Plant genome directed editing tool based on transposon-encoded nuclease

Abstract

The invention belongs to the field of gene engineering, and relates to a plant genome directional editing tool based on transposon-coded nuclease. The invention aims to solve the technical problem that the application range of a plant genome editing tool based on CRISPR-Cas9 and Cas12a is limited to a great extent due to the fact that CRISPR-Cas9 and Cas12a are large in protein size and difficult to deliver. The invention provides transposon nuclease suitable for plant genome editing. The transposon nuclease is IsDge10, IsAam1 or enIscB subjected to codon preference optimization; and a gene editing system containing the three transposon nuclease is constructed. The gene editing system can be suitable for editing a coding region, a non-coding region and the like; the method can be widely applied to monocotyledonous plants, dicotyledonous plants, gymnosperm and the like.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to a plant genome-directed editing tool based on a transposon-encoded nuclease. Background Art

[0002] Targeted genome editing technology is a cutting-edge and hot area in biological research. It achieves precise, targeted genome editing by deletion, replacement, knock-in, or nucleotide correction of specific genomic regions. The CRISPR-Cas9 (Clustered regularly interspaced short palindromic repeats CRISPR-associated 9) system, reported in 2012, has been widely used in gene function analysis, germplasm creation, and genetic improvement in animals, plants, and microorganisms due to its ease of design and manipulation, efficient editing, and wide versatility. Following the CRISPR-Cas9 system, researchers have developed a new VA-type CRISPR-Cas system, CRISPR-Cas12a. However, the large size of existing CRISPR-Cas9 and Cas12a nucleases (>1000 Å) makes their delivery difficult. Therefore, further development of smaller, compact nuclease-based genome editing systems could effectively improve the delivery efficiency of editing tools and expand the application of plant genome editing tools.

[0003] Recently, researchers reported a compact TnpB nuclease system encoded by a transposon (IS200 / IS605) (Xiang et al., 2023). The TnpB system contains a nuclease protein encoded by approximately 391 amino acids and a reRNA (i.e., right element RNA, long non-coding RNA, derived from the RE element in the ISDra2 transposon) expression unit, which can achieve single reRNA-guided DNA cutting. The molecular weight of TnpB is only about one-third of that of the Cas9 and Cas12a genome editing enzymes, which provides an advantage for the delivery of genome editing tools. However, TnpB has only shown editing activity in mammalian cells, and genome editing tools have not yet been developed in plants. Therefore, the application prospects of the TnpB system in plant genome editing remain unclear. Summary of the Invention

[0004] The technical problem to be solved by the present invention is that the application scope of plant genome editing tools based on CRISPR-Cas9 and Cas12a is greatly limited due to the large protein size and difficulty in delivery.

[0005] The technical solution of the present invention is a coding sequence of a transposon nuclease suitable for plant genome editing, which is the coding sequence of IsDge10, IsAam1 or enIscB; the coding sequence of IsDge10 is shown in Seq ID No.13; the coding sequence of IsAam1 is shown in Seq ID No.14; and the coding sequence of enIscB is shown in Seq ID No.15.

[0006] The present invention also provides the use of the coding sequence of the above-mentioned transposon nuclease in constructing a plant genome editing system.

[0007] The present invention also provides a plant genome editing system based on transposon nuclease, which includes a transposon nuclease protein expression unit with a structure of promoter-transposon nuclease-terminator.

[0008] Wherein, the transposon nuclease is a TnpB-type transposon nuclease or an IscB-type transposon nuclease.

[0009] Furthermore, the TnpB-type transposon nuclease is IsDge10 or IsAam1.

[0010] Furthermore, the IscB transposon nuclease is enIscB.

[0011] Specifically, the coding sequence of IsDge10 is shown in Seq ID No.13.

[0012] Specifically, the coding sequence of IsAam1 is shown in Seq ID No.14.

[0013] Specifically, the coding sequence of enIscB is shown in Seq ID No.15.

[0014] Furthermore, in the transposon nuclease protein expression unit, the 5' and / or 3' ends of the transposon nuclease are further fused with an NLS.

[0015] Preferably, the above-mentioned plant genome editing system further comprises a reRNA transcription expression cloning unit, the structure of which is promoter-reRNA scaffold-terminator.

[0016] Furthermore, in the above-mentioned plant genome editing system, the reRNA scaffolds of the same type of transposon nuclease can be used interchangeably. Furthermore, