SNP molecular marker related to wheat thousand kernel weight and application thereof
By designing SNP molecular markers on the 4A chromosome of the wheat genome and performing dCAPS marker detection, the problem of poor repeatability of wheat thousand-grain weight QTLs across different environments was solved, realizing an efficient identification and breeding method and improving wheat thousand-grain weight.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
- Filing Date
- 2025-08-18
- Publication Date
- 2026-05-15
AI Technical Summary
In existing technologies, QTLs related to the thousand-grain weight of wheat have poor reproducibility across different environments and have a small contribution rate, making them difficult to apply to genetic improvement.
We provide SNP molecular markers located on chromosome 4A of the wheat genome, design dCAPS markers for genotyping, identify CC and TT genotypes by XhoI restriction enzyme digestion, and perform PCR amplification using specific primer combinations to achieve efficient identification of thousand-grain weight-related traits.
By detecting SNP molecular markers, wheat with high thousand-grain weight can be accurately identified, providing a new method for molecular marker-assisted selection breeding and improving wheat yield.
Smart Images

Figure CN120796566B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker breeding technology, and in particular to SNP molecular markers related to the thousand-grain weight of wheat and their applications. Background Technology
[0002] Wheat (Triticum aestivum L.) is one of the most important global food crops and a vital source of energy and nutrition for humankind. Thousand-grain weight (TGW) is a crucial factor in wheat yield and an important indicator of wheat seed quality. Therefore, identifying superior allelic variations in regulating thousand-grain weight and developing functional markers has significant application value in high-yield wheat breeding.
[0003] In recent years, QTL mapping for thousand-grain weight and related traits in wheat has been a research hotspot in wheat yield traits. It has been reported that QTLs for thousand-grain weight and related traits have been mapped to all 21 chromosomes of wheat. For example, Yu Manli et al., using the RIL population created by H307 / Zhengmai 9023, mapped six thousand-grain weight QTLs to chromosomes 1D, 2B, 3D, 6D, and 7A, explaining 4.54-13.14% of phenotypic variation. Gao et al., using the Zhou 8425B / China Spring RIL population, mapped 13 thousand-grain weight QTLs to chromosomes 1AL, 2DL(2), 3DL, 4AL, 4BS, 5AL(2), 5AS, 5BL, 6A, 7AL, and 7BL. Among them, QTKW.caas-6A.1 and QTKW.caas-7AL were detectable in all environments, explaining 4.8-10.3% and 3.5-6.5% of phenotypic variation, respectively. Zhang Zeyuan et al. used a population of 216 recombinant inbred lines constructed from Heshangtou and Longchun 23, and identified 51 QTLs related to grain weight under four different environments using 55kSNP gene chip typing. These included four QTLs that were stable in three or more environments, located on chromosomes 2D, 5A, 6B, and 7D. Kim et al. used F2-F5 crosses between soft and hard wheat to map grain traits and found five QTL loci controlling thousand-grain weight, located on chromosomes 3B, 1AS / 1AL, 1BS / 1BL, 3DL, and 2AS, with each QTL contributing 5.0%-12.2%. Cao Dong et al. used an F2 population to identify five thousand-grain weight QTLs distributed on chromosomes 1B, 5A, 5B, 5D, and 7B, explaining 8.9%-10.9% of phenotypic variation. They also found the same QTL locus controlling multiple traits on chromosomes 5B and 7B, indicating pleiotropic effects.
[0004] Although many QTLs associated with wheat thousand-grain weight have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat thousand-grain weight. Summary of the Invention
[0005] The purpose of this invention is to provide SNP molecular markers related to the thousand-grain weight of wheat and their applications, in order to solve the problems existing in the prior art.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] One of the technical solutions of the present invention is an SNP molecular marker related to the thousand-grain weight of wheat. The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO: 1, wherein the 783rd base of the nucleotide sequence is C or T.
[0008] The second technical solution of the present invention is a method for identifying the thousand-grain weight of wheat using the SNP molecular marker, comprising the following steps: detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the wheat to be identified, wherein the thousand-grain weight of wheat with genotype CC is higher than that of wheat with genotype TT.
[0009] The third technical solution of the present invention is a method for identifying the thousand-grain weight of wheat using the SNP molecular marker, comprising the following steps: detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the wheat to be identified, wherein the thousand-grain weight of wheat with genotype CC is higher than that of wheat with genotype TT.
