PCR primer set, kit and method for rapidly identifying siniperca kneri, megaleyes and their hybrid
By designing PCR primer sets, rapid identification of Changchun bream, blunt snout bream and their hybrids was achieved, solving the problems of complex identification and high equipment requirements in existing technologies, improving identification efficiency and accuracy, and making it suitable for germplasm control in fish fry production.
Patent Information
- Application Number
- CN202511262207.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-09-05
AI Technical Summary
Existing technologies are insufficient for quickly and accurately identifying morphologically similar species such as the Changchun bream, blunt snout bream, and their hybrids. Traditional methods, which rely on morphological characteristics and molecular markers, are complex to operate and require sophisticated equipment, failing to meet the demand for efficient and rapid identification in actual production.
A PCR primer set was designed, including forward primer F and reverse primer R, to achieve rapid identification of Changchun bream, blunt snout bream and their hybrids through a simple PCR amplification method. The primer sequences are SEQ ID No: 1 and SEQ ID No: 2.
It enables rapid and accurate identification of Changchun bream, blunt snout bream and their hybrids, simplifies the identification process, improves identification efficiency, and is suitable for quality control in fish fry production, preventing the production of hybrid fish fry.
Smart Images

Figure CN120796512B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology identification technology, specifically involving PCR primer sets, kits and methods for rapid identification of Changchun bream, blunt snout bream and their hybrids. Background Technology
[0002] The Changchun bream and the bluntnose bream belong to the genera *Bream* and *Brucea*, respectively, within the subfamily Cultinae of the family Cypriniformes. Widely distributed in my country, they are two important freshwater economic fish species in rivers and lakes in eastern my country. Both the bluntnose bream and the Changchun bream have delicious, nutritious flesh, grow rapidly, and have high survival rates in aquaculture. They have been promoted nationwide as high-quality aquaculture species.
[0003] In terms of reproduction, the Changchun bream lays floating eggs, while the blunt-snout bream lays adhesive eggs. Due to their similar breeding seasons, overlapping habitats, and the influence of non-compliant stock enhancement programs, natural hybridization can occur in the wild without human intervention. Therefore, for the purpose of restoring wild resources and protecting wild populations, many provinces and cities have included the Changchun bream and blunt-snout bream in their stock enhancement programs. At the same time, the development and utilization of wild germplasm resources and the collection and preservation of wild parent fish are also gradually underway.
[0004] Currently, the identification of bream species among various fish groups mainly relies on morphological recognition and molecular markers. For example, reference 10.3724 / SP.J.1118.2017.16100 published a comparative analysis of the growth and morphology of hybrid offspring of blunt snout bream and triangular bream or long-necked bream, showing that the hybrid offspring are morphologically similar to the maternal parent. Another example is reference 10.3724 / SP.J.1231.2014.4888, which published the construction and genetic structure analysis of microsatellite DNA fingerprinting profiles for different bream populations. Based on 60 pairs of microsatellite locus marker primers reported in the literature, and through cross-population PCR verification, universal microsatellite primers for various bream species such as long-necked bream and blunt snout bream were developed, and population genetic analysis was performed. Furthermore, the DNA fingerprinting technology developed using 18 universal microsatellite loci can provide a reference for the identification of bream hybrids and paternity. For example, the literature 10.27158 / d.cnki.ghznu.2022.000662 published the development of mitochondrial single nucleotide polymorphisms (SNPs) of Changchun bream, blunt snout bream and their hybrids. Through PCR amplification, sequencing and sequence alignment, some SNP sites with species identification functions can be screened.
