Primer probe combination, kit, system and detection method for simultaneously detecting bordetella septicum and isospora suis and application of primer probe combination, kit, system and detection method for simultaneously detecting bordetella septicum and isospora suis

By designing specific primer-probe combinations and kits and combining them with PCR technology, the problem of simultaneous detection of Bordetella septicaemia and Isospora suis in pig farms was solved, achieving efficient and accurate diagnosis of mixed infections and reducing losses in the pig farming industry.

CN120796534AActive Publication Date: 2025-10-17HUNAN SHENGCE BIOTECHNOLOGY CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511293225.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-11
Publication Date
2025-10-17
Estimated Expiration
2045-09-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to simultaneously and efficiently detect Bordetella septicaemia and Isospora suis in pig farms, resulting in difficulties in diagnosing mixed infections and causing huge losses to the pig industry.

Method used

A primer-probe combination for the simultaneous detection of Bordetella septicaemia and Isospora suis was designed, including specific primer and probe sequences, and a supporting kit and detection method, using PCR technology for sample analysis.

Benefits of technology

It has achieved high-sensitivity and specificity detection of Bordetella septicaemia and Isospora suis, which can accurately identify mixed infections, reduce diagnostic difficulty, and reduce misdiagnosis and missed diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796534A_ABST
    Figure CN120796534A_ABST
Patent Text Reader

Abstract

The invention discloses a primer probe combination, a kit, a system and a detection method for simultaneously detecting bordetella septicum and isospora suis and application of the primer probe combination, the kit, the system and the detection method. The primer probe combination comprises a first primer probe group for detecting bordetella septicum and a second primer probe group for detecting isospora suis, the first primer probe group comprises primer sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5 and a probe sequence as shown in SEQ ID NO: 6; the second primer probe group comprises primer sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20 and a probe sequence as shown in SEQ ID NO: 14; the 11th nucleotide at the 3'end of the probe sequence of the first primer probe group is locked nucleic acid. The primer probe combination provided by the invention is high in sensitivity and good in specificity, and can be effectively used for detecting bordetella septicum and isospora suis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to a primer probe combination, a kit, a system, a detection method for simultaneously detecting Bordetella bronchiseptica and Isospora suis, and application thereof. BACKGROUND

[0002] With the improvement of the scale of the pig industry, the probability of disease occurrence in pig population increases, thus bringing new challenges to the prevention and control of various diseases of live pigs. Among them, the pig isospora disease is a protozoan disease caused by Isospora suis parasitizing the small intestinal epithelial cells of pigs, and the pig isospora is the main pathogen causing coccidiosis in suckling pigs and weaned piglets. It usually infects 5-14 day old piglets, and is characterized by severe yellow diarrhea and ineffective antibiotic treatment. Pig isospora disease mainly occurs in piglet groups in intensive pig farms, and has the strongest pathogenicity to piglets, mainly showing clinical symptoms such as diarrhea, reduced appetite and weight loss, and severe cases can lead to death. Adult pigs, multiparous sows or farrowing sows are mostly negative infections or worm hosts, and do not show clinical symptoms, but are the source of infection of the disease; Bordetella bronchiseptica (Bb) can cause non-progressive atrophic rhinitis (NPAR) and bronchopneumonia in pigs, and is also one of the important pathogenic factors of porcine respiratory disease complex (PRDC), which brings great loss to the pig industry. According to the current situation of pig disease epidemic, mixed infection of multiple pathogenic bacteria is a trend of disease development in pig farms at present. Therefore, it is urgent to provide related reagents for simultaneously detecting Bordetella bronchiseptica and pig isospora. SUMMARY

[0003] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a primer probe combination for simultaneously detecting Bordetella bronchiseptica and pig isospora.

[0004] The present application also proposes a kit having the above primer probe combination.

[0005] The present application also proposes the application of the above primer probe combination or kit.

[0006] The present application also proposes a method for detecting Bordetella bronchiseptica and pig isospora for non-disease diagnosis purposes.

[0007] The present application also provides a system for detecting Bordetella bronchiseptica and pig isospora.

[0008] According to one aspect of the present application, a primer probe combination for simultaneously detecting B. pilosicoli and I. suis is provided, the primer probe combination comprising a first primer probe combination for detecting B. pilosicoli and a second primer probe combination for detecting I. suis. The first primer probe combination comprises a primer sequence as shown in SEQ ID NO: 4, SEQ ID NO: 5 and a probe sequence as shown in SEQ ID NO: 6. The second primer probe combination comprises a primer sequence as shown in SEQ ID NO: 19, SEQ ID NO: 20 and a probe sequence as shown in SEQ ID NO: 14. The 11th nucleotide from the 3' end of the probe sequence of the first primer probe combination is a locked nucleic acid.

[0009] In some embodiments of the present application, the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a fluorescent quenching group.

[0010] In some embodiments of the present application, the probe sequence of the first primer probe combination and the probe sequence of the second primer probe combination have different fluorescent groups.

[0011] In some embodiments of the present application, the fluorescent group includes, but is not limited to, any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, VIC and TET.

[0012] In some embodiments of the present application, the fluorescent quenching group includes, but is not limited to, any one of super Quenther 1, super Quenther 2, Eclipse, BHQ, TAMRA, MGB and Dabcyl.

[0013] According to a second aspect of the present application, a kit is provided, the kit containing the primer probe combination described above.

[0014] In some embodiments of the present application, the kit further comprises at least one of a PCR reaction solution, Taq DNA polymerase, MgCl2 solution, positive control and negative control.

[0015] In some embodiments of the present application, the PCR reaction solution comprises 2x PCR buffer.

[0016] In some embodiments of the present application, the positive control comprises nucleic acid molecules of B. pilosicoli and I. suis; or a carrier comprising the nucleic acid molecules.

[0017] In some embodiments of the present application, the positive control comprises a recombinant vector comprising a sequence as set forth in SEQ ID NO: 27, a recombinant vector comprising a sequence as set forth in SEQ ID NO: 28, and / or a combination of a recombinant vector comprising a sequence as set forth in SEQ ID NO: 27 and a recombinant vector comprising a sequence as set forth in SEQ ID NO: 28.

[0018] In a third aspect of the present application, the use of the primer probe combination and kit described above is provided, and the use is the use in the preparation of a product for detecting or assisting in the detection of B. piliformis and Isospora suis.

[0019] In some embodiments of the present application, the product is a kit or a chip.

[0020] In some embodiments of the present application, the use of the product is as follows: using pig sample DNA to be tested as a template, the primer probe combination or kit described above is used for PCR amplification to obtain an amplification product; and the amplification product is analyzed.

[0021] In some embodiments of the present application, the reaction system used for PCR amplification is as follows: 2× PCR buffer 1×; upstream primer for detecting B. piliformis 0.05-0.5 pmol / µL; downstream primer for detecting B. piliformis 0.05-0.5 pmol / µL; probe for detecting B. piliformis 0.05-0.3 pmol / µL; upstream primer for detecting Isospora suis 0.1-0.6 pmol / µL; downstream primer for detecting Isospora suis 0.1-0.6 pmol / µL; probe for detecting Isospora suis 0.05-0.3 pmol / µL; Taq DNA polymerase 0.2-0.5 U / µL; MgCl2 solution 0.005-0.03 mol / L; DNA sample to be tested 4-6 µL; ddH2O to 25 µL.

[0022] In some embodiments of the present application, the reaction system used for PCR amplification is as follows: 2× PCR buffer 1×; upstream primer for detecting B. piliformis 0.3 pmol / µL; downstream primer for detecting B. piliformis 0.3 pmol / µL; Probe for detecting B. pilosicoli 0.15 pmol / µL; Upstream primer for detecting I. suis 0.4 pmol / µL; Downstream primer for detecting I. suis 0.4 pmol / µL; Probe for detecting I. suis 0.2 pmol / µL; Taq DNA polymerase 0.4 U / µL; MgCl2 solution 0.016 mol / L; DNA of sample to be tested 4-6 µL; ddH2O to make up to 25 µL.