[0010] The fourth technical solution of the present invention is a primer combination for specifically amplifying the SNP molecular marker, wherein the primer combination includes the sequences shown in SEQ ID NO: 2 to SEQ ID NO: 5.
[0011] The fifth technical solution of the present invention is the application of the SNP molecular marker in the breeding of wheat thousand-grain weight correlation traits.
[0012] The sixth technical solution of this invention is the application of the SNP molecular marker in the identification or auxiliary identification of wheat thousand-grain weight related traits in breeding.
[0013] The seventh technical solution of the present invention is the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of wheat thousand-grain weight-related traits.
[0014] Based on the above technical solution, the present invention has the following technical effects:
[0015] This invention, through genetic variation analysis of a natural wheat population, identified a single SNP corresponding to position 783 from the 5' end of SEQ ID NO: 1. By designing a dCAPS marker for this SNP, two genotypes were found: genotype A (C) and genotype B (T). Association analysis demonstrated that, among the homozygous types of these two genotypes, the thousand-grain weight was: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the aforementioned SNP. Experiments have shown that by detecting this SNP, wheat varieties with higher thousand-grain weight can be identified. This invention provides a novel method for marker-assisted selection breeding of wheat, which is of significant importance in agricultural practices and / or related scientific research for cultivating high-yielding wheat varieties. Attached Figure Description
[0016] Figure 1 The electrophoretic detection results of the SNP-labeled enzyme digestion products developed in this invention are shown; wherein, lane C is the band cleaved by XhoI, and lane T is the band that cannot be cleaved by XhoI.
[0017] Figure 2 This is a schematic diagram of the gene structure and SNP sites of the present invention.
[0018] Figure 3 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.
[0019] Figure 4 This is a schematic diagram showing the association between gene polymorphism sites and thousand-grain weight in a natural population.
[0020] Figure 5 This is a schematic diagram illustrating the correlation analysis results between gene polymorphism sites in a natural population and thousand-grain weight.
[0021] Figure 6 This is the XhoI identification site.
[0022] Figure 7 This is a photo of the wheat sowing site in Example 2.
[0023] Figure 8 This is a photo of the wheat harvesting site in Example 2. Detailed Implementation
[0024] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0025] This invention provides an SNP molecular marker associated with the thousand-grain weight of wheat. The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO: 1, where the 783rd base of the nucleotide sequence is C or T.
[0026] In some specific implementations, the SNP molecular markers include genotypes CC and TT.
[0027] This invention also provides a method for identifying the thousand-grain weight of wheat using the SNP molecular marker, comprising the following steps: detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the wheat to be identified, wherein the thousand-grain weight of wheat with genotype CC is higher than that of wheat with genotype TT.
[0028] In some specific implementations, the method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the wheat genomic DNA to be identified is as follows:
[0029] (1) Using the wheat genomic DNA to be identified as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO: 2 to SEQ ID NO: 3;
[0030] (2) Dilute the PCR product from step (1) and perform PCR amplification using the primer pairs shown in SEQ ID NO: 4 to SEQ ID NO: 5;
[0031] (3) The PCR product of step (2) is digested with XhoI enzyme to obtain the digested product; if the digested product is two or smaller fragments: 94bp, the genotype of the wheat to be tested at the locus is CC; if the digested product is one or larger fragment: 118bp, the genotype of the wheat to be tested at the locus is TT.
[0032] This invention also provides primer combinations for specifically amplifying the SNP molecular marker, the primer combinations comprising the sequences shown in SEQ ID NO: 2 to SEQ ID NO: 5.
[0033] This invention also provides the application of the SNP molecular marker in breeding wheat thousand-grain weight related traits.
[0034] This invention also provides the application of the SNP molecular marker in identifying or assisting in the identification of wheat thousand-grain weight related traits in breeding.
[0035] This invention also provides the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of wheat thousand-grain weight-related traits.
[0036] The wheat materials used in the embodiments of this invention are all from the National Crop Germplasm Bank (https: / / www.cgris.net / home). Material information can be found on the China Crop Germplasm Information Network, website: https: / / www.cgris.net / contact.
