RNA interference method for targeting MYC, nucleic acid and application thereof

Abstract

The present invention provides nucleic acid molecules for modulating the level or amount of mRNA of MYC. In particular, the present invention provides delivery of primary microRNAs to form precursors after in vivo processing, as well as microRNAs, for inhibiting expression of mRNA of MYC in vivo. The invention also provides a delivery system of the nucleic acid molecule, comprising a carrier, an exosome and a cell, and a pharmaceutical composition containing the same. The invention also provides the use of the nucleic acid molecule and delivery system in disease treatment and drug preparation, in particular methods and drugs for cancer.

Description

[0001] This application claims priority to Chinese patent application No. 202410774877.X, filed on June 14, 2024, entitled “RNA interference method, nucleic acid and its application targeting MYC”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the fields of molecular biology and medicine. Specifically, the present invention relates to a system for delivering precursor miRNA and its application in disease treatment. Background Art

[0003] In recent years, C-Myc has transformed from being considered refractory to becoming one of the most attractive therapeutic targets for cancer treatment. However, numerous obstacles remain. First, as a transcription factor, C-Myc lacks a small molecule-specific active site, making it difficult to functionally inhibit its activity using strategies similar to those used for kinases. Second, C-Myc is primarily located in the cell nucleus, making it technically difficult to target nuclear Myc with specific monoclonal antibodies.

[0004] RNA interference (RNAi) is a gene silencing phenomenon of specific target sequences at the mRNA level triggered by double-stranded RNA. It is widely present in animals, plants and viruses, and mainly includes two action pathways: small interfering RNA (siRNA) and microRNA (miRNA).

[0005] Endogenous miRNAs are hairpin-shaped secondary structures present in many primary RNA transcripts (pri-miRNAs). In the nucleus, the Drosha / DGCR8 complex binds and cleaves the base stem of the pri-miRNA to release the stem-loop precursor miRNA (pre-miRNA). Pre-miRNAs are then exported from the nucleus, and the loop is cleaved by Dicer / TRBP to form a mature RNA duplex. The guide strand, also known as the targeting strand, separates from the guest strand and is loaded onto the argonaute protein in the RNA-induced silencing complex (RISC), which then targets the complementary mRNA transcript for degradation or translational repression.

[0006] Artificial miRNA (amiRNA) technology replaces the mature sequence of a natural miRNA with an artificially designed antisense sequence targeting a gene of interest, achieving RNAi effects through the production and action pathways of natural miRNAs. This technology offers advantages such as significant interference, rapid action, and low toxicity, and holds broad application prospects. AmiRNAs are typically produced by intracellular transcription and processing from expression vectors, and their mechanisms of action are identical or similar to those of natural miRNAs. Because the precursor processing mechanisms and action processes of miRNAs in vivo are not fully understood, further research is needed to ensure the expected normal synthesis of amiRNAs and achieve optimal production levels. Furthermore, factors influencing the silencing effect of amiRNAs, in addition to sequence specificity, include uncertainties such as the amiRNA backbone sequence, cleavage sites, and synergistic interactions with other small molecules or proteins.

[0007] There remains a need in the art for better gene therapies targeting MYC, particularly improved methods and approaches for delivering artificial miRNAs with greater efficiency and fewer off-target effects. Summary of the Invention

[0008] The present invention provides nucleic acid molecules and methods for regulating the level or amount of MYC mRNA. Specifically, the present invention provides nucleic acid molecules for delivering primary microRNA (pri-miRNA or pri-miR) to form precursors and microRNAs (miRNA or miR) after in vivo processing.

[0009] Specifically, the present invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding an RNA that inhibits MYC gene expression, wherein the nucleic acid sequence comprises a miRNA sequence that inhibits MYC gene.

[0010] In one aspect, the nucleic acids provided by the present invention are used to deliver primary microRNAs or precursor microRNAs into the body, where they are processed within cells to produce highly specific artificial microRNAs or siRNAs that reduce MYC expression.

[0011] The term "microRNA (or miRNA or miR)" herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3'UTR of a nucleic acid molecule and downregulates gene expression (either by reducing nucleic acid molecule stability or by inhibiting translation). The regulatory polynucleotides of the present invention may comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, e.g., sequences that function as microRNAs.

