Solid-state visual LAMP primer combination for field detection of foot-and-mouth disease of cattle and sheep, PCR reaction tube, fast detection box for foot-and-mouth disease of cattle and sheep and application

Abstract

The invention relates to the technical field of cattle and sheep foot-and-mouth disease virus detection, in particular to a solid-state visual LAMP primer combination for cattle and sheep foot-and-mouth disease field detection, a PCR reaction tube, a cattle and sheep foot-and-mouth disease rapid detection box and application. The primer combination comprises an FMDV-F3-N1 primer, an FMDV-B3-N1 primer, an FMDV-Bloop-N1 primer, an FMDV-Bloop-N1 primer, an FMDV-Floop-N1 primer, an FMDV-FIP-N1 primer, an FMDV-FIP-N1 primer, and an FMDV-BIP-N1 primer, and the primer combination comprises an FMDV-F3-N1 primer and an FMDV-BIP-N1 primer. And cross reaction with common bovine and sheep epidemic disease pathogens such as bovine viral diarrhea virus and bovine bluetongue virus is avoided. On the basis of a solid-state visual LAMP kit for field detection of foot-and-mouth disease of cattle and sheep, instrument and equipment consumable reagents required by detection are integrated in a pressure-resistant lifting box with the same size as a boarding box, a portable mobile quick detection laboratory is established, and field detection of foot-and-mouth disease of cattle and sheep is realized.

Description

TECHNICAL FIELD

[0001] The application relates to the field of detection techniques for foot-and-mouth disease virus of cattle and sheep, in particular to a primer combination for solid-state visual LAMP (Loop-mediated Amplification) for on-site detection of foot-and-mouth disease of cattle and sheep, a PCR reaction tube, a foot-and-mouth disease rapid detection box for cattle and sheep and application. BACKGROUND

[0002] Foot-and-mouth disease (FMD) is a highly contagious vesicular disease caused by foot-and-mouth disease virus (FMDV) containing an RNA genome, which infects cattle and sheep. It is listed as a class A disease by the World Organization for Animal Health and as a class I infectious disease in China. FMD has a great harm to the cattle and sheep industry and severely restricts trade, causing serious economic losses. Cattle are sensitive to FMDV, and adult cattle infected with FMDV will have a typical symptom of elevated body temperature, oral mucosa and hoof crown and breast vesicles. In severe cases, it can also cause death. Calves may die of acute myocarditis before the vesicles appear. Sheep are not sensitive to FMDV, and the symptoms are not obvious, so it is not easy to be found early. Therefore, early detection, early diagnosis and early prevention and control are the basic principles of controlling the virulent disease. Because some animals have atypical clinical symptoms, especially in the early stage, early and accurate diagnosis of FMD relies on professional experimental methods.

[0003] At present, in addition to the antigen and antibody test strip, the experimental diagnosis method for FMD cannot be released on site, especially the classic RT-PCR and RT-qPCR nucleic acid molecular diagnosis method. A large number of breeders, especially in remote pastoral areas, hope to obtain the diagnosis results at the first time on site, and there is an urgent need to develop a FMDV nucleic acid detection method which is simple to operate, simple in equipment, rapid in reaction, low in cost and low in dependence on professional experiment personnel. Compared with the classic RT-PCR and RT-qPCR nucleic acid molecular diagnosis method, the loop-mediated isothermal amplification method (Loop-mediated Amplification, LAMP) does not need to be amplified in cycles, so a common constant temperature block can complete the amplification reaction. Moreover, because the amplification is extremely rapid, a large amount of amplification product is generated in a short time, and the color change of the reaction tube can be observed by the naked eye after adding dye, and the positive and negative results can be obtained by visualization. The unique advantages of LAMP make it have unique potential for on-site detection. The classic visual LAMP is a liquid reaction, which is not conducive to transportation after dispensing, and is easy to produce pollution and interfere with result interpretation. Compared with the liquid visual LAMP, the solid ready-to-use visual LAMP has more advantages, meets the needs of on-site detection, moves the line of disease prevention and control forward, meets the urgent needs of breeders, and has huge market potential.

[0004] FMDV is divided into seven serotypes, namely O type, A type, C type, Asia1 type, SAT1, SAT2 and SAT3. In China, O type and A type are prevalent, and in the past five years, no A type foot-and-mouth disease has occurred. The FMDV genome is a single-stranded positive RNA, and the 1D gene encoding the structural protein VP1 is the basis for genotyping, and the 3D gene encoding the non-structural protein is highly conserved and is the main molecular target for diagnosing FMD. Although some visual LAMP detection methods for FMD have been developed for the 3D gene, they still cannot be released on site due to insufficient sensitivity or easy contamination. Therefore, it is of great significance to develop a more sensitive visual LAMP detection method that is not prone to contamination. SUMMARY

[0005] In order to solve the above problems, the present application provides a kind of solid-state visual LAMP primer combination for on-site detection of cattle and sheep foot-and-mouth disease, PCR reaction tube, cattle and sheep foot-and-mouth disease rapid detection box and application, the present application is based on years of FMD LAMP research, and the solid-state visual LAMP detection primer combination and PCR reaction tube that can meet the demand of on-site detection of cattle and sheep FMD are developed, and are integrated into portable rapid detection box, which provides a powerful tool for on-site detection of epidemic situation or routine disease monitoring.