[0023] In some embodiments of the present application, the reaction procedure of the PCR amplification is as follows: 94-96 ℃ for 1-3 min; then enter the cycle stage: 93-96 ℃ for 5-15 s, 55-62 ℃ for 25-35 s, 40-50 cycles, and collect fluorescence data.

[0024] In some embodiments of the present application, the analysis of the amplification product comprises: statistics of the Ct value of the sample, and result interpretation; the result interpretation is as follows: Positive: if the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli, corresponding to the detection Ct value ≤40, it is reported that the sample is positive for B. pilosicoli; if the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting I. suis, corresponding to the detection Ct value ≤40, it is reported that the sample is positive for I. suis; Negative: if the fluorescence detection channel does not detect the fluorescence signal of the fluorescent group of the probe for detecting B. pilosicoli and I. suis, and no Ct value is detected, it is reported that the sample is negative for B. pilosicoli and I. suis.

[0025] In the fourth aspect of the present application, a method for detecting B. pilosicoli and I. suis for non-disease detection purposes is provided, which comprises the following steps: using the DNA of the pig sample to be tested as a template, and using the above-mentioned primer probe combination or kit to perform PCR amplification to obtain an amplification product; and analyzing the amplification product.

[0026] In some embodiments of the present application, the reaction system used in the PCR amplification is as follows: 2× PCR buffer 1×; Upstream primer for detecting B. pilosicoli 0.05-0.5 pmol / µL; Downstream primer for detecting B. pilosicoli 0.05-0.5 pmol / µL; Probe for detecting B. piliformis 0.05-0.3 pmol / µL; Upstream primer for detecting I. suis 0.1-0.6 pmol / µL; Downstream primer for detecting I. suis 0.1-0.6 pmol / µL; Probe for detecting I. suis 0.05-0.3 pmol / µL; Taq DNA polymerase 0.2-0.5 U / µL; MgCl2 solution 0.005-0.03 mol / L; DNA of sample to be tested 4-6 µL; ddH2O to make up to 25 µL.

[0027] In some embodiments of the present application, the reaction system for the PCR amplification is as follows: 2× PCR buffer 1×; Upstream primer for detecting B. piliformis 0.3 pmol / µL; Downstream primer for detecting B. piliformis 0.3 pmol / µL; Probe for detecting B. piliformis 0.15 pmol / µL; Upstream primer for detecting I. suis 0.4 pmol / µL; Downstream primer for detecting I. suis 0.4 pmol / µL; Probe for detecting I. suis 0.2 pmol / µL; Taq DNA polymerase 0.4 U / µL; MgCl2 solution 0.016 mol / L; DNA of sample to be tested 4-6 µL; ddH2O to make up to 25 µL.

[0028] In some embodiments of the present application, the reaction procedure for the PCR amplification is as follows: 94-96 ℃ for 1-3 min; then entering the cycle stage: 93-96 ℃ for 5-15 s, 55-62 ℃ for 25-35 s, 40-50 cycles, collecting fluorescence data.

[0029] In some embodiments of the present application, the analysis of the amplification product comprises: counting the Ct value of the sample, and making result interpretation; the result interpretation is as follows: Positive: if the fluorescence detection channel detects the fluorescence signal of the fluorescent group of the probe for detecting B. piliformis, and the corresponding detection Ct value is ≤40, it is reported that the sample is positive for B. piliformis; If the fluorescence detection channel detects a fluorescence signal of the fluorescence group of the probe for detecting Isospora suis, the corresponding detection Ct value is ≤40, and the sample is reported as Isospora suis positive; Negative: If the fluorescence detection channel does not detect a fluorescence signal of the fluorescence group of the probe for detecting B. bovis and Isospora suis, no Ct value is detected, and the sample is reported as B. bovis and Isospora suis negative.

[0030] According to a fifth aspect of the present application, a system for detecting B. bovis and Isospora suis is provided, comprising: An amplification module for performing PCR amplification on the genomic DNA of the pig sample to be tested using the primer probe combination or kit described above to obtain an amplification product; An evaluation module for detecting the amplification product and evaluating whether the pig sample to be tested is infected with B. bovis and Isospora suis.

[0031] According to some embodiments of the present application, the system further comprises a DNA template extraction module for extracting the genomic DNA of the sample to be tested.

[0032] According to some embodiments of the present application, at least the following advantages are provided: the primer probe combination for simultaneously detecting B. bovis and Isospora suis provided by the present application has high sensitivity and good specificity, and can be effectively used for the detection of B. bovis and Isospora suis. BRIEF DESCRIPTION OF DRAWINGS

[0033] The present application will be further described below in conjunction with the drawings and examples, wherein: Figure 1 Detection result chart of primer probe combination 1 for detecting B. bovis in the embodiments of the present application; Figure 2 Detection result chart of primer probe combination 2 for detecting B. bovis in the embodiments of the present application; Figure 3 Detection result chart of primer probe combination 3 for detecting B. bovis in the embodiments of the present application; Figure 4 Detection result chart of primer probe combination 4 for detecting B. bovis in the embodiments of the present application; Figure 5 Detection result chart of primer probe combination 1 for detecting Isospora suis in the embodiments of the present application; Figure 6 Detection result chart of primer probe combination 2 for detecting Isospora suis in the embodiments of the present application; Figure 7 Detection result chart of primer probe combination 3 for detecting Isospora suis in the embodiments of the present application; Figure 8A detection result chart of the primer probe group 4 for detecting Isospora suis in the embodiment of the present application; Figure 9 A detection result chart of the primer probe group 5 for detecting Isospora suis in the embodiment of the present application; Figure 10 A detection result chart of the kit for simultaneously detecting B. pilosicoli and Isospora suis. DETAILED DESCRIPTION

[0034] The concept and technical effects of the present application will be described below in combination with embodiments so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0035] Example 1 Design and verification of primer probe combination for simultaneously detecting B. pilosicoli and Isospora suis In the embodiment, a primer probe combination for simultaneously detecting B. pilosicoli and Isospora suis is prepared, and the specific design and verification process is as follows: 1. Design of primer probe The present application selects the conservative gene regions of B. pilosicoli and Isospora suis through a large number of comparison and analysis, and then analyzes whether the selected conservative gene regions can be used to design suitable primer probes by using biological software Oligo 7.60. The data is repeatedly analyzed and screened to obtain a plurality of primer probe pairs. The plurality of primer probe pairs are comprehensively analyzed, and finally the primer probe group 1-4 for detecting B. pilosicoli and the primer probe group 1-5 for detecting Isospora suis are screened. The probes in the primer probe group for detecting B. pilosicoli are comprehensively analyzed, and a nucleotide is selected and replaced with a corresponding locked nucleic acid. The specific sequence is shown in Table 1. The sequence is synthesized by Bailingge Biotechnology (Shanghai) Co., Ltd.

[0036] Table 1

[0037] Wherein, +A represents adding a LNA-A locked nucleotide modification to the C base, and +T represents adding a LNA-T locked nucleotide modification to the C base.

[0038] 2. Optimization of primer probe group The primer probe groups of different groups designed in step (1) (the primer probe group 1-4 for detecting B. pilosicoli and the primer probe group 1-5 for detecting Isospora suis) are used for experiments respectively, and the optimal primer probe group is screened.

[0039] Synthesis of standard plasmid: pUC57 was used as a cloning vector, and recombinant plasmids containing SC target site conserved sequences and Bb target site conserved sequences were synthesized, respectively. The plasmids were synthesized by Shenguo Bioengineering Co., Ltd.

[0040] SC target site conserved sequence 320bp: CCGATAGGTCTAGGTAATCTTGTGAGTATGCATCGTGATGGGGATAGATTATTGCAATTATTAATCTTCAACGAGGAATGCCTAGTAGGCGCAAGTCAGCAGCTTGCGCCGATTACGTCCCTGCCCTTTGTACACACCGCCCGTTGCTCCTACCGATTGAGTGTTCCGGTGAATTATTCGGACCGTTTTGTGGCGCGTTCGTGCCCGAGATGGAAAGTTTTGTGAACCTTAACACTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCCTGCAGCGGAAGCTTGGAAGCCGAATTCCA (SEQ ID NO: 27).