[0012] The term "pre-miRNA" as used herein refers to precursor microRNA. Pre-miRNAs are approximately 70 bases long and are produced in the cell nucleus after pri-miRNA is cleaved by Drosha. Pre-miRNAs are exported to the cytoplasm by exportin 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0013] The term "siRNA" herein refers to small interfering RNA, which is sometimes also called short interfering RNA or silencing RNA. It is a type of double-stranded RNA, typically 17-24 base pairs in length. It interferes with the expression of a specific gene by degrading mRNA with a nucleotide sequence complementary to the siRNA antisense strand (also known as the guide strand) to prevent translation.

[0014] The polynucleotides provided by the present invention can efficiently deliver exogenous nucleotide sequences to exosomes, specifically inhibit target genes in target cells after the exosomes reach the target cells, and can minimize side effects caused by off-target effects.

[0015] In one aspect of the present invention, an isolated nucleic acid is provided, comprising a nucleic acid sequence encoding a pri-miRNA that inhibits MYC gene expression. The pri-miRNA comprises a miRNA sequence that inhibits MYC gene, and one or more of a flanking structure sequence, a stem-loop structure, and a compensatory sequence of the RNA sequence. In one embodiment of the present invention, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that inhibits MYC gene expression, a stem-loop sequence, a compensatory sequence, and a 3' flanking structure sequence.

[0016] As used herein, "isolated" means a substance that has been separated from its original environment. For example, nucleic acids and polypeptides in their natural state within living cells are not isolated and purified. However, the same nucleic acid or polypeptide is isolated if it is separated from other substances with which it is naturally present.

[0017] In one embodiment of the present invention, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the present invention, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it comprises 2, 3 or 4 copies.

[0018] In one embodiment of the present invention, there is a spacer sequence between the sequences encoding the multiple copies of pri-miRNA that inhibit gene expression in the aforementioned nucleic acid. In another embodiment of the present invention, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0019] Specifically, in one aspect of the present invention, the pri-miRNA has the structure of the following formula I:

[0020]

[0021] Among them, “|” represents base pairing, (A1A2…A a-1 A a ) is the first RNA sequence; (B b B b-1 ...B2B1) is the second RNA sequence, (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) fully complementary or substantially fully complementary, wherein a and b are each independently an integer from about 15 to 29, preferably an integer from about 18 to 22;

[0022] [M1M2…M m-1 M m ] is the 5' flanking structure sequence; [N n N n-1 ...N2N1] is a 3' end flanking structure sequence, wherein m and n are each independently an integer of about 25-50, preferably, m <n;

[0023] The separation sequence that forms the stem-loop structure is called the C stem-loop.

[0024] wherein c is an integer of about 10-30, preferably an integer of about 16-20.

[0025] The pri-miRNA provided by the present invention is biologically processed (in vivo, in tissues or cells, etc.) (hereinafter referred to as "processing") to produce pre-miRNA or miRNA, and finally produce RNA sequences targeting target mRNA. In the present invention, the 5' end flanking structure sequence (such as [M1M2...M in Formula I) m-1 M m ]) and the first RNA sequence (such as A1A2...A in Formula I a-1 A a ) is also called the 5' arm, wherein the first RNA sequence is called the 5' arm RNA sequence or the 5' arm miRNA. n N n-1 ...N2N1]) and a second RNA sequence (such as B in Formula I b B b-1...B2B1) is also called the 3' arm, and the second RNA sequence therein is called the 3' arm RNA sequence or the 3' arm miRNA. The pre-miRNA provided by the present invention comprises an RNA sequence targeting the target mRNA, which can be positioned or located on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, that is, the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by the present invention can produce one or two single-stranded mature miRNAs. According to the processing from the 5' end arm and the 3' end arm of the precursor, the first miRNA sequence (A1A2...A a- 1A a ) can be called miRNA-5p, corresponding to the second miRNA sequence (B b B b-1 ...B2B1) can be referred to as miRNA-3p.

[0026] miRNA can be substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming a secondary structure. Typically, two "substantially complementary" nucleotide sequences have at least 70% of their nucleotides complementary to each other; preferably, at least 80% of their nucleotides are complementary; more preferably, at least 90% of their nucleotides are complementary; further preferably, at least 95% of their nucleotides are complementary; such as 98%, 99% or 100%. Functionally, miRNA interferes with the post-transcriptional degradation of the mRNA of a specific gene expressing the complementary nucleotide sequence, thereby preventing translation.

[0027] In one aspect of the present invention, the length of miRNA is 15-29 nucleotide (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, 22nt. A large number of experiments have shown that the length of RNA sequence is less than 18nt, particularly less than 15nt, and this RNA sequence is mostly invalid, can not play a role, and the length of RNA sequence is greater than 22nt, particularly greater than 25nt, then not only the cost of circuit is greatly improved, and effect is also not better than the RNA sequence that length is 18-22nt, poor economic benefit. Therefore, the length of miRNA sequence is 15-25nt, particularly 18-22nt, best effect.

