry red colors as indicative of freshness. pH is closely related to color and water holding capacity, as well as ATP, glycogen, and lactic acid content. The pH value at which glycogenolysis terminates after slaughter can be used to distinguish between PSE, normal, and DFD meat. Therefore, color and pH are crucial indicators for evaluating meat quality.
[0022] The present invention provides a molecular marker located at the g.64930G>T site of the PPARG gene, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1 and SEQ ID NO.2. When the base at position 118 from the 5' end of the molecular marker is G, the meat color brightness of beef is higher and the muscle pH is lower than when the base at position T is T.
[0023] Example 1 Anhui local breed cattle PPARG Genetic diversity analysis 1. Test materials 1.1 Experimental Animals A total of 286 individuals from five local cattle breeds in Anhui Province (Wandong cattle, Wannan cattle, Dabieshan cattle, Dongliu buffalo, and Jianghuai buffalo) were sampled using a random representative sampling method. Detailed information is shown in Table 1.
[0024] Table 1 Sample information of five local cattle breeds in Anhui Province 1.2 Preparation of main reagents and solutions (1) Main reagents Chloroform, isoamyl alcohol, double-distilled water (ddH2O), anhydrous ethanol, and ultrapure water (DI) were all provided by the university laboratory. DNA Marker (DL2000), 6x Loading Buffer, and 2× Taq PCR Master Mix were purchased from Sangon Biotech (Shanghai) Co., Ltd.; agarose was purchased from Mona Biotechnology Co., Ltd.; nucleic acid stain was purchased from Sevier Biotechnology Co., Ltd.; and a blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.
[0025] (2) Preparation of reagents A: PBS buffer: NaCl 8 g, KCl 0.2 g, Na2HPO4·12H2O 3.58 g, KH2PO4 0.27 g, add ddH2O to 1 L, adjust the pH to 7.4, autoclave, and store at 4°C.
[0026] B: 50xTAE: Put 242g Tris and 100mL 0.5mol / L EDTA into a 1L beaker, add 800ml ddH2O into the beaker, stir evenly, then add 57.1ml glacial acetic acid solution, continue to stir. Finally, add enough deionized water until the total volume reaches 1L.
[0027] C: 1xTAE electrode buffer: 20mL 50xTAE, 980mL distilled water to 1L.
[0028] D: 1.5% agarose gel electrophoresis: add 1.5g agarose to 100mL 1xTAE, heat in a microfurnace until melted, when it can be touched by hand, add 5μL nucleic acid dye and mix evenly.
[0029] 1.3, Main instruments The main instruments and equipment required by the present application are shown in Table 2 below.
[0030] Table 2 Main instruments and equipment 2, Test method 2.1, Collection of blood samples Collect the jugular vein blood of 5 breeds of local cattle in Anhui into EDTA anticoagulant tubes, put them into the ice box and take them back to the laboratory, and store them at -20℃ for standby use.
[0031] 2.2, Extraction of genomic DNA Use the animal blood genomic DNA extraction kit to extract genomic DNA from the blood of 286 cattle. The specific operation steps are carried out according to the kit instructions.
[0032] 2.3, Detection of genomic DNA concentration and purity Use Nanodrop one ultramicro spectrophotometer to detect the DNA concentration, and the A 260 : A 280 range of the pure DNA product is 1.7~1.9, and then further verify its integrity. Mix 2μL DNA template with 3μL 6xLoading Buffer, and detect by 1.5% agarose gel electrophoresis. After passing, store at -20℃ for standby use.
[0033] 2.4, Primer design and synthesis According to the bovine PPARGThe gene (ID: 281993) sequence was used to design primers for the exon regions and some intron regions of the gene using Primerpremier 5.0 software. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Details are shown in Table 3.
[0034] Table 3 Anhui local cattle breeds PPARG Gene primer information Note: E: exon; i: intron 2.5 PCR amplification and sequencing The PCR amplification system consisted of 25 μL of the following: 12.5 μL of 2× Taq PCR Master Mix, 2 μL of DNA template, 1 μL of each upstream and downstream primer (100 ng / μL), and 8.5 μL of deionized water. Amplification conditions were as follows: 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing for 30 s (see Table 3 for annealing temperatures), and extension at 72°C for 30 s; a total extension at 72°C for 10 min, and storage at 4°C until use. PCR amplification products were checked by 1.5% agarose gel electrophoresis and sent to Universal Biosystems (Anhui) Co., Ltd. for sequencing.