[0005] The above methods have significant drawbacks in the breeding, aquaculture promotion, and stock enhancement of Changchun bream and blunt snout bream: 1. The hybrid offspring of Changchun bream and blunt snout bream are morphologically similar to their parent species, and this similarity is based on fully developed individuals. Both Changchun bream and blunt snout bream are laterally compressed fish, making them extremely similar in visible features. Identification mainly relies on the measurement and statistics of morphological characteristics, which in practice is highly dependent on the professional competence and measurement and statistical skills of the operators, making rapid implementation impossible; 2. In the fry stage, both purebred and hybrid fry are incompletely developed, transparent or semi-transparent states, making morphological characteristics even more blurred, and even impossible to measure and count; 3. Microsatellite marker technology in aquaculture is mainly used for population genetic structure and pedigree analysis. Currently, no reports have been found of single microsatellite markers with the function of identifying hybrids of Changchun bream and blunt snout bream. Identifying bream and silver carp genera using DNA fingerprinting based on multiple microsatellite loci requires advanced instruments such as sequencers or capillary electrophoresis, which is labor-intensive and time-consuming, hindering efficient and rapid identification in practical production. 4. The mitochondrial SNP method for identifying Changchun bream, blunt-snout silver carp, and their hybrids also requires cumbersome steps such as PCR, sequencing, and sequence alignment, further hindering efficient and rapid identification in practical production. Therefore, traditional morphological recognition and molecular markers are no longer sufficient to meet current practical needs, and researchers urgently need to develop targeted reagent kits and identification methods for hybrids.
[0006] Therefore, how to quickly identify and confirm fish species information from morphologically similar species such as the Changchun bream, blunt snout bream, and their hybrids is an urgent problem that staff need to solve in the process of protecting wild germplasm resources. Summary of the Invention
[0007] This invention provides a PCR primer set, kit, and method for rapid identification of Changchun bream, blunt snout bream, and their hybrids. The kit and method designed using this PCR primer set enable rapid identification of Changchun bream, blunt snout bream, and their hybrids.
[0008] The objective of this invention is achieved through the following technical solution:
[0009] A PCR primer set for rapid identification of Changchun bream, blunt snout bream and their hybrids is provided. The primer set includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No: 2.
[0010] Among them, SEQ ID No: 1 GGCCCACCAAGATACTTCAGA;
[0011] SEQ ID No: 2 CCCCTGTGAAAACCCCCTTA.
[0012] The present invention also provides a kit for identifying Changchun bream, blunt snout bream and their hybrids, comprising the PCR primer set as described in claim 1, ddH2O and 2×Taq PCR Mix; wherein the concentration of forward primer F in the PCR primer set is 10 µmol and the concentration of reverse primer R is 10 µmol.
[0013] Preferably, the concentration of forward primer F is 10 µmol and the concentration of reverse primer R is 10 µmol.
[0014] Preferably, the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 10 s; 56℃ annealing for 30 s; 72℃ extension for 45 s; a total of 35 cycles; a final extension at 72℃ for 5 min; and cooling the product to 4℃ to end the reaction.
[0015] As preferred, the following are (a1) and (a2):
[0016] (a1) Identify Changchun bream, blunt snout bream and their hybrids;
[0017] (a2) Detect whether the DNA sample to be tested originates from Changchun bream, blunt snout bream and their hybrids.
[0018] Compared with the prior art, the advantages or beneficial effects of the technical solution of this application include:
[0019] 1. This invention develops a rapid PCR primer set for identifying *Cyprinus longicornis*, *Cyprinus bluntnose*, and their hybrids. Using only this primer set and simple PCR amplification, *Cyprinus longicornis*, *Cyprinus bluntnose*, and their hybrids can be rapidly identified, distinguishing them at the molecular level. Compared to existing technologies that use multiple primers for stepwise detection of multiple fish species, this invention is faster, more accurate, and more efficient, making it easier to apply in practical situations.
[0020] 2. By quickly identifying Changchun bream, blunt snout bream and their hybrids, technicians can better control the genetic quality of the released fish fry and prevent the production of hybrid fish fry in advance during the fry production process. Attached Figure Description
[0021] Figure 1 The results are shown in the PCR electrophoresis detection example. Detailed Implementation
[0022] The following detailed description of the embodiments of this application, in conjunction with the accompanying drawings, will provide a thorough understanding of how this application uses technical means to solve technical problems and achieve corresponding technical effects, enabling its implementation. The embodiments of this application and the various features within them can be combined with each other without conflict, and all resulting technical solutions are within the protection scope of this application.