[0028] In one aspect of the present invention, the pri-miRNA provided herein, after biological processing, substantially only produces a miRNA having the sequence of the first miRNA, while the other RNA sequence does not form or barely forms a miRNA. In one embodiment of the present invention, the miRNA having the sequence of the first miRNA, obtained after in vivo processing of the pri-miRNA provided herein, is active, i.e., the 5' arm miRNA is active, while the miRNA having the sequence of the second miRNA is barely produced, i.e., the 3' arm miRNA is inactive or barely active.

[0029] In one aspect of the present invention, the amount of the almost unformed miRNA obtained after biological processing of the pri-miRNA provided by the present invention accounts for less than 40% of the total miRNA obtained after processing of the pri-miRNA, preferably less than 10%, more preferably less than 5%, for example less than or equal to 2%.

[0030] In one aspect of the invention, the pri-miRNA of the nucleic acid provided by the invention is processed in vivo to obtain a target knockdown (KD) of the target mRNA that inhibits the miRNA sequence of the gene that is at least greater than about 30%, about 40%, 50%, 90%, 95%, or up to 99%.

[0031] In one aspect of the present invention, the pri-miRNA of the nucleic acid provided by the present invention is processed in vivo, and the miRNA sequence that inhibits the expression of the gene obtains a target knockdown of the protein of the gene that is at least greater than about 40%, 50%, 90%, 95%, or reaches 99%.

[0032] In one aspect of the present invention, the pri-miRNA provided by the present invention is biologically processed to form almost no miRNA, and the target knockdown achieved is less than about 40%, 10%, 5%, or close to 0.

[0033] In one aspect of the present invention, the pri-miRNA provided by the present invention is biologically processed to obtain substantially only miRNA without producing off-target effects.

[0034] In one embodiment of the present invention, the miRNA sequence that inhibits MYC gene expression has the following nucleotide sequence:

[0035] TTAAGGATAACTACCTTGGGG(SEQ ID NO.32)

[0036] CATTAGACCCAGATGAACCAA(SEQ ID NO.33)

[0037] TATCATAGTCTCCAGGAAGCA(SEQ ID NO.34)

[0038] TGTTATCATAGTCTCCAGGAA(SEQ ID NO.35)

[0039] AATAGTAGCATTCCTCCCAGA(SEQ ID NO.36)

[0040] CATTAGACCCAGATGAACCAA(SEQ ID NO.37)

[0041] TATCATAGTCTCCAGGAAGCA(SEQ ID NO.38)

[0042] AATAGTAGCATTCCTCCCAGA(SEQ ID NO.39)

[0043] TTAAGGATAACTACCTTGGGG(SEQ ID NO.40)

[0044] TAGTTGTGCTGATGTGTGGAG(SEQ ID NO.41)

[0045] ACTCTGACACTGTCCAACTTG(SEQ ID NO.42)

[0046] TAGTCCTTCCGAGTGGAGGGA(SEQ ID NO.43)

[0047] TAGCTCGTTCCTCCTCTGGCG(SEQ ID NO.44)

[0048] TGTGTGTTCGCCTCTTGACAT(SEQ ID NO.45)

[0049] TTGCTGATCTGTCTCAGGACT(SEQ ID NO.46)

[0050] TCCGCAACAAGTCCTCTTCAG(SEQ ID NO.47)

[0051] CAGAAGGTGATCCAGACTCTG(SEQ ID NO.48)

[0052] TTGCTCCTCTGCTTGGACGGA(SEQ ID NO.49)

[0053] AAGAGTTCCGTAGCTGTTCAA(SEQ ID NO.50)

[0054] AGAGTCGCGTCCTTGCTCGGG(SEQ ID NO.51)

[0055] AGATCCTGCAGGTACAAGCTG(SEQ ID NO.52)

[0056] TTGCGAGGCGCAGGACTTGGG(SEQ ID NO.53)

[0057] TGGGCGGTGTCTCCTCATGGA(SEQ ID NO.54)

[0058] TCCTCTGGCGCTCCAAGACGT(SEQ ID NO.55)

[0059] AAGACGTTGTGTGTTCGCCTC(SEQ ID NO.56)

[0060] TGTTCGCCTCTTGACATTCTC(SEQ ID NO.57)

[0061] AGACGTGGCACCTCTTGAGGA(SEQ ID NO.58)

[0062] AGGCGCTGCGTAGTTGTGCTG(SEQ ID NO.59)

[0063] TCTGAGACGAGCTTGGCGGCG(SEQ ID NO.60)

[0064] TAGCTCGTTCCTCCTCTGGCG (SEQ ID NO. 61) or

[0065] TCCGCAACAAGTCCTCTTCAG (SEQ ID NO. 62).