[0041] Bb target site conserved sequence 320bp: GCTACCCAGGGCCGATTGGGACTTGTTCAGGTTGTTCTGGGCAACCAGCGACAAGTAGTTGGTATTGATGACTGCAGCCATGTTGAGGCTCCCAAGAGAGAAAGGCTTCTTCAAACCGGGCAGCTAGGCCGCCCATCTGTAACATCGGACTTTCGCTTGCACAGCGCCGCGATTTCCTTTGTTGCCTGGATTACGGCAGGTTTGCGACGGACTTAAGCAAAAAAAGTGAAGTTCGGAAATGTGCGGGGGAATCTGGCTGCAAAGGGCATGTTCCTGCGGGGACAGGCGCCCGTGCGGTGCGGGCGGGACGGGGCAGGCGC (SEQ ID NO: 28).

[0042] The preparation steps of the detection template are as follows: (1) about 4 µg of original plasmid (specifically, a plasmid containing coccidiosis or septicemic Bacterium) per tube (in dry powder state), 400 µL of 0.01% TE-SDS, shake and mix, and then the liquid is used as the original plasmid (concentration of 1 x 10-2 (2) Take 10µL of the original plasmid and add 990µL of 0.01% TE-SDS, and mark it as 10-2; (3) Take 10µL of the plasmid with a concentration of 10-2 and add 990µL of 0.01% TE-SDS, and mark it as 10-4; (4) Take 100µL of the plasmid with a concentration of 10-4 and add 900µL of 0.01% TE-SDS, and mark it as 10-5; (5) Take 100µL of the plasmid with a concentration of 10-5 and add 900µL of 0.01% TE-SDS, and mark it as =10-6; (6) Take 100µL of plasmid with a concentration of 10-6, add 900µL of 0.01% TE-SDS, and mark it as 10-7; (7) Take 100µL of plasmid with a concentration of 10-7, add 900µL of 0.01% TE-SDS, and mark it as 10-8; (8) Take 100µL of plasmid with a concentration of 10-8, add 900µL of 0.01% TE-SDS, and mark it as 10-9 (the concentration is 1×10 -11 µg / µL).

[0043] Plasmid templates at concentrations of 10-4, 10-5, 10-6, 10-7, and 10-8 were selected (one well was spotted with plasmid at concentrations of 10-4 and 10-5; two replicate wells were spotted with concentrations of 10-6, 10-7, and 10-8). The following reaction system and reaction procedure were used to detect Bordetella septicagensis.

[0044] Select plasmid templates of 10-5, 10-6, 10-7, 10-8, and 10-9 (use plasmid at concentrations of 10-5 and 10-6 in one well each, and 10-7, 10-8, and 10-9 in two replicate wells) and use the following reaction system and reaction procedure to detect Isospora suis.

[0045] The reaction system used for screening Bordetella septica is shown in Table 2, and the reaction system used for screening Isospora suis is shown in Table 3.

[0046] Table 2

[0047] Table 3

[0048] The fluorescence PCR reaction procedures for detecting Bordetella septica and Isospora suis are shown in Table 4.

[0049] Table 4

[0050] Table 5

[0051] Table 6

[0052] The screening results of the primer probe set for detecting B. piliformis are shown in Table 5 and Figure 1-4 As can be seen from the table, primer probe sets 1-4 all have good detection effects. From the Ct values and detection rates of low concentration samples, primer probe set 2 is better than primer probe sets 1, 3-4. Therefore, primer probe set 2 is selected for subsequent experiments.

[0053] The screening results of the primer probe set for detecting I. suis are shown in Table 6 and Figure 5-9 As can be seen from the table, primer probe sets 1-5 all have good detection effects. From the Ct values and detection rates of low concentration samples, primer probe set 4 is better than primer probe sets 1-3, 5. Therefore, primer probe set 4 is selected for subsequent experiments.