[0023] It should be clearly stated that the embodiments described below are merely some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without inventive effort are within the scope of protection of this application.
[0024] Example 1: Screening of microsatellite loci for Changchun bream
[0025] Based on the team's self-analyzed Changchun bream T2T (telomere-to-telomere) genome, the genome size is 1.0 G, with an N50 value of 36.79 MB, and it is mounted on 24 pairs of chromosomes. Microsatellite loci were screened in the Changchun bream T2T genome using MISA software. The screening criteria were at least 10 repeats of mononucleotides, at least 6 repeats of dinucleotides, at least 5 repeats of trinucleotides and tetranucleotides, and at least 5 repeats of pentanucleotides and hexanucleotides, with a distance of less than 100 bp between two microsatellite loci considered as one microsatellite locus. A total of 366,939 microsatellite loci were screened in the Changchun bream T2T genome, with a total frequency of 358.74 loci per Mb. -1 .
[0026] Example 2: Microsatellite primer design and e-PCR for Changchun bream
[0027] 250 bp sequences upstream and downstream of microsatellite markers were extracted, and batch primers were designed using Primer3 software. The amplified fragment length ranged from 80 to 1800 bp, the primer size from 20 to 27 bp, the primer GC content from 35% to 65% (optimal 50%), and the TM value from 55 to 65℃ (optimal 57℃). Three primer pairs were designed for each microsatellite marker site. The number of potential binding sites for the designed primers was detected using e-PCR software. Primers were successfully designed for a total of 196,830 microsatellite markers.
[0028] Example 3: Screening of microsatellite marker sites for the identification of Changchun bream, blunt snout bream and their hybrids
[0029] Using e-PCR with blunt snout bream, primers were successfully designed based on a selection of microsatellite markers with 1 binding site and 0 alignment gaps (Gaps). Fifty pairs of primers suitable for e-PCR detection were screened. First, standard primers were synthesized, and initial detection was performed using DNA from one fish each of Changchun bream, blunt snout bream, and hybrid species. The PCR reaction system consisted of genomic DNA (concentration 50 ng·µL). -1 0.5 µL of 2×Taq PCR Mix (Tiangen Biotech (Beijing) Co., Ltd.), 0.8 µL each of forward and reverse primers (10 µmol concentration), and ddH2O to a final volume of 20 µL were added. PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 10 s; 56℃ annealing for 30 s; 72℃ extension for 45 s; 35 cycles in total; final extension at 72℃ for 5 min; product cooling to 4℃ to terminate the reaction. 2 µL of the reaction product was examined by 1.5% agarose gel electrophoresis at 130 V for 30 min, followed by gel imaging. Initial screening identified one suitable microsatellite identification locus: repeat core (TA) 7, located on chromosome 4 of *Brachys edulis*, with start locus 19806532 and stop locus 19806545. Forward primer F: GGCCCACCAAGATACTTCAGA (shown in SEQ ID NO.1), reverse primer R: CCCCTGTGAAAACCCCCTTA (shown in SEQ ID NO.2). The amplification product of this primer in Changchun bream is approximately 154 bp in size, and the amplification product in blunt snout bream is approximately 732 bp in size.
[0030] HEX-labeled fluorescent primers were further synthesized to examine the range of amplification products from multiple individuals. The amplification product type of 30 individuals from *Cyprinus changchunense* was approximately 154 bp (150-158 bp); the amplification product type of 30 individuals from *Brachys chuatsi* was approximately 732 bp (728-736 bp).
[0031] Example 4: Accuracy test of identification of Changchun bream, blunt snout bream and their hybrids
[0032] Sixteen Changchun bream, sixteen blunt-snout bream, and sixteen hybrids were collected from the breeding base. Genomic DNA was extracted from fins and standardized to 50 ng·µL. -1 PCR amplification and electrophoresis were performed on DNA samples from 48 tails. The experimental conditions for PCR amplification, electrophoresis, and gel imaging were the same as in point three.