[0006] In order to achieve the above purpose, the present application provides the following technical scheme:

[0007] The present application provides a kind of solid-state visual LAMP primer combination for on-site detection of cattle and sheep foot-and-mouth disease, which includes FMDV-F3-N1 primer, FMDV-B3-N1 primer, FMDV-Bloop-N1 primer, FMDV-Floop-N1 primer, FMDV-FIP-N1 primer and FMDV-BIP-N1 primer;

[0008] The nucleotide sequence of the FMDV-F3-N1 primer is shown as SEQ ID No.1;

[0009] The nucleotide sequence of the FMDV-B3-N1 primer is shown as SEQ ID No.2;

[0010] The nucleotide sequence of the FMDV-Bloop-N1 primer is shown as SEQ ID No.3;

[0011] The nucleotide sequence of the FMDV-Floop-N1 primer is shown as SEQ ID No.4;

[0012] The nucleotide sequence of the FMDV-FIP-N1 primer is shown as SEQ ID No.5;

[0013] The nucleotide sequence of the FMDV-BIP-N1 primer is shown as SEQ ID No. 6.

[0014] The application further provides the application of the primer combination in the preparation of a reagent for detecting foot-and-mouth disease of cattle and sheep.

[0015] The application provides a PCR reaction tube for solid-state visual LAMP for on-site detection of foot-and-mouth disease of cattle and sheep, wherein the PCR reaction tube contains the primer combination.

[0016] Preferably, the PCR reaction tube contains 10 μL of RT-LAMP MIX, 0.04 μL of FMDV-F3-N1 primer with a concentration of 100 μM, 0.04 μL of FMDV-B3-N1 primer with a concentration of 100 μM, 0.11 μL of FMDV-Bloop-N1 primer with a concentration of 100 μM, 0.11 μL of FMDV-Floop-N1 primer with a concentration of 100 μM, 0.5 μL of FMDV-FIP-N1 primer with a concentration of 100 μM, 0.5 μL of FMDV-BIP-N1 primer with a concentration of 100 μM, 0.1 mg of agarose, 0.1 mg of β-cyclodextrin and 1 μL of cresol red solution with a concentration of 500 μM.

[0017] Preferably, the PCR reaction tube is an 8-row independent cover PCR reaction tube, and the specification of each PCR reaction tube is 200 μL.

[0018] The application further provides the application of the PCR reaction tube in the preparation of a foot-and-mouth disease device for cattle and sheep.

[0019] Preferably, when the PCR reaction tube is used for detecting foot-and-mouth disease of cattle and sheep, 1 μL of Bst-AMV enzyme mixed solution and 2 μL of a template to be detected are further added to the PCR reaction tube.

[0020] Preferably, the reaction condition for detecting foot-and-mouth disease of cattle and sheep by using the PCR reaction tube comprises a temperature of 65℃ and a time of 60 min.

[0021] After the reaction is completed, when the color in the PCR reaction tube is yellow, the template to be detected is positive; and when the color in the PCR reaction tube is purple, the template to be detected is negative.

[0022] The application further provides a foot-and-mouth disease rapid detection box for on-site detection of foot-and-mouth disease of cattle and sheep by using solid-state visual LAMP, wherein the articles in the box are placed in two layers, and the upper layer is provided with a pipettor, an EP tube rack, a self-sealing bag, a disposable plastic tablecloth, 1 package of 1.5 mL EP tubes, 1 package of 2 mL EP tubes containing 0.5 mL of normal saline, a marker pen, a notepad, 1 pair of scissors and 1 instruction manual.

[0023] Lower layer to put a white thermos cup 1, black thermos cup 1, simple nucleic acid extraction kit, mini metal bath 1, mini centrifuge 1, gun tip box 1, 10ml syringe 20, long cotton swab 2 packs, pasteurization solution 1 bottle, garbage box 1, latex gloves and disposable mask.

[0024] Preferably, the specifications of the pipette are 1000 μL, 200 μL and 10 μL; the number of 1.5ml EP tubes per pack is 100; the number of 2ml EP tubes containing 0.5ml physiological saline per pack is 100; the white thermos cup contains the PCR reaction tube of any one of claims 3-5; the black thermos cup contains Bst-AMV enzyme mixture and positive and negative controls; the gun tip box contains 1ml, 200 μL and 10 μL gun tips; the capacity of the pasteurization solution is 500ml / bottle; and the number of disposable masks is 10.