[0054] Example 2: A kit for simultaneously detecting B. piliformis and I. suis The kit contains primer probe set 4 for detecting I. suis prepared in Example 1 at a concentration of 50 pmol / µL, primer probe set 2 for detecting B. piliformis at a concentration of 50 pmol / µL, internal standard YI primer probe set at a concentration of 50 pmol / µL, Taq DNA polymerase at a concentration of 5 U / µL, MgCl2 solution at a concentration of 1 mol / L, 2× PCR buffer, negative control and positive control.

[0055] The fluorescence PCR reaction system of the kit is shown in Table 7.

[0056] Table 7

[0057] The fluorescence PCR reaction program is shown in Table 8.

[0058] Table 8

[0059] Sample result determination criteria: FAM detection Ct value ≤ 40, and HEX / VIC channel Ct value ≤ 35 report B. piliformis positive; CY5 detection Ct value ≤ 40, and HEX / VIC channel Ct value ≤ 35 report I. suis positive; FAM and CY5 channel detection has no Ct value, and internal standard (HEX / VIC channel) detection Ct value ≤ 35, report B. piliformis and I. suis negative; FAM or CY5 channel detection 40 < Ct value ≤ 45, and the internal standard (HEX / VIC channel) detects Ct value ≤ 35, report as B. bovis and C. perfiium suspicious, recommended for recheck, with the recheck results as the standard (renewal of nucleic acid extraction and PCR detection); FAM or CY5 channel detection no Ct value and internal standard (HEX / VIC channel) detects no Ct value or Ct value > 35, then the detection result of the sample is invalid, the reasons should be found and excluded, and the sample should be re-detected or re-sampled for experiment.

[0060] The results of simultaneous detection of B. bovis Bb and C. perfiium using the above kit are shown as follows Figure 10 As can be seen from the figure, accurate detection can be achieved.

[0061] Example 3 Optimization of kit system In this example, the amount of primer probe set in the kit in example 2, the amount of MgCl2 solution and the reaction program of fluorescence PCR reaction using the kit were optimized.

[0062] 1. Optimization of primer and probe dosage of primer probe set for detecting B. bovis Bb The fluorescence quantitative PCR reaction system shown in Table 9 was used to screen the dosage of primer and probe. The reaction program was consistent with example 2. The template used for screening was the recombinant plasmid containing B. bovis nucleic acid prepared in example 1, with 10-5 and 10-6 concentrations each point one hole, 10-7, 10-8 and 10-9 concentrations each point 2 holes.

[0063] Table 9

[0064] The results are shown in Table 10, from which it can be seen that group 4 has the best effect, so the addition amount of group 4 is selected for detecting B. bovis, and therefore the final concentration of primer of primer probe set for detecting B. bovis is 0.4 pmol / µL and the final concentration of probe is 0.2 pmol / µL.

[0065] Table 10

[0066] 2. Optimization of primer and probe dosage of primer probe set for detecting C. perfiium SC The primer and probe dosage screening was performed using the fluorescent quantitative PCR reaction system shown in Table 11. The reaction procedure was consistent with that of Example 2. The template used for screening was the recombinant plasmid containing the nucleic acid of Isospora suis prepared in Example 1, with 10-5 and 10-6 concentrations each point one hole, 10-7; 10-8 and 10-9 concentrations each point 2 complex holes.

[0067] Table 11

[0068] The results are shown in Table 12, from which it can be seen that group 3 is the best, so the addition amount of group 3 is selected for detecting Isospora suis, and the final concentration of the primer of the primer and probe group for detecting Isospora suis is 0.3 pmol / µL, and the final concentration of the probe is 0.15 pmol / µL.

[0069] Table 12

[0070] 3. Screening of reaction procedure The detection procedure to be screened is shown in Tables 13-15, respectively. The template used for detection was the recombinant plasmid containing the nucleic acid of B. melitensis and Isospora suis prepared in Example 1, with an addition volume ratio of 1:1, and the fluorescent quantitative PCR reaction system was consistent with that of Example 2.