[0035] 3. Data Analysis 3.1 Genotype frequency and allele frequency Genotype frequency = number of genotyped individuals / total number of measured populations Allele frequency = allele frequency in a population divided by allele frequency Pi: frequency of the i-th allele; i: homozygous multiple allele i1, j2, ... jn: the 1st to nth alleles co-dominant with i 3.2 Hardy-Weinberg equilibrium test Hardy-Weinberg equilibrium is the genotypic frequency state of the two alleles at an autosomal gene locus after random mating in an infinite population.
[0036] Where: Ei represents the theoretical value, Oi represents the actual observed value, and n represents the number of alleles.
[0037] 3.3 Genetic homozygosity Ho ) HoIndicates the degree of purity of a specific allele in a population. Its calculation formula is:
[0038] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.
[0039] 3.4. Heterozygosity He ) He It is the proportion of heterozygotes in a population at a certain locus, which measures the information content of the marker method. The calculation formula is:
[0040] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.
[0041] 3.5. Effective number of alleles Ne ) Ne It is also an indicator of the size of the genetic variation in a population and is expressed as the reciprocal of homozygosity. If the alleles in a population are more evenly distributed, the effective number of alleles will be closer to the actual number of alleles detected.
[0042] Where: i is the i-th allele; pi is the frequency of the i-th allele; n is the number of alleles.
[0043] 3.6、Polymorphic Information Content( PIC ) Polymorphism Information Content PIC ) value is calculated based on the frequency of its allele in a population, indicating the high or low polymorphism of the site.
[0044] Where: pi and pj are the frequencies of the ith and jth alleles respectively; n is the number of alleles. PIC >0.5, highly polymorphic; 0.25< PIC When <0.5, it is moderately polymorphic; PIC When <0.25, it is low polymorphism.
[0045] 3.7 Data Analysis Software The sequencing results were compared with the reference sequence using DNAman software to screen SNP sites. Chromas software was used to analyze the peak chart of the sequencing results to further verify the screened SNP sites.
[0046] 4. Results and analysis 4.1. Genomic DNA quality detection The quality of the extracted genomic DNA was detected by NanoDrop One ultramicro spectrophotometer, and the ratio A 260 / A 280 was in the interval of 1.7-1.9. Further detection was performed by 1.5% agarose gel electrophoresis, and the electrophoresis results are shown in Figure 1. The band was bright, clear, without tailing phenomenon, and the integrity of the band was good. These results showed that the quality of the extracted DNA met the requirements of subsequent experiments.
[0047] 4.2. Anhui local breed cattle PPARG Genetic diversity analysis of genes 4.2.1, PPARG Quality detection of PCR amplification products of genes PPARG The PCR amplification products of genes were detected by 1.5% agarose gel electrophoresis results Figures 2-5 ). Amplification PPARG The specificity of 8 pairs of primers of the gene was good, without dimer, the amplification band was bright, clear and single, the fragment size was as expected, and the subsequent sequencing could be directly performed.
[0048] 4.2.2, PPARG Analysis of gene sequencing results The amplified Anhui local 5 breed cattle population PPARG The whole exon and 1st intron fragment of the gene were sequenced, and the sequencing results were compared with the bovine PPARG Gene reference sequence published by NCBI for analysis. The results showed that: in PPARG The SNP site screened in the gene was g.64930G>T on the 7th exon.
[0049] The nucleotide sequence of the molecular marker containing the above SNP site is shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0050] SEQ ID NO. 1: TGTAACTCAACCTCCTGTTCTGTCTTCCATTTCTGCTCTCCCAGACCGCCCAGGTTTGCTGAACGTGAAGCCCATTGAGGACATACAAGACAATCTGCTGCAAGCCTTGGAGCTGCAGCTCAAGCTGAACCACCCCGAGTCCTCCCAGCTCTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTGACAGAACACGTGCAGCTGTTGCAAGTAATAAAGAAAACAGAGACGGACATGAGTCTCCACCCACTCCTACAGGAAATCTACAAGGACTTGTATTAGCAGAGAAGTCCGAGTTCACTGACAGCATCTT SEQ ID NO. 2: TGTAACTCAACCTCCTGTTCTGTCTTCCATTTCTGCTCTCCCAGACCGCCCAGGTTTGCTGAACGTGAAGCCCATTGAGGACATACAAGACAATCTGCTGCAAGCCTTGGAGCTGCATCTCAAGCTGAACCACCCCGAGTCCTCCCAGCTCTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTGACAGAACACGTGCAGCTGTTGCAAGTAATAAAGAAAACAGAGACGGACATGAGTCTCCACCCACTCCTACAGGAAATCTACAAGGACTTGTATTAGCAGAGAAGTCCGAGTTCACTGACAGCATCTT 4.2.3, Anhui local breed cattle PPARG Population genetic structure analysis of genes (1) PPARG Genetic polymorphism analysis of the 7th exon of the gene In the population of 5 breeds of Anhui local cattle PPARGSNP sites of the 7th exon of the gene were analyzed for gene frequency and genotype frequency (Table 4). In the g.64930G>T site, two genotypes of GG and GT were detected in the five breed cattle populations; in the three common cattle populations, the GG genotype frequency was higher than the GT genotype frequency, which was the dominant genotype, and the Dabie Mountain cattle had the highest GG genotype frequency of 0.83; in the two buffalo populations, the GT genotype frequency was higher than the GG genotype frequency, which was the dominant genotype. However, in the five different breed cattle populations, the frequency of G allele was higher than that of T allele, so G allele was the dominant allele. Among these populations, the G allele frequency of Dabie Mountain cattle was the highest, reaching 0.92.