[0033] like Figure 1The results showed that the amplification products of 16 Changchun bream were single bands of approximately 154 bp, the amplification products of 16 blunt snout bream were single bands of approximately 732 bp, and the amplification products of hybrids were double bands of approximately 154 bp and 732 bp. The accuracy of this locus in identifying Changchun bream, blunt snout bream and their hybrids was 100%.
[0034] In this study, the habitats of the Changchun bream and the bluntnose bream overlap and their breeding seasons are close, allowing for natural hybridization. However, most fish hybrids, such as those between the Changchun bream and the topmouth culter, or the bluntnose bream and the topmouth culter, are artificially bred and do not hybridize naturally. In this embodiment, on the one hand, the identification of purebred Changchun bream and bluntnose bream provides technical support for scientific stock enhancement and release, contributing to the restoration of wild germplasm resources; on the other hand, controlling the germplasm of the original parent fish at the source prevents hybrid parent fish from participating in breeding, thus eliminating the production of hybrid fry and adding another layer of security to the germplasm resources.
[0035] This invention is not limited to the specific embodiments described above. The embodiments described above are merely for illustrating the use of this invention in detail, and production methods and technical details with equivalent functions are also part of this invention. In fact, those skilled in the art, based on the foregoing description, can find different adjustments according to their own needs, and these adjustments should all be within the scope of the appended claims.
Claims
1. A PCR primer set for rapid identification of Changchun bream, blunt-snout bream and their hybrids, characterized in that, The primer set includes a forward primer F and a reverse primer R, the nucleotide sequence of which is shown in SEQ ID No: 1, and the nucleotide sequence of which is shown in SEQ ID No:
2.
2. A kit for identifying Changchun bream, blunt-snout bream and their hybrids, characterized in that, It includes the PCR primer set as described in claim 1, ddH2O, and 2×Taq PCR Mix; wherein the concentration of the forward primer F in the PCR primer set is 8-12 µmol and the concentration of the reverse primer R is 8-12 µmol.
3. The reagent kit according to claim 2, characterized in that, The concentration of forward primer F is 10 µmol, and the concentration of reverse primer R is 10 µmol.
4. A method for identifying *Cyprinus longchunensis*, *Cyprinus chuatsi*, and their hybrids, characterized in that, Includes the following steps: S01. Extract DNA from Changchun bream, blunt snout bream and their hybrids; S02. Using the DNA obtained in the above steps as an amplification template, perform PCR amplification using the PCR primer set described in claim 1, and detect the PCR amplification product by agarose gel electrophoresis. S03. If the amplification product is a single band of about 154 bp, it is identified as Changchun bream; if the amplification product is a single band of about 732 bp, it is identified as blunt snout bream; if the amplification product is a double band of about 154 bp and about 732 bp, it is identified as a hybrid of the two.
5. The method according to claim 4, characterized in that, In step S02, the PCR reaction system is as follows: 0.8 µL each of upstream and downstream primers with a concentration of 10 µmol and a concentration of 50 ng·µL. -1 0.5 µL of genomic DNA, 10 µL of 2×Taq PCR Mix, and finally ddH2O to bring the reaction volume to 20 µL.
6. The method according to claim 4, characterized in that, In step S02, the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 10 s; 56℃ annealing for 30 s; 72℃ extension for 45 s; a total of 35 cycles; a final extension at 72℃ for 5 min; and the reaction ends when the product is cooled to 4℃.
7. The application of the PCR primer set according to claim 1, characterized in that, It is either (a1) or (a2): (a1) Identify Changchun bream, blunt snout bream and their hybrids; (a2) Detect whether the DNA sample to be tested originates from Changchun bream, blunt snout bream and their hybrids.
Citation Information
Patent Citations
Method for screening megalobrama amblycephala group combinations with hybrid vigor
CN102487860A
Method for establishment of hybrid strain between bluntsnout bream and topmouth culter and breeding method of topmouth bream
CN102972319A