[0025] The beneficial effects of the present application are:

[0026] The established solid-state visual LAMP method for on-site detection of FMD of cattle and sheep is an RT-LAMP method based on the highly conserved 3D gene of the FMD virus genome. The reaction tube for on-site detection is a pre-packaged 8-row independent cover PCR reaction tube. When used, only 1 μL of Bst-AMV mixed enzyme and 2 μL of the template to be detected per tube need to be added. The total volume of each pre-packaged reaction tube is 17 μL, which contains 0.5% low-melting-point agarose gel, 0.5% β-cyclodextrin and 6 primers. The dye is cresol red (500 μM). The reaction time is 60 minutes and the reaction temperature is 65℃. After the reaction is completed, the reaction tube is taken out and placed at room temperature. The reaction solution quickly solidifies and the color change of the reaction tube is observed within 24 hours. If the reaction tube turns yellow, it is judged to be positive, and if it remains purple, it is judged to be negative. The sensitivity of this solid-state method is 500 copies / reaction (3D gene RNA transcript), which is 20 times more sensitive than the original method (invention patent CN 113564276A, publication date October 29, 2021). This solid-state amplification method does not have cross-reactions with common cattle and sheep disease pathogens such as bovine viral diarrhea virus, bovine blue tongue virus, bovine tuberculous skin disease virus, sheep pox virus and sheep mouth sore virus. Based on the solid-state visual LAMP kit for on-site detection of FMD of cattle and sheep, the required instrument equipment and consumables are integrated in a pressure-resistant pull-out box of the size of a carry-on luggage, establishing a portable mobile rapid detection laboratory to realize on-site detection of FMD of cattle and sheep. BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0028] Figure 1 Figure 1 is agarose gel electrophoresis map of O and A type FMDV 3D gene plasmid;

[0029] Figure 2 Figure 2 is agarose gel electrophoresis map of O and A type FMDV 3D gene RNA transcript;

[0030] Figure 3 Figure 3 is FMD fluorescence RT-LAMP amplification curve map before and after optimization of LAMP primers;

[0031] Figure 4 Figure 4 is solid-state visualized RT-LAMP reaction sensitivity map of FMD in cattle and sheep by original neutral red method;

[0032] Figure 5 Figure 5 is solid-state visualized RT-LAMP reaction sensitivity map of FMD in cattle and sheep by new cresol red method;

[0033] Figure 6 Figure 6 is sensitivity map of solid-state visualized LAMP for on-site detection of FMD in cattle and sheep with 3-month storage period;

[0034] Figure 7 Figure 7 is sensitivity map of solid-state visualized LAMP for on-site detection of FMD in cattle and sheep with 6-month storage period;

[0035] Figure 8 Figure 8 is sensitivity map of solid-state visualized LAMP for on-site detection of FMD in cattle and sheep with 9-month storage period;

[0036] Figure 9 Figure 9 is sensitivity map of solid-state visualized LAMP for on-site detection of FMD in cattle and sheep with 12-month storage period;

[0037] Figure 10 Figure 10 is cattle and sheep foot-and-mouth disease rapid detection box;

[0038] Figure 11 Figure 11 is internal structure (upper and lower two layers) of cattle and sheep foot-and-mouth disease rapid detection box;

[0039] Figure 12 Figure 12 is WOAH recommended FMD fluorescence quantitative TaqMan probe RT-qPCR amplification curve. DETAILED DESCRIPTION

[0040] The application provides a primer combination for solid-state visual LAMP for on-site detection of foot-and-mouth disease of cattle and sheep, which comprises FMDV-F3-N1 primer, FMDV-B3-N1 primer, FMDV-Bloop-N1 primer, FMDV-Floop-N1 primer, FMDV-FIP-N1 primer and FMDV-BIP-N1 primer; the nucleotide sequence of the FMDV-F3-N1 primer is shown as SEQ ID No. 1; the nucleotide sequence of the FMDV-B3-N1 primer is shown as SEQ ID No. 2; the nucleotide sequence of the FMDV-Bloop-N1 primer is shown as SEQ ID No. 3; the nucleotide sequence of the FMDV-Floop-N1 primer is shown as SEQ ID No. 4; the nucleotide sequence of the FMDV-FIP-N1 primer is shown as SEQ ID No. 5; and the nucleotide sequence of the FMDV-BIP-N1 primer is shown as SEQ ID No. 6.

[0041] SEQ ID No. 1:

[0042] 5'- ATGGAACTGGGTTTTACAARCC-3', (R: A or G (purine);

[0043] SEQ ID No. 2:

[0044] 5'- CACACGGCGTTCACCCA-3';

[0045] SEQ ID No. 3:

[0046] 5'- CAGGGCCTCTTTGAGATTCC-3';

[0047] SEQ ID No. 4:

[0048] 5'- CACGGCGTGCAAAGGAGAG-3';

[0049] SEQ ID No. 5:

[0050] 5'- CCTGCCACGGAGATCAACTTCTTTTTGATGGCCTCGAAGACCCTC-3';

[0051] SEQ ID No. 6:

[0052] 5'- ACGAGTACCGGCGTCTCTTYGATTTTACGCAGGTAAAGTGATCTGTAGC-3', (Y: C or T / U (pyrimidine).

[0053] The present invention also provides the use of the primer combination described in the above technical solution in preparing a reagent for detecting foot-and-mouth disease in cattle and sheep.