[0051] According to the calculation of gene frequency and genotype frequency Ne , He , Ho , PIC and Hardy-Weinberg equilibrium, the results are shown in Table 5. The g.64930G>T site in the buffalo population Ne was higher than that in the common cattle population. The polymorphic information content of the two buffalo breed populations was in moderate polymorphism (0.25 PIC <0.5), and the three common cattle breed populations were in low polymorphism ( PIC <0.25). The Jianghuai buffalo in the two buffalo breed populations was in Hardy-Weinberg extremely unbalanced state ( P <0.01), and the Dongliu buffalo and the three common cattle populations were in Hardy-Weinberg balanced state ( P >0.05).
[0052] Table 4 Local breed cattle in Anhui PPARG Gene and genotype frequency of the 7th exon of the gene Table 5 Local breed cattle in Anhui PPARG Genetic variation parameters of the 7th exon of the gene Example 2 Dabie Mountain cattle PPARG Analysis of the correlation between genetic polymorphism and meat quality 1. Test materials and methods 1.1. Sample collection Select 24~30 months old healthy, no disease, similar weight of 56 head of Dabie beef (Anqing Taihu County Juhong Agricultural Comprehensive Development Co., Ltd.). 24 hours before slaughter, no food, health inspection, collection of blood samples 10 mL, after slaughter, take the 12~13 dorsal longissimus dorsi muscle 500 g, washed with physiological saline blood, -20 ℃ preservation for standby.
[0053] 1.2, determination of beef quality (1) crude fat: according to GB / T5009.6-2003 "determination of fat in food", the fat content of Dabie beef longissimus dorsi muscle was determined by soxhlet extraction method.
[0054] (2) meat color: the cut surface of the collected longissimus dorsi muscle was exposed to air and oxygenated for 40 min, and the color difference was measured using Canon CR-S400w handheld colorimeter. The brightness (L*), redness (a*) and yellowness (b*) of the longissimus dorsi muscle were measured. Each sample was measured 3 times, and the average value was taken.
[0055] (3) drip loss: the muscle membrane around the meat sample was removed, and the meat sample was cut into about 5 cm×3 cm×2 cm along the muscle fiber direction. Each meat sample was taken 3 pieces, and the weight (m1) was recorded. The iron wire was bent into a hook shape, hooked on one end, and put into a plastic bag filled with gas to prevent it from falling and avoid contacting the plastic bag. The meat sample was placed in a 4 ℃ refrigerator for 24 h, then the plastic bag was removed, and the juice on the surface of the meat sample was wiped with filter paper and reweighed (m2). The formula is as follows:
[0056] Drip loss (%) = (m1-m2) / m1×100% (4) cooking loss: after removing the connective tissue and fat on the surface of the muscle, it was cut into about 2 cm thick pieces and weighed (recorded as W1). The meat was placed in a high temperature resistant vacuum bag and a thermometer was inserted into the center of the muscle. The bag was tightly sealed and placed in a constant temperature water bath at 80 ℃. The core temperature of the meat sample was raised to 70 ℃. Then the meat sample was taken out of the water bath and cooled naturally in room temperature environment. Then the water on the surface of the meat sample was absorbed with absorbent paper, and the weight was measured (recorded as W2). The formula is as follows:
[0057] Cooking loss (%) = (W1-W2) / W1×100% (5) Shear force: The meat sample was placed in a water bath preheated to 80°C and heated until the temperature of the center of the meat sample reached 70°C, then the meat sample was removed and allowed to cool to room temperature. Ten cylindrical samples with a diameter of 1.27 cm were taken from the meat sample along the muscle fiber direction. The shear force test was performed using a tenderness tester, and the average value of the obtained shear force value was calculated.
[0058] (6) Water loss rate: The meat sample was cut into 2 cm pieces, the weight of the part of the meat sample was weighed and recorded as W1, then it was wrapped with gauze. After that, the wrapped meat sample was placed between two layers of filter paper, a total of 18 layers, and the meat sample was placed on a pressure instrument, a pressure of 25 kg was applied for 5 min, then the pressure was removed. Then the meat sample was weighed again and recorded as W2. The difference between the weight before pressure (W1) and the weight after pressure (W2) is the water loss weight of the meat sample. The calculation formula is:
[0059] Water loss rate (%) = (W1-W2) / W1 x 100% 2) (7) pH: The electrode of the acidity meter was inserted into the meat sample, and three repeated measurements were made for each meat sample, and then the average value of the three measurements was calculated as the pH value of the meat sample.
[0060] 2、Data analysis 2.1、Statistical analysis model First, the data was preliminarily sorted in Excel. Then, using the GLM (General linear model) process of SAS software, combined with the least squares variance analysis model, the differences of meat quality trait indexes between different genotypes were compared. Finally, the significant difference test and multiple comparison of meat quality trait indexes between different genotypes were performed, and the results were presented in the form of mean ± standard deviation.
[0061] The statistical model is: Yij = μ + GENi + GROj + eij Yij is the phenotype value of an individual trait; μ is the population mean; GENi is the genotype effect; GROj is the group effect; eij is the random error 3、Results and analysis Using SAS software, the Dabie Mountain cattle PPARG Genetic polymorphism site genotype and Dabie Mountain cattle intramuscular fat, shear force, drip loss and other 9 meat quality trait indexes were analyzed (Table 6). The g.64930G>T site was significantly related to meat color brightness (L*) and pH, and the GG genotype was significantly higher than the GT genotype in meat color brightness (L*) (P<0.05). P< 0.05), GT genotype individuals were significantly higher than GG genotype (P < 0.05) in pH P <0.05).
[0062] Table 6 PPARG Association analysis of gene SNP with Dabie beef quality Note: different lower case letters indicate significant difference (P < 0.05) between different genotypes at the same locus P <0.05), different upper case letters indicate extremely significant difference (P < 0.01) between different genotypes at the same locus P <0.01).
[0063] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalent technologies, the present application also intends to include these modifications and variations.
Claims
1. A SNP molecular marker at the g.64930 position of the PPARG gene in Anhui local breed cattle, characterized in that: The molecular marker is located at the g.64930 site of the PPARG gene, and its nucleotide sequence is shown in SEQ ID NO.1 and SEQ ID NO.
2. When the base at position 118 from the 5' end of the molecular marker is G, the brightness of the beef color is higher and the muscle pH is lower than when the base at position 118 is T.
2. A primer pair for specifically amplifying the molecular marker according to claim 1, characterized in that: It includes a forward primer and a reverse primer. Forward primer: 5′-TGTAACTCAACCTCCTGTT-3′; Reverse primer: 5′-AAGATGCTGTCAGTGAACT-3′.
3. A kit for detecting SNP molecular markers at the g.64930 site of the PPARG gene in Anhui local breed cattle, characterized in that: It comprises the primer pair according to claim 2.
4. The kit according to claim 3, wherein Also includes 2× Taq PCR Master mix and deionized water.
5. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in identifying the color and brightness trait of beef.
6. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in identifying the pH trait of beef muscle.
7. A method for detecting SNP molecular markers at the g.64930 site of the PPARG gene in Anhui local breed cattle, characterized in that: The following steps are involved: Extract genomic DNA from the blood of Anhui local breed cattle; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 2; The amplified products were sequenced by Sanger sequencing and compared with the bovine PPARG gene sequence published in the NCBI database to determine the genotypes: GG and GT genotypes.
8. A method for detecting or identifying beef color brightness and muscle pH properties, characterized in that: The following steps are involved: The genotype of the g.64930 site of the PPARG gene described in claim 1 is detected. The flesh color brightness of individuals with the GG genotype is higher than that of individuals with the GT genotype, and the pH of individuals with the GT genotype is higher than that of individuals with the GG genotype.
9. The method according to claim 7 or 8, characterized in that The PCR reaction program was as follows: pre-denaturation at 94-95°C for 5 min to 5 min 30 s; denaturation at 94°C for 30 s, annealing at 54-55°C for 30-45 s, extension at 70-75°C for 30-45 s, 30-40 cycles, and holding at 70-75°C for 10 min.
10. The method according to claim 7 or 8, characterized in that The beef comes from Wandong cattle, Wannan cattle, Dabie Mountain cattle, Dongliu buffalo or Jianghuai buffalo.
Citation Information
Cited By
Product, system and method of cell cultivation
US12668774B2
Culture media based on protein hydrolysate and a process for preparing thereof
US12686847B2