[0071] Table 13 Reaction procedure 1

[0072] Table 14 Reaction procedure 2

[0073] Table 15 Reaction procedure 3

[0074] Table 16

[0075] The results are shown in Table 16, from which it can be seen that changing the annealing temperature of procedure 3 to 60℃ will promote the FAM channel to move forward by about 0.5 CT, and will not affect the CY5 channel, so procedure 3 is selected for amplification.

[0076] Example 4 Sensitivity test The kit prepared in Example 2 and the use method of the kit were used for sensitivity detection, and the template used for detection was the recombinant plasmid containing the nucleic acid of B. melitensis and Isospora suis prepared in Example 1, with an addition volume ratio of 1:1.

[0077] Preparation of gradient DNA template: The preparation steps of the detection template are as follows: (1) about 4 μg of the original plasmid per tube (in dry powder state), 400 μL of 0.01% TE-SDS is added, and the liquid is used as the original plasmid (concentration of 1 x 10 -2 μg / μL) after shaking and mixing. (2) 10 μL of the original plasmid is taken, 990 μL of 0.01% TE-SDS is added, and it is labeled as 10-2. (3) 10 μL of the 10-2 plasmid is taken, 990 μL of 0.01% TE-SDS is added, and it is labeled as 10-4. (4) 100 μL of the 10-4 plasmid is taken, 900 μL of 0.01% TE-SDS is added, and it is labeled as 10-5. (5) 100 μL of the 10-5 plasmid is taken, 900 μL of 0.01% TE-SDS is added, and it is labeled as 10-6. (6) 100 μL of the 10-6 plasmid is taken, 900 μL of 0.01% TE-SDS is added, and it is labeled as 10-7. (7) 100 μL of the 10-7 plasmid is taken, 900 μL of 0.01% TE-SDS is added, and it is labeled as 10-8. (8) 100 μL of the 10-8 plasmid is taken, 900 μL of 0.01% TE-SDS is added, and it is labeled as 10-9 (concentration of 1 x 10 -11 μg / μL). (9) 500 μL of the 10-9 plasmid is taken, 500 μL of 0.01% TE-SDS is added, and it is labeled as 10-9-1:1 (i.e. concentration of 5 x 10 -12 μg / μL). (10) 200 μL of the 10-9 plasmid is taken, 800 μL of 0.01% TE-SDS is added, and it is labeled as 10-9-1:4 (i.e. concentration of 2 x 10 -12 μg / μL).

[0078] The above gradient DNA template is used for sensitivity detection by using the kit prepared in Example 2 and the use method of the kit.

[0079] Table 17

[0080] The results are shown in Table 17. As can be seen from the table, the sensitivity of the kit prepared in Example 2 for detecting B. piliformis nucleic acid and pig isospora is 5 x 10 -13 μg / μL.

[0081] Example 5 Specificity test The kit prepared in Example 2 and the use method of the kit are used for specificity detection.

[0082] Sample source: The genome of porcine reproductive and respiratory syndrome virus in pig serum was extracted, and cDNA was synthesized by reverse transcription with random primer. The genomes of African swine fever virus, porcine circovirus type 2 and pseudorabies virus sample were extracted, and diluted with 1x TE buffer to 40 ng / μL as sample detection.

[0083] Table 18

[0084] The results are shown in Table 18. As can be seen from the table, the kit prepared in Example 2 has good specificity.

[0085] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A primer-probe combination for simultaneous detection of Bordetella septicaemia and Isospora suis, characterized in that: The primer-probe combination includes a first primer-probe group for detecting Bordetella septica and a second primer-probe group for detecting Isospora suis; The first primer-probe set includes primer sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5 and a probe sequence as shown in SEQ ID NO: 6; The second primer-probe set includes primer sequences as shown in SEQ ID NO: 19 and SEQ ID NO: 20 and a probe sequence as shown in SEQ ID NO: 14; The 11th nucleotide at the 3' end of the probe sequence of the first primer probe set is a locked nucleic acid.