[0054] The present invention also provides a solid-state visualized LAMP PCR reaction tube for on-site detection of foot-and-mouth disease in cattle and sheep, wherein the PCR reaction tube contains the primer combination described in the above technical solution. In the present invention, the PCR reaction tube preferably contains 10 μL of RT-LAMP MIX (Beijing Mylab Medical Technology Co., Ltd.), 0.04 μL of FMDV-F3-N1 primer at a concentration of 100 μM, 0.04 μL of FMDV-B3-N1 primer at a concentration of 100 μM, 0.11 μL of FMDV-Bloop-N1 primer at a concentration of 100 μM, 0.11 μL of FMDV-Floop-N1 primer at a concentration of 100 μM, 0.5 μL of FMDV-FIP-N1 primer at a concentration of 100 μM, 0.5 μL of FMDV-BIP-N1 primer at a concentration of 100 μM, 0.1 mg of agarose, 0.1 mg of β-cyclodextrin, and 1 μL of cresol red solution at a concentration of 500 μM. In the present invention, the PCR reaction tubes are preferably 8-row PCR reaction tubes with independent caps, and the specification of each PCR reaction tube is 200 μL. In the present invention, the agarose is preferably low-melting-point agarose, with a final concentration of 0.5%.

[0055] The present invention also provides the use of the PCR reaction tube described in the above technical solution in the preparation of cattle and sheep foot-and-mouth disease equipment. In the present invention, when the PCR reaction tube is preferably used for cattle and sheep foot-and-mouth disease detection: 1 μL of Bst-AMV enzyme mixture and 2 μL of the template to be detected are further added to the PCR reaction tube. In the present invention, the reaction conditions for the PCR reaction tube for cattle and sheep foot-and-mouth disease detection preferably include: a temperature of 65°C and a time of 60 minutes. In the present invention, after the reaction is completed, when the color inside the PCR reaction tube is yellow, the template to be detected is positive; when the color inside the PCR reaction tube is purple, the template to be detected is negative.

[0056] In the LAMP reaction, Bst polymerase catalyzes the polymerization of dNTP (deoxynucleoside triphosphate) to form a DNA chain. When catalyzing the connection of dNTP to DNA chain, it breaks the phosphodiester bond at its end, releasing a pyrophosphate (PPi). PPi is further hydrolyzed into two molecules of inorganic phosphate (Pi). Pi dissociates into a small amount of hydrogen ions (H +), so that the system acid is enhanced. With the LAMP amplification, a large number of dNTPs are consumed, and a large amount of Pi is generated by the hydrolysis of PPi, resulting in the gradual decrease of the pH of the reaction system, so that the weakly alkaline initial reaction buffer of the present study becomes acidic. At this time, the neutral red dye in the reaction solution will change from yellow to red, directly indicating the positive amplification result. If the dye in the reaction solution is cresol red, it will change from the initial purple to yellow, directly indicating the positive amplification result.

[0057] The present application also provides a solid-state visual LAMP for on-site detection of foot-and-mouth disease of cattle and sheep, and a foot-and-mouth disease rapid detection box of cattle and sheep. The items in the box are placed in two layers, the upper layer is placed with a pipette, an EP tube rack, a self-sealing bag, a disposable plastic tablecloth, 1 package of 1.5 mL EP tubes, 1 package of 2 mL EP tubes containing 0.5 mL of normal saline, a marker pen, a notebook, 1 pair of scissors and 1 copy of instructions; the lower layer is placed with 1 white thermos cup, 1 black thermos cup, a simple nucleic acid extraction kit, 1 mini metal bath, 1 mini centrifuge, 1 gun tip box, 20 10 ml syringes, 2 packages of long cotton swabs, 1 bottle of pasteurized disinfectant, 1 garbage box, latex gloves and disposable masks. The present application preferably separates the upper and lower layers with a sponge pad, which is beneficial to the transportation and protection of the items in the box. The thermos cup of the present application is added with water 12 hours before use to provide a low-temperature environment for the reaction tube, Bst enzyme and plasmid. The white thermos cup of the present application is additionally provided with a sponge partition, so that the solid ready-to-use FMD LAMP amplification array reaction tube is not frozen, the gel does not crack, and the integrity is maintained.

[0058] In the present application, the specifications of the pipette are 1000 μL, 200 μL and 10 μL; the number of 1.5 mL EP tubes per package is 100; the number of 2 mL EP tubes containing 0.5 mL of normal saline per package is 100; the white thermos cup contains the PCR reaction tube described in the above technical solution; the black thermos cup contains Bst-AMV enzyme mixture and positive and negative controls; the gun tip box contains 1 mL, 200 μL and 10 μL gun tips; the capacity of the pasteurized disinfectant is 500 ml / bottle; and the number of disposable masks is 10.

[0059] In order to further illustrate the present application, the present application will be described in detail below in conjunction with examples, but they should not be understood as limiting the scope of protection of the present application.