[0066] In one embodiment of the present invention, the combination of the RNA sequence that inhibits MYC gene expression and its complementary sequence is a sequence group having the following nucleotide sequence:

[0067]

[0068]

[0069]

[0070] In one embodiment of the present invention, the RNA that inhibits MYC gene expression is a pri-miRNA having a stem-loop structure. In one embodiment of the present invention, the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO. 97).

[0071] In one embodiment of the present invention, the RNA that inhibits MYC gene expression is pri-miRNA, which has a 5' end flanking structure sequence (such as [M1M2...M m-1 M m ]) and 3' end flanking structure sequence (such as [N n N n-1 ...N2N1]). In one embodiment of the present invention, the 5' flanking sequence and the 3' flanking sequence are each independently or simultaneously greater than 80%, preferably greater than 90%, preferably greater than 95%, and preferably 100% identical to a mammalian (particularly human) pri-miR sequence. In one embodiment of the present invention, the pri-miR is pri-miR155.

[0072] In one embodiment of the present invention, the 5'-end flanking structure sequence of the pri-miRNA has the following nucleotide sequence: TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO. 99) or TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO. 101).

[0073] In one embodiment of the present invention, the 3' flanking sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO. 100) or the 3' flanking sequence is CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO. 102).

[0074] In one aspect of the present invention, the present invention further provides a pre-miRNA, which is processed from the pri-miRNA of the present invention described above.

[0075] The present invention also provides an isolated nucleic acid encoding a combination of RNAs that inhibit the expression of one or more target genes. The nucleic acid comprises (1) a nucleic acid sequence encoding an RNA that inhibits the expression of the MYC gene, and (2) a nucleic acid sequence encoding an RNA that inhibits the expression of a second gene.

[0076] In one aspect of the present invention, the second gene includes LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, APP gene, TAU gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene and α-synuclein gene, etc.

[0077] In another aspect of the present invention, a vector is provided, which comprises the aforementioned nucleic acid of the present invention comprising an isolated nucleic acid sequence encoding an RNA that inhibits MYC gene expression and inhibits MYC and a second gene expression. In another aspect of the present invention, the vector is an expression vector. The nucleic acid of the present invention can be located downstream of a promoter (for example, but not limited to, CMV, U6, CBA or a CBA promoter with an SV40 intron) of the vector.

[0078] In one embodiment of the present invention, the vector is a plasmid. In one embodiment of the present invention, after administration to a mammal, the plasmid can be enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly liver), transcribe and / or express the RNA fragment of the present invention, and the RNA fragment is encapsulated in exosomes in the cells of the tissue.

[0079] In one embodiment of the present invention, the vector is a viral vector. For example, it can be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpes virus vector, or a lentivirus vector. In one embodiment of the present invention, the vector is an adenovirus vector, for example, adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9.

[0080] In one embodiment of the present invention, after being administered to a mammal, the plasmid or viral vector is enriched and expressed in the liver, and its product is largely encapsulated in exosomes.

[0081] In one aspect of the present invention, a cell comprising an isolated nucleic acid of the present invention as described above is provided. Cells comprising a nucleic acid of the present invention as described above can be obtained by transfecting cells with a plasmid or viral vector. Transfection of cells with a nucleic acid construct can be performed using a variety of methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.

[0082] In one aspect of the present invention, exosomes containing RNA that inhibits MYC gene expression are provided, comprising the pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above. In one embodiment of the present invention, the exosomes are derived from human tissues or cells. The tissues include the liver, lungs, gastrointestinal tract, breast, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the present invention, the exosomes are derived from the liver or liver cells.

[0083] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example, at 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, for example, immunoprecipitation using specific antibodies, magnetic bead purification, resin-based purification. The exosomes can then be quantified and characterized.

[0084] The RNA provided by this invention can be delivered to different tissues to inhibit specific target genes and treat related diseases. For example, siRNA targeting the MYC gene can treat related cancers in the liver.

[0085] In one aspect of the present invention, a pharmaceutical composition is provided, comprising the nucleic acid, vector, or cell as described above, and further comprising a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector, or cell to a subject.

[0086] The administration of the drug includes oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. That is, the drug can be administered orally, inhaled, subcutaneously, intramuscularly, or intravenously. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to mammals, the plasmid or viral vector in the drug is enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, especially liver), and its expressed products are encapsulated in large quantities in exosomes in the cells of the tissue and delivered to the target tissue, exerting a therapeutic effect.

[0087] The pharmaceutical composition can be used to treat various diseases, including cancer, acute and chronic infectious diseases or other acute and chronic diseases. The cancer may be any cancer, including leukemia, lymphoma, multiple myeloma or solid tumors. In one aspect of the present invention, the cancer is MYC-related cancer. In one aspect of the present invention, the cancer is leukemia, lymphoma, multiple myeloma or solid tumors. For example, the disease is liver cancer. The acute and chronic infectious diseases include: viral influenza, viral hepatitis, AIDS, SARS viral diseases, bacterial diseases (such as tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include: respiratory system diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases and locomotor system diseases. For example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease or graft-versus-host disease.

[0088] In one aspect of the present invention, a method for treating a disease is provided, comprising administering the aforementioned nucleic acid, vector, or exosome to a subject. The disease includes cancer, acute or chronic infectious diseases, or other acute or chronic diseases.

[0089] It is understood by those skilled in the art that the actual dosage to be administered will vary depending on a variety of factors, such as the vector, the target cell or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, etc. DETAILED DESCRIPTION

[0090] The essential content and beneficial effects of the present invention will be further illustrated below with reference to examples, which are only used to illustrate the present invention rather than to limit the present invention.

[0091] Example 1 Materials and Methods

[0092] Table 1 Cells, materials and kits:

[0093]

[0094] Example 2 Nucleic acid synthesis and plasmid preparation

[0095] 1. Entrust Jiangsu Jinweizhi Biotechnology Co., Ltd. to synthesize or prepare the nucleic acid fragments in Table 2 below. The sequences of the pri-miRNA are as shown in the following table.

[0096] Table 2 pri-miRNA sequences and structures

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] The pri-miRNA sequence is shown in SEQ ID NO.1-31, and its structure from 5' to 3' includes: 5' flanking sequence; first miRNA sequence; stem-loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO.97); complementary sequence, or second miRNA sequence; and 3' flanking sequence.

[0104] The 5' flanking sequence of MYC-1 to MYC-19 is TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO. 99); and the 3' flanking sequence is CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO. 100).

[0105] The 5' flanking sequence of MYC-20 to MYC-31 is TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO. 101); the 3' flanking sequence is

[0106] CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO. 102).

[0107] The combinations of the first miRNA sequence and the second miRNA sequence of MYC-1 to MYC-31 are shown in the following table:

[0108] Table 3 miRNA sequences of pri-miRNA

[0109]

[0110]

[0111]

[0112] In addition, Scramble miRNA was provided as a negative control for the experiment. Scramble miRNA had the same 5' flanking sequence, 3' flanking sequence and stem-loop structure sequence as the aforementioned pri-miRNA, but did not have a sequence encoding a complementary sequence to MYC mRNA.

[0113] 2. Construction of a plasmid containing the above-mentioned pri-miRNA nucleic acid fragment that inhibits MYC and expressing the contained miRNA

[0114] Jiangsu Jinweizhi Biotechnology Co., Ltd. was commissioned to insert the above-mentioned nucleic acid fragments encoding the pri-miRNA targeting MYC into the pcDNA6.2-EmGFP-mir9 vector to prepare plasmids carrying the sequence of the pri-miRNA targeting MYC. The obtained plasmids were named MYC-1 to MYC-31, respectively.

[0115] Example 3 Cell and exosome preparation and analysis

[0116] The plasmid prepared in Example 2 was transfected into HEK293T cells using Lipofectamin 3000 according to the instructions, and the exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number of exosomes secreted by each group was similar, with a similar size distribution, and a peak value between 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited a typical round vesicle morphology and were of the correct size. In addition, the enrichment of specific exon markers (CD63, TSG101, and CD9) was only detected in the purified exosomes, but not in the cell culture medium. Exosomal RNA was extracted for miRNAseq to analyze the miRNA composition.

[0117] The results are shown in Table 4 below.

[0118] Table 4. miRNA composition detection.

[0119]

[0120] Example 4 miRNA plasmid activity verification

[0121] 1. Changes in intracellular MYC gene mRNA levels after transfection of miRNA plasmids into 293T cells. Trypsin-digested 293T cells were collected, counted, and adjusted to a cell density of 0.6E6 / mL with complete culture medium. 1.2M cells (2mL) were added to each well of a six-well plate, allowing the cell suspension to cover the entire bottom of the dish. Label the wells and incubate in a 37°C, 5% CO2 incubator for 18-24 hours. Lipofectamin 3000 was used according to the manufacturer's instructions to transfect 3ug of miRNA plasmid into 293T cells. An empty vector carrying scrambled miRNA was also transfected as a negative control. After 48 hours of incubation at 37°C, 5% CO2, the culture medium was removed and the cells were harvested.

[0122] Total RNA was extracted from cells using RNeasy Plus Mini Kit and reverse transcribed using HiScript IIQ RT SuperMix. The changes in MYC gene mRNA in 293T cells were detected using QPCR. The mRNA target knockdown (KD) was based on 2 –ΔΔCt Calculated using the qPCR method, where the Ct value represents the threshold cycle of the sample during the QPCR reaction. ΔCt = Ct value of the target gene MYC minus the Ct value of the reference gene GAPDH / β-actin. ΔΔCt = ΔCt value of the experimental group minus ΔCt value of the control group. The experimental group refers to 293T cells transfected with the MYC miRNA plasmid; the control group refers to 293T cells transfected with the scramble miRNA plasmid.

[0123] The QPCR primers used for the MYC target gene and GAPDH / β-actin reference gene are as follows:

[0124] Table 5 QPCR primers

[0125] Forward primer sequence (5' to 3') Reverse primer sequence (5' to 3') MYC CGTCCTCGGATTCTCTGCTC GTTCCTCCTCAGAGTCGCTG GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

[0126] The results are shown in Table 6 below.

[0127] Table 6 miRNA activity detection-mRNA target knockdown (KD)

[0128] pri-miRNA mRNA KD by miRNA Scramble miRNA 100％ miMYC-7 83.6％ miMYC-16 76.1％ miMYC-19 64％ miMYC-20 81.5％ miMYC-24 65％ miMYC-25 64.6％ miMYC-26 83.7％ miMYC-27 83.6％ miMYC-30 70.4％ miMYC-31 52.7％

[0129] 2. Changes in intracellular MYC protein levels after miRNA plasmid transfection into 293T cells

[0130] Western blotting was used to detect changes in MYC protein in 293T cells. Cells transfected with the miRNA plasmid were harvested and lysed using RIPA (Biyuntian). The supernatant was then assayed for total protein concentration using a BCA protein quantification kit. 25 μg of total protein in the cell lysate was added to 4X LDS (Thermo Fisher) and incubated at 70°C for 10 minutes for protein denaturation. Polymerase chain reaction (PAGE) was then performed at 135V for 70 minutes. After electrophoresis, the membrane was transferred using a transfer membrane, blocked with 5% skim milk, and incubated with antibodies against the target gene MYC and an internal reference gene, tubulin, at 4°C overnight. The membrane was then incubated with Goat Anti-Rabbit IgG (H+L), Secondary Antibody / Goat Anti-Mouse IgG (H+L), and Secondary Antibody, respectively, at room temperature for 1 hour. After washing with PBST solution, take the reagent in TanonTM Femto-sig ECL Western Blotting Substrate, mix it in a 1:1 ratio (1 mL), and evenly add it dropwise to the PVDF membrane. Image it on a TANON 5200multi imager, and finally use imageJ software to perform grayscale analysis of the protein bands.

[0131] The results are shown in Table 7. Protein target knockdown (KD) was calculated according to the following method.

[0132] ImageJ software was used to analyze the grayscale values ​​of the target protein MYC band and the internal reference protein Tubulin band. The grayscale value of the experimental group = grayscale value of the target protein MYC band in the experimental group / grayscale value of the corresponding internal reference protein Tubulin band in the experimental group; the grayscale value of the control group = grayscale value of the target protein MYC band in the control group / grayscale value of the corresponding internal reference protein Tubulin band in the control group. Protein target knockdown (KD) = (1 - (grayscale value of the control group - grayscale value of the experimental group) / grayscale value of the control group) × 100. The experimental group refers to the 293T cell group transfected with the MYC miRNA plasmid; the control group refers to the 293T cell group transfected with the scramble miRNA plasmid.

[0133] Table 7 miRNA activity detection-protein target knockdown (KD)

[0134]

[0135] Example 5 Design of dual copies of pri-miRNA to inhibit MYC

[0136] 1. Synthesis of Double-Copy pri-miRNA Designed Gene Fragments and Plasmid Construction

[0137] Jiangsu Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid fragments listed in Table 8 below.

[0138] Table 8 Double copy pri-miRNA gene fragment sequences

[0139]

[0140] Among them, 2X-miMYC is a nucleic acid fragment of the corresponding aforementioned MYC pri-miRNA having two copies: the sequence fragment of 2×miMYC-16 (SEQ ID NO.94) includes two sequence fragments of miMYC-16 (SEQ ID NO.16), and the spacer sequence between the two sequence fragments: CTCGAGATATC (SEQ ID NO.98); the sequence fragment of 2×miMYC-25 (SEQ ID NO.95) includes two sequence fragments of miMYC-25 (SEQ ID NO.25), and the spacer sequence between the two sequence fragments: CTCGAGATATC (SEQ ID NO.98).

[0141] According to the method disclosed in Example 2, a plasmid containing multiple copies of the above-mentioned MYC-inhibiting pri-miRNA nucleic acid fragment and expressing the contained miRNA was constructed.

[0142] 2. Comparison of activity of two-copy pri-miRNA and single-copy pri-miRNA plasmids

[0143] 2.1 According to the method disclosed in Example 4, a plasmid carrying two copies of the pri-miRNA sequence targeting MYC was transfected into 293T cells, and the changes in the MYC gene mRNA level in the cells were detected.

[0144] The results are shown in Table 9 below.

[0145] Table 9 Gene target knockdown activity of two-copy pri-miRNA design and single-copy pri-miRNA design

[0146] pri-miRNA mRNA KD by miRNA Scramble miRNA 100％ miMYC-16 76％ miMYC-25 57.5％ 2×miMYC-16 13％ 2×miMYC-25 41.6％

[0147] 2.2 According to the method disclosed in Example 4, a plasmid carrying two copies of the pri-miRNA sequence targeting MYC was transfected into 293T cells, and the changes in the MYC gene protein level in the cells were detected.

[0148] Table 10 Protein target knockdown activity of two-copy pri-miRNA design and single-copy pri-miRNA design

[0149]

[0150] 2.3Daudi cell proliferation assay

[0151] Trypsinized Daudi cells were counted and adjusted to a cell density of 5E6 / mL with complete medium. 1E5 cells (100 μL) were added to each well of a 96-well plate, allowing the cell suspension to cover the entire bottom of the dish. The wells were labeled and incubated in a 37°C, 5% CO2 incubator for 18-24 hours. JetPRIME was used according to the manufacturer's instructions to transfect Daudi cells with 0.2 μg of a single miRNA plasmid and 0.1 μg of a 2× miRNA plasmid. An empty vector carrying a scrambled miRNA was also transfected as a negative control. After incubation at 37°C, 5% CO2 for 24, 48, and 72 hours, 10 μL of CCK-8 solution was added to each well and incubated at 37°C, 5% CO2 for 4 hours. The absorbance at 450 nm was measured using a microplate reader.

[0152] Calculate cell survival rate: Cell survival percentage = [(AC) / (BC)] × 100%

[0153] A: Absorbance value of the experimental group (absorbance value containing culture medium, cells, test drug and CCK-8 solution); B: Absorbance value of the control group (absorbance value containing culture medium, cells and CCK-8 solution); C: Absorbance value of the blank group (absorbance value containing culture medium and CCK-8 solution).

[0154] The above is an explanation of the present invention and should not be regarded as limiting the present invention. Unless otherwise noted, the practice of the present invention will use the conventional techniques of organic chemistry, polymer chemistry, biotechnology, etc., and it is obvious that in addition to being particularly described in the above description and embodiments, the present invention can also be realized in other ways. Other aspects and improvements within the scope of the present invention will be apparent to those skilled in the art. According to the teachings of the present invention, many changes and variations are feasible, and therefore they are within the scope of the present invention.

Claims

1. An isolated nucleic acid comprising a nucleic acid sequence encoding a pri-miRNA that inhibits MYC gene expression, wherein the pri-miRNA comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that inhibits MYC gene expression, a stem-loop sequence, a compensatory sequence, and a 3' flanking structure sequence, wherein the miRNA sequence that inhibits MYC gene expression is an RNA sequence that is complementary or substantially complementary to an mRNA sequence expressed by the MYC gene.

2. The nucleic acid according to claim 1, comprising multiple copies of the nucleic acid sequence of the pri-miRNA, preferably, the multiple copies are 2-10 copies, for example, 2, 3 or 4 copies.

3. The nucleic acid according to claim 1 or 2, wherein the miRNA sequence that inhibits MYC gene expression has the following nucleotide sequence: TTAAGGATAACTACCTTGGGG(SEQ ID NO.32) CATTAGACCCAGATGAACCAA(SEQ ID NO.33) TATCATAGTCTCCAGGAAGCA(SEQ ID NO.34) TGTTATCATAGTCTCCAGGAA(SEQ ID NO.35) AATAGTAGCATTCCTCCCAGA(SEQ ID NO.36) CATTAGACCCAGATGAACCAA(SEQ ID NO.37) TATCATAGTCTCCAGGAAGCA(SEQ ID NO.38) AATAGTAGCATTCCTCCCAGA(SEQ ID NO.39) TTAAGGATAACTACCTTGGGG(SEQ ID NO.40) TAGTTGTGCTGATGTGTGGAG(SEQ ID NO.41) ACTCTGACACTGTCCAACTTG(SEQ ID NO.42) TAGTCCTTCCGAGTGGAGGGA(SEQ ID NO.43) TAGCCTCGTTCCTCCTCTGGCG(SEQ ID NO.44) TGTGTGTTCGCCTCTTGACAT(SEQ ID NO.45) TTGCTGATCTGTCTCAGGACT(SEQ ID NO.46) TCCGCAACAAGTCCTCTTCAG(SEQ ID NO.47) CAGAAGGTGATCCAGACTCTG(SEQ ID NO.48) TTGCTCCTCTGCTTGGACGGA(SEQ ID NO.49) AAGAGTTCCGTAGCTGTTCAA(SEQ ID NO.50) AGAGTCGCGTCCTTGCTCGGG(SEQ ID NO.51) AGATCCTGCAGGTACAAGCTG(SEQ ID NO.52) TTGCGAGGCGCAGGACTTGGG(SEQ ID NO.53) TGGGCGGTGTCTCCTCATGGA(SEQ ID NO.54) TCCTCTGGCGCTCCAAGACGT(SEQ ID NO.55) AAGACGTTGTGTGTTCGCCTC(SEQ ID NO.56) TGTTCGCCTCTTGACATTCTC(SEQ ID NO.57) AGACGTGGCACCTCTTGAGGA(SEQ ID NO.58) AGGCGCTGCGTAGTTGTGCTG(SEQ ID NO.59) TCTGAGACGAGCTTGGCGGCG(SEQ ID NO.60) TAGCTCGTTCCTCCTCTGGCG (SEQ ID NO. 61) or TCCGCAACAAGTCCTCTTCAG (SEQ ID NO. 62).

4. The nucleic acid according to claim 3, wherein the combination of the miRNA sequence that inhibits MYC gene expression and its complementary sequence is a sequence group having the following nucleotide sequence: 5 . The nucleic acid according to claim 1 , wherein the miRNA that inhibits MYC gene expression has a stem-loop structure, and its sequence has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO. 97).

6. The nucleic acid according to claim 1, wherein the miRNA that inhibits MYC gene expression has a 5' flanking structure sequence and a 3' flanking structure sequence, each of which independently or simultaneously has an identity with a mammalian or human (preferably human) pri-miR (e.g., pri-miR155) sequence greater than 80%, preferably greater than 95%, and more preferably 100%.

7. The nucleic acid according to claim 6, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.99) or TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO.101); And / or wherein the 3' flanking structure sequence has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCAC (SEQ ID NO. 100) or the 3' flanking sequence is CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO. 102).

8. A vector comprising the isolated nucleic acid encoding any one of claims 1-7.

9. A cell comprising the nucleic acid according to any one of claims 1 to 7 or the vector according to claim 8, optionally wherein the exosomes in the cell comprise RNA obtained after the pri-miRNA is processed in vivo. 10 . A pharmaceutical composition comprising the nucleic acid according to claim 1 , the vector according to claim 8 , the cell according to claim 9 , or the exosomes secreted by the cell.

11. Use of the nucleic acid according to any one of claims 1 to 7, the vector according to claim 8, the cell according to claim 9, or the exosomes secreted by the cell in preparing a drug for treating a disease, Preferably, the disease is cancer, acute or chronic infectious disease or other acute or chronic disease, More preferably, the cancer is leukemia, lymphoma, multiple myeloma or solid tumor, for example, the disease is liver cancer.

Images