2. The primer-probe combination according to claim 1, characterized in that The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescence quenching group; The fluorescent group includes but is not limited to any one of FAM, ROX, CY5, HEX, JOE, CY3, NED, TAMRA, VIC and TET; The fluorescence quenching group includes but is not limited to any one of Eclipse, BHQ, TAMRA, MGB and Dabcyl.

3. A kit, characterized in that The kit comprises the primer-probe combination according to any one of claims 1 to 2.

4. The kit according to claim 3, wherein The kit further comprises at least one of a PCR reaction solution, Taq DNA polymerase, a MgCl2 solution, a positive control, and a negative control.

5. The kit according to claim 4, characterized in that The positive control includes a recombinant vector containing the sequence shown in SEQ ID NO: 27, a recombinant vector containing the sequence shown in SEQ ID NO: 28 and / or a combination of a recombinant vector containing the sequence shown in SEQ ID NO: 27 and a recombinant vector containing the sequence shown in SEQ ID NO:

28.

6. Use of the primer-probe combination according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 5 in the preparation of a product for detecting or assisting in the detection of Bordetella septica and Isospora suis.

7. The use according to claim 6, characterized in that The method of using the product is as follows: using the pig sample DNA as a template, using the primer-probe combination described in any one of claims 1-2 or the kit described in any one of claims 3-5 to perform PCR amplification to obtain an amplified product; and analyzing the amplified product.

8. The use according to claim 7, characterized in that The reaction system used in the PCR amplification is as follows: 2× PCR buffer1×; Upstream primers for detection of Bordetella septica 0.05-0.5 pmol / µL; Downstream primers for detection of Bordetella septica 0.05-0.5 pmol / µL; Probe for detection of Bordetella septica 0.05-0.3 pmol / µL; For the detection of Isospora suis, the upstream primer was 0.1-0.6 pmol / µL; Downstream primers for detecting Isospora suis 0.1-0.6 pmol / µL; Probe for detection of Isospora suis 0.05-0.3 pmol / µL; Taq enzyme 0.2-0.5U / µL; MgCl2 solution 0.005-0.03 mol / L; 4-6µL of DNA sample to be tested; Add ddH2O to 25 μL; And / or, the reaction program of the PCR amplification is: 94-96° C. 1-3 min; then enter the cycling stage: 93-96° C. 8-12 s, 58-62° C. 25-35 s, 40-50 cycles, and collect fluorescence data.

9. A method for detecting Bordetella septica and Isospora suis for non-disease detection purposes, characterized in that: The method comprises the following steps: using the pig sample DNA to be tested as a template, performing PCR amplification using the primer-probe combination according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 5 to obtain an amplified product; and analyzing the amplified product.

10. A system for detecting Bordetella septica and Isospora suis, characterized in that: The system comprises: an amplification module for performing PCR amplification on the genomic DNA of the pig sample to be tested using the primer-probe combination according to any one of claims 1-2 or the kit according to any one of claims 3-4 to obtain an amplified product; The result evaluation module is used to detect the amplification product and evaluate whether the pig sample to be tested is infected with Bordetella septicaemia and Isospora suis.

Citation Information

Patent Citations

  • Real-time fluorescent PCR (polymerase chain reaction) kit for detecting swing Isospora in piglet umbilical cord blood and application thereof

    CN106435012A

  • Fluorescent PCR detection primer composition capable of simultaneously detecting streptococcus suis and pig bordetella bronchiseptica, and method

    CN110951900A

  • Primer, probe and method for treble fluorescence PCR detection of streptococcus suis, haemophilus parasuis and porcine bronchoseptic porcine bacillus

    CN110951901A

  • Super-multiplex PCR (polymerase chain reaction) primer group and super-multiplex PCR and nanopore sequencing method for detecting broad-spectrum pig pathogens

    CN118240972A

  • Duplex PCR primer group, kit and method for detecting parasitic protozoa of pig intestinal tract

    CN118389703A