[0060] Example 1

[0061] Synthesis of target gene sequence and preparation of its RNA transcript

[0062] All 3D sequences of FMDV were downloaded from GenBank Database, and gene homology analysis was performed by bioinformatics software. The better conserved segment was selected as the target gene segment for commercial synthesis and was ligated to pMD-18T vector. A T7 promoter sequence was added at the 3' end during synthesis to lay the foundation for later preparation of RNA transcripts. The synthesized plasmid was subjected to 1% agarose gel electrophoresis, and the results are shown in Figure 1 . The synthesized 3D sequences of O and A type FMDV containing T7 promoter are as follows:

[0063] The synthesized sequence of the conserved region of 3D gene of A type FMDV (Genbank sequence number OQ356348.1) (SEQ ID No. 7) is as follows:

[0064] GCATCATCAACACAATTTTGAACAACATTTACGTGCTCTACGCCTTGCGTAGACACTATGAGGGAGTTGAGCTGGACACTTACACCATGATCTCCTATGGAGACGACATCGTGGTTGCAAGTGATTACGATCTGGACTTTGAGGCCCTCAAGCCTCACTTCAAATCTCTTGGTCAAACCATTACCCCAGCTGACAAAAGCGACAAAGGTTTTGTTCTTGGTCACTCCATTACCGATGTCACTTTCCTCAAAAGACACTTCCACATGGACTATGGAACTGGGTTTTACAAACCTGTGATGGCCTCGAAGACCCTCGAGGCTATCCTCTCCTTTGCGCGCCGTGGGACCATACAGGAGAAGTTGATCTCCGTGGCAGGACTCGCCGTCCACTCTGGACCTGACGAGTACCGGCGTCTCTTCGAGCCCTTTCAGGGCCTCTTTGAGATTCCAAGCTACAGATCACTTTACCTGCGTTGGGTGAACGCCGTGTGCGGTGACGCATAATACGACTCACTATAGGG (20 bp at the 3' end is a T7 promoter sequence).

[0065] The synthesized sequence of the conserved region of 3D gene of O type FMDV (Genbank sequence number MN062583.1) (SEQ ID No. 8) is as follows:

[0066] GCATCATCAACACAATTTTGAACAACATTTACGTGCTCTACGCCTTGCGTAGACACTATGAGGGAGTTGAGCTGGACACTTACACCATGATCTCCTATGGAGACGACATCGTGGTTGCAAGTGATTACGATCTGGACTTTGAGGCCCTCAAGCCTCACTTCAAATCTCTTGGTCAAACCATTACCCCAGCTGACAAAAGCGACAAAGGTTTTGTTCTTGGTCACTCCATTACCGATGTCACTTTCCTCAAAAGACACTTCCACATGGACTATGGAACTGGGTTTTACAAACCTGTGATGGCCTCGAAGACCCTCGAGGCTATCCTCTCCTTTGCGCGCCGTGGGACCATACAGGAGAAGTTGATCTCCGTGGCAGGACTCGCCGTCCACTCTGGACCTGACGAGTACCGGCGTCTCTTCGAGCCCTTTCAGGGCCTCTTTGAGATTCCAAGCTACAGATCACTTTACCTGCGTTGGGTGAACGCCGTGTGCGGTGACGCATAATACGACTCACTATAGGG(3' end 20bp is a T7 promoter sequence).

[0067] FMDV 3D gene RNA transcript preparation was performed according to the instructions of the commercial T7 in vitro transcription kit. First, a 520bp target fragment was amplified by conventional PCR using a recombinant plasmid containing the 3D target gene as a template, and the target fragment was cut after agarose gel electrophoresis and purified using a commercial gel recovery kit. Then, the recovered target fragment was used as a template for transcription using the in vitro transcription kit to obtain the RNA transcript, which was detected by agarose gel electrophoresis. A band of the expected molecular weight size was observed, which was the 3D gene (520bp) RNA transcript of FMDV A and O ( Figure 2 ), as a template for subsequent RT-LAMP sensitivity analysis.

[0068] Example 2

[0069] On-site detection of bovine and ovine foot-and-mouth disease solid visual LAMP kit

[0070] Based on the previous research on foot-and-mouth disease visual LAMP and the problem of low sensitivity (invention patent application publication number CN 113564276A, publication date October 29, 2021), the LAMP primers were further optimized to improve their detection sensitivity.

[0071] 1. Primer optimization

[0072] The original primer names and sequences are as follows:

[0073] FMDV-3-F3 (SEQ ID No. 9): 5'-ATGGAACTGGGTTTTACAARCC-3'; (R: A or G (purine);

[0074] FMDV-1-B3 (SEQ ID No. 10): 5'-CACACGGCGTTCACCCA-3';

[0075] FMDV-1-Bloop1 (SEQ ID No. 11) 5'-GGCGTGCAAAGGAGAGGAT-3';

[0076] FMDV-1-Floop (SEQ ID No. 12): 5'-CGTGCAAAGGAGAGGATAGC-3';

[0077] FMDV-FIP-1 (SEQ ID No. 13): 5'-CCTGCCACGGAGATCAACTTCTTTTTGATGGCCTCGAAGACCCTC-3';

[0078] FMDV-BIP-1 (SEQ ID No. 14): 5'-ACGAGTACCGGCGTCTCTTYGATTTTACGCAGGTAAAGTGATCTGTAGC-3', (Y: C or T / U (pyrimidine)).

[0079] The optimized primer names and sequences are as follows:

[0080] After further alignment analysis, the loop primers were optimized in this study, and a pair of loop primers were redesigned to improve the amplification efficiency and increase the amount of amplification products.

[0081] FMDV-F3-N1 (SEQ ID No. 1): 5'-ATGGAACTGGGTTTTACAARCC-3';

[0082] FMDV-B3-N1 (SEQ ID No. 2): 5'-CACACGGCGTTCACCCA-3';

[0083] FMDV-Bloop-N1 (SEQ ID No. 3): 5'-CAFFFCCTCTTTGAGATTCC-3';

[0084] FMDV-Floop-N1 (SEQ ID No.: 4): 5'-CACGGCGTGCAAAGGAGAG-3';

[0085] FMDV-FIP-N1 (SEQ ID No.: 5) 5'-CCTGCCACGGAGATCAACTTCTTTTTGATGGCCTCGAAGACCCTC-3';

[0086] FMDV-BIP-N1 (SEQ ID No. 6): 5'-ACGAGTACCGGCGTCTCTTYGATTTTACGCAGGTAAAGTGATCTGTAGC-3'.

[0087] In the case of the reaction solution, the optimized LAMP primer group before and after was used to carry out fluorescent FMD RT-LAMP reaction, and the prepared 3D RNA transcript was used as the amplification template, 65℃, reaction for 60 minutes. The results showed that after the primer was optimized, the reaction sensitivity was significantly improved. When the RNA transcript was 10 6 / μL, the average Tp value (reaction time reaching threshold value) of the optimized primer was 18.24 min, and the Tp value of the unoptimized primer group was 24.88 min Figure 3 After further optimization of the primer, the sensitivity of the fluorescent FMD RT-LAMP reaction was greatly improved, which laid the foundation for visual reaction.

[0088] Table 1 Tp value (mins) of FMD fluorescent RT-LAMP reaction before and after optimization of primer

[0089]

[0090] 2. Solid-state RT-LAMP sensitivity analysis using the original reaction solution

[0091] Using the original reaction solution, i.e. the reaction solution with neutral red as the dye, solid-state reaction was carried out, and 0.5% low-melting-point agarose gel was added to the reaction tube for solid-state amplification reaction. The 3D gene RNA transcript was diluted to 10 7 ,10 6 ,10 5 ,10 4 ,10 3 ,10 2 ,10, 1 copy number / reaction / 2μL, 65℃, reaction for 60 minutes, when the reaction tube turned pink, it was positive, and yellow was negative as the judgment standard. The results showed that its sensitivity was 10 4 copies / reaction, as shown in Figure 4 .

[0092] Table 2 solid RT-LAMP visual amplification system based on the original reaction liquid

[0093]

[0094] 3. Sensitivity analysis of visual RT-LAMP with new solid reaction liquid

[0095] To better reduce the complexity of terminal detection, pre-mixing reaction reagents in the reaction tube can reduce the operation time of the terminal. In addition, liquid dispensing is prone to cause reagent adhesion and bead hanging or exosmosis through the gap of the tube cover during transportation, so the research and development of solid reaction liquid is carried out, which seals the reagents at the bottom of the tube, and

[0096] No need for frozen storage, more suitable for grassroots self-detection. In order to improve the detection sensitivity and upgrade to solid visual LAMP, the reaction liquid is also adjusted accordingly. In the new reaction liquid, 0.

[0097] 5% β-cyclodextrin, dye is changed to cresol red, and the final concentration of low-melting agarose gel is 0.5% (see Table 3).

[0098] According to the pre-dispensing of 17ul / tube, 1.0uL Bst-AMV enzyme mixed solution and 2uL reaction template are added during application. 65℃, reaction for 60 minutes. After the reaction is completed, the reaction tube is taken out and placed at room temperature, and the reaction tube is quickly solidified. The reaction tube turns yellow for positive, and remains purple for negative as the judgment standard. With the RNA transcript as the template, 10 6 ,10 5 ,10 4 ,10 3 ,500,100,10,1

[0099] copies / reaction / 2μL, the results show that its sensitivity is 500 copies / reaction (see Figure 5 ).

[0100] Table 3 solid visual RT-LAMP reaction liquid for on-site detection of bovine and sheep foot-and-mouth disease

[0101] Reagent Component Amount Used RT-LAMP MIX (commercially available) 10 μL F3-N1 / B3-N1 (100 μM) 0.04 μL each Floop-N1 / Bloop-N1 (100 μM) 0.11 μL each FIP-N1 / BIP-N1 (100 μM) 0.5 μL each Low-melting agarose 0.1 mg β-cyclodextrin 0.1 mg Cresol red (500 μM) 1 μL Template to be detected 2 μL Bst-AMV enzyme mix 1.0 μL RNase free dH2O To 20 μL

[0102] 4. Specificity analysis of visual RT-LAMP with new solid reaction liquid

[0103] Using the genomes of common bovine and sheep disease pathogens such as bovine viral diarrhea virus, bovine blue tongue virus, bovine tuberous skin disease virus, sheep pox virus and sheep mouth sore virus as templates, FMD solid visual RT-LAMP reaction was carried out. The results show that the newly prepared solid visual LAMP has good specificity and does not cross-react with these common bovine and sheep disease pathogens.