[0037] Example 1
[0038] 1.1 Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP
[0039] A SNP was found on wheat chromosome 4A (iwgsc_refseqv1.0 assembly for Triticum aestivum), corresponding to position 783 from the 5' end of SEQ ID NO.1. Two genotypes were found at this locus in the naturally occurring wheat population:
[0040] SEQ ID NO: 1(>chromosome:IWGSC:4A:406557729-406560182):
[0041]
[0042]
[0043] Note: Bold and slanted sites in the sequence are SNP sites. The underlined part represents the sequence from position 384 to 1170 of SEQ ID NO: 1 used for PCR amplification. The double underlined part represents the sequence from position 688 to 805 of SEQ ID NO: 1 used for PCR amplification.
[0044] Genotype A: C; Genotype B: T.
[0045] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:
[0046] F1: ATGAAAGAAGCCCTCCGAGAA (SEQ ID NO: 2);
[0047] R1:TCAGAATAAGGTGCATATCTTCTT (SEQ ID NO: 3)
[0048] F2: CCTGTTTTGAATGTAAGGAC (SEQ ID NO: 4);
[0049] R2: CAAATAACTTCCGGCATGTCTC (SEQ ID NO: 5).
[0050] The sequence from positions 384 to 1170 of SEQ ID NO: 1 was amplified by PCR using primers F1 and R1; the sequence from positions 688 to 805 of SEQ ID NO: 1 was amplified by PCR using primers F2 and R2. Enzyme digestion analysis showed that this polymorphism could be recognized by XhoI.
[0051] 1.2 Establishment of PCR-restriction polymorphism detection and genotyping methods
[0052] 1) Extract genomic DNA from the wheat to be tested.
[0053] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).
[0054] The PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min; and stored at 16℃.
[0055] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×TaqMix 10 μL, primer F2 (10 μmol / L) and primer R2 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.
[0056] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 15 s, for 35 cycles; 72℃ for 10 min, and stored at 16℃.
[0057] 4) Digest the PCR product obtained in step 3) with XhoI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:
[0058] If the enzyme digestion product consists of two or smaller fragments (94 bp), the genotype of the wheat being tested at that locus is C / C; if the enzyme digestion product consists of one or larger fragment (118 bp), the genotype of the wheat being tested at that locus is T / T. Figure 1 ).
[0059] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:
[0060] I: C / C (i.e., homozygous genotype A); II: T / T (i.e., homozygous genotype B).
[0061] Note: The part before the " / " indicates the case on one homologous chromosome, and the part after the " / " indicates the case on another homologous chromosome.
[0062] 1.3 Genotyping of natural populations using dCAPS markers and association analysis with thousand-grain weight trait.
[0063] Each wheat variety in a natural population consisting of 348 hexaploid wheat accessions was used as a test wheat variety. The wheat amplification products were then sequenced and verified. The results are shown in Table 1.
[0064] Table 1 shows the polymorphic sites in the natural wheat population.
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072] Exon capture sequencing was performed on 383 samples, and specific genotyping was conducted on these samples. Genotyping included two cases: homozygous C / C genotype A and homozygous T / T genotype B. For example... Figure 3 Of the 383 materials, 371 materials could be clearly distinguished as homozygous C / C genotype A or homozygous T / T genotype B, while the remaining 12 materials could not be genotyped.
[0073] Furthermore, of these 383 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 35 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 4 As shown, only these 348 data points were used in the association analysis between natural population gene polymorphism sites and thousand-grain weight. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples for association analysis was 331. These 331 samples were used to discover the relationship between molecular markers and traits.
[0074] In 2018, wheat populations of the above-mentioned natural populations were planted in arid and hot fields, dry fields, and hydrothermal fields at the Third Branch Experimental Station of Hebei Agricultural University (Baoding, Hebei); in 2019, they were planted in arid and hot fields, dry fields, hydrothermal fields, and hydroponic fields at the Hengshui Experimental Site of Hebei Agricultural University (Baoding and Hengshui, Hebei); and in 2020, they were planted in dry fields and arid and hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The thousand-grain weight of each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the thousand-grain weight and the polymorphic loci. A mixed linear model + population structure (MLM + (Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.
[0075] Table 2. Association analysis results between gene polymorphism sites in natural populations and thousand-grain weight.
[0076]
[0077]
[0078] The association analysis results in Table 2 show that the differences in thousand-grain weight between the two types of wheat in the natural population composed of 331 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, the thousand-grain weight of wheat of type I was higher than that of wheat of type II. In several environments, the thousand-grain weight of wheat materials of type I was 0.682, 0.628, 0.733, 0.622, 1.065, 0.285, 0.699, 1.096, 0.989, and 0.871 grams higher than that of wheat of type II, respectively. The study of the natural population indicates that type I is a superior genotype for increasing the thousand-grain weight of wheat.
[0079] Example 2
[0080] To further verify that wheat homozygous genotype A is greater than or candidate greater than wheat homozygous genotype B, an association analysis was conducted on the genetic polymorphism sites in natural populations and the thousand-grain weight for another 120 samples (Table 3). Among these 120 samples, 3 samples did not have genotyping, so the actual number of samples for association analysis was 117. These 117 samples were used to verify that there is indeed a relationship between molecular markers and traits.
[0081] Table 3. Validation of the polymorphic sites described in natural wheat populations.
[0082]
[0083]
[0084]
[0085] In 2020, wheat populations of the above-mentioned natural populations were planted in dry-hot and dry-hot and hydrothermal fields at the Hengshui Experimental Site of Hebei Agricultural University (Hengshui, Hebei); in 2021, in dry-hot and dry-hot and hydrothermal and hydrothermal fields at the Pingshan Experimental Site of Hebei Agricultural University (Hengshui and Pingshan, Hebei); and in 2022, in dry-hot and dry-hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The thousand-grain weight of each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the thousand-grain weight and the polymorphic loci. A mixed linear model + population structure (MLM + (Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 4. Figure 5 As shown.
[0086] Table 4. Association analysis results between gene polymorphism sites in natural populations and thousand-grain weight.
[0087]
[0088]
[0089] The association analysis results in Table 4 confirm that the differences in thousand-grain weight between the two types of wheat in the natural population composed of 120 hexaploid wheat accessions shown in Table 3 were statistically significant (P < 0.05). Specifically, the thousand-grain weight of wheat of type I was higher than that of wheat of type II. In several environments, the thousand-grain weight of wheat material of type I was 1.095, 0.544, 0.343, 0.309, 0.745, 0.54, 0.612, 0.514, 0.581, and 0.783 grams higher than that of wheat of type II, respectively. The study of the natural population indicates that type I is a superior genotype for increasing the thousand-grain weight of wheat.
[0090] In summary, this invention discloses a SNP locus associated with wheat thousand-grain weight and its application. Through genetic variation analysis of the coding region of a natural wheat population, this invention identified a SNP corresponding to position 783 from the 5' end of SEQ ID NO: 1. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis showed that among the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting this SNP, wheat with a higher thousand-grain weight can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties or in research.
[0091] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A SNP molecular marker associated with wheat thousand-grain weight, characterized in that, The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO: 1, where the 783rd base is C or T.
2. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular markers include genotypes CC and TT.
3. A method for identifying the thousand-grain weight of wheat using the SNP molecular markers described in claim 1, characterized in that, Includes the following steps: The genotypes of the corresponding single nucleotide polymorphism sites of the SNP molecular markers in the genomic DNA of wheat to be identified were detected. Wheat with genotype CC had a higher thousand-grain weight than wheat with genotype TT.
4. The method according to claim 3, characterized in that, The method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the wheat genomic DNA to be identified is as follows: (1) Using the wheat genomic DNA to be identified as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO: 2~SEQ ID NO: 3; (2) Dilute the PCR product from step (1) and perform PCR amplification using the primer pairs shown in SEQ ID NO: 4~SEQ ID NO: 5; (3) The PCR product of step (2) is digested with XhoI enzyme to obtain the digested product; if the digested product is two fragments, and one of the fragments is 94bp, then the genotype of the wheat to be tested at the locus is CC; if the digested product is a 118bp fragment, then the genotype of the wheat to be tested at the locus is TT.
5. The application of the SNP molecular marker as described in claim 1 or 2 in the breeding of wheat thousand-grain weight trait.
6. The application of the SNP molecular marker as described in claim 1 or 2 in the identification or auxiliary identification of wheat thousand-grain weight trait breeding.
7. The application of the SNP molecular marker as described in claim 1 or 2 in the preparation of products for identification or auxiliary identification of wheat thousand-grain weight traits.