[0104] 5. FMD solid visual LAMP kit shelf life experiment

[0105] FMD solid visual RT-LAMP reaction tube was stored at 4°C after dispensing, and Bst-AMV enzyme mixture was frozen at -20°C. The shelf life experiment was performed at 3, 6, 9 and 12 months respectively. The sensitivity change was detected with RNA transcript (10 6 , 10 5 , 10 4 , 10 3 , 500, 100, 10, 1 copy / reaction) diluted by multiple times as template, and each reaction was repeated three times. The results showed that the sensitivity of FMD solid visual RT-LAMP reaction appeared a downward trend after low temperature storage, and the sensitivity was 10 3 copies / reaction after 3 months of storage, which decreased by about 1 times compared with that of fresh preparation. However, the sensitivity was still 10 3 copies / reaction until 12 months of storage, and no further decrease was observed, as shown in Figure 6-9 .

[0106] In summary, by further optimizing the LAMP primers targeting the highly conserved region of 3D gene, adding β-cyclodextrin and low melting point agarose in the reaction solution, and using cresol red as dye, the ready-to-use pre-dispensed solid RT-LAMP amplification for FMD of cattle and sheep was realized, with a sensitivity of 500 copies / reaction. The sensitivity of the corresponding kit assembled was stable at 10 3 copies / reaction after 12 months of low temperature storage. The detection results of field samples of cattle and sheep were basically consistent with those of conventional RT-qPCR. The method is simple to operate, simple in equipment (constant temperature heat block), fast in reaction (60 minutes), and has the potential for basic on-site detection.

[0107] Example 3

[0108] FMD rapid detection box

[0109] 1. Assembly of FMD rapid detection box

[0110] In order to further facilitate the use of end users, all instruments, consumables, reagents and health supplies required for detection were concentrated in a detection box similar in size to a boarding box, realizing the convenience of carrying a mobile laboratory and walking out of the detection box. The box was made of light and pressure-resistant aviation materials, and the appearance of the FMD rapid detection box was shown in Figure 10The items in the box are placed in two layers, the upper layer is placed with a pipette (1000 / 200 / 10 uL), an EP tube rack, a self-sealing bag, a disposable plastic tablecloth, 1.5 mL EP tubes 1 package (100 per package), 2 mL EP tubes containing 0.5 mL of normal saline 1 package (100 per package, for sampling), a marker pen, a notebook, a small pair of scissors and an instruction manual. The lower layer is placed with a white thermos cup (containing a solid-state ready-to-use RT-LAMP amplification array reaction tube for foot-and-mouth disease), a black thermos cup (containing Bst enzyme and positive and negative controls), a simple nucleic acid extraction kit, a mini metal bath, a mini centrifuge, a gun tip box (1 mL / 200 uL / 10 uL gun tip), 20 10 ml syringes (for cattle and sheep blood sampling), 2 packages of long cotton swabs (for cattle and sheep oropharyngeal swab collection), 1 bottle of pasteurized disinfectant (500 ml per bottle), a garbage box, latex gloves (large, medium and small, 5 pairs each) and disposable masks (10), as shown in Figure 11

[0111] When in use, first freeze the thermos cup with water 12 hours before use, the purpose is to provide a low temperature environment for the reaction tube, Bst enzyme and plasmid. The reaction tube is placed on a foam or sponge pad, not directly in contact with ice, to prevent gel low temperature cracking.

[0112] 2. Field sample detection and comparison with conventional RT-qPCR

[0113] 30 samples of cattle and sheep were collected on site with the foot-and-mouth disease rapid detection box, including oropharyngeal swabs and resting serum. The genomic RNA / DNA was extracted on site or nearby using the nucleic acid simple extraction kit in the rapid detection box, then the RT-LAMP isothermal amplification was performed according to the instruction manual using the cattle and sheep foot-and-mouth disease on-site detection solid-state visual LAMP kit, 65℃, 60 minutes. The on-site observation results show that the positive and negative reactions are established, the reaction tube color does not change after amplification of the collected sample, maintaining purple, showing that all are FMDV negative.

[0114] The nucleic acid of the field sample was brought back to the laboratory for re-examination using the fluorescence quantitative TaqMan probe method RT-qPCR recommended by WOAH (reaction system see Table 5), the RT-qPCR reaction program was 50℃, 30min; 95℃, 3min; (95℃, 10s, 55℃, 30s, 72℃, 30s) x40 cycles. The positive control of RT-qPCR presents a typical "S" amplification curve, and the negative one does not amplify, the experiment is established Figure 12 ). The detection of 30 field samples of cattle and sheep is negative, consistent with the results of the solid-state visual RT-LAMP detection method.

[0115] Table 4 WOAH recommended fluorescence quantitative TaqMan probe method RT-qPCR reaction system ​

[0116]

[0117] In summary, the solid-state visualized LAMP kit for field detection of FMD in cattle and sheep is integrated with various instruments and consumables required for detection and reagents in a small and portable box, which constitutes a rapid detection box for field detection at the grassroots level, equivalent to a small mobile laboratory. After collecting throat swabs or serum from cattle and sheep, detection can be performed directly without sending or transporting the samples to a conventional laboratory in a remote place, which not only saves time but also greatly reduces the possible spread of the virus during transportation of suspicious positive samples, which is conducive to discovering, extinguishing and controlling FMD epidemic at the first time and the first line.

[0118] Although the above embodiments make a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. A primer combination for solid-state visual LAMP on-site detection of foot-and-mouth disease in cattle and sheep, characterized in that: Including FMDV-F3-N1 primer, FMDV-B3-N1 primer, FMDV-Bloop-N1 primer, FMDV-Floop-N1 primer, FMDV-FIP-N1 primer and FMDV-BIP-N1 primer; The nucleotide sequence of the FMDV-F3-N1 primer is shown in SEQ ID No. 1; The nucleotide sequence of the FMDV-B3-N1 primer is shown in SEQ ID No. 2; The nucleotide sequence of the FMDV-Bloop-N1 primer is shown in SEQ ID No. 3; The nucleotide sequence of the FMDV-Floop-N1 primer is shown in SEQ ID No. 4; The nucleotide sequence of the FMDV-FIP-N1 primer is shown in SEQ ID No. 5; The nucleotide sequence of the FMDV-BIP-N1 primer is shown in SEQ ID No.

6.

2. Use of the primer combination according to claim 1 in preparing a reagent for detecting foot-and-mouth disease in cattle and sheep.

3. A solid-state visual LAMP PCR reaction tube for on-site detection of foot-and-mouth disease in cattle and sheep, characterized in that: The PCR reaction tube contains the primer combination according to claim 1.

4. The PCR reaction tube according to claim 3, characterized in that: The PCR reaction tube contains 10 μL of RT-LAMP MIX, 0.04 μL of FMDV-F3-N1 primer at a concentration of 100 μM, 0.04 μL of FMDV-B3-N1 primer at a concentration of 100 μM, 0.11 μL of FMDV-Bloop-N1 primer at a concentration of 100 μM, 0.11 μL of FMDV-Floop-N1 primer at a concentration of 100 μM, 0.5 μL of FMDV-FIP-N1 primer at a concentration of 100 μM, 0.5 μL of FMDV-BIP-N1 primer at a concentration of 100 μM, 0.1 mg of agarose, 0.1 mg of β-cyclodextrin, and 1 μL of cresol red solution at a concentration of 500 μM.

5. The PCR reaction tube according to claim 3, characterized in that: The PCR reaction tubes are 8-row PCR reaction tubes with independent lids, and the specification of each PCR reaction tube is 200 μL.

6. Use of the PCR reaction tube according to any one of claims 3 to 5 in the preparation of equipment for foot-and-mouth disease in cattle and sheep.

7. The use according to claim 6, characterized in that When the PCR reaction tube is used for detecting foot-and-mouth disease in cattle and sheep: 1 μL of Bst-AMV enzyme mixture and 2 μL of the template to be detected are added to the PCR reaction tube.

8. The use according to claim 7, characterized in that The reaction conditions of the PCR reaction tube for detecting foot-and-mouth disease in cattle and sheep include: temperature of 65° C. and time of 60 min; After the reaction is completed, when the color inside the PCR reaction tube is yellow, the template to be detected is positive; when the color inside the PCR reaction tube is purple, the template to be detected is negative.

9. A solid-state visual LAMP rapid detection box for foot-and-mouth disease in cattle and sheep, characterized by: The items in the cattle and sheep foot-and-mouth disease rapid test box are placed in two layers, the upper layer contains a pipette, an EP tube rack, a ziplock bag, a disposable plastic tablecloth, a pack of 1.5 ml EP tubes, a pack of 2 ml EP tubes containing 0.5 ml of normal saline, a marker, a notepad, a pair of small scissors and an instruction manual; The lower layer contains 1 white thermos cup, 1 black thermos cup, a simple nucleic acid extraction kit, 1 mini metal bath, 1 mini centrifuge, 1 gun tip box, 20 10ml syringes, 2 packs of long cotton swabs, 1 bottle of pasteurized solution, 1 trash box, latex gloves and disposable masks.

10. The cattle and sheep foot-and-mouth disease rapid inspection box according to claim 9, characterized in that: The specifications of the pipette are 1000μL, 200μL and 10μL; the number of 1.5mL EP tubes per package is 100; the number of 2mL EP tubes containing 0.5mL normal saline per package is 100; the white thermos contains the PCR reaction tube described in any one of claims 3 to 5; the black thermos contains the Bst-AMV enzyme mixture and the positive and negative controls; the gun tip box contains 1mL, 200μL and 10μL gun tips; the capacity of the pasteurized solution is 500ml / bottle; the number of disposable masks is 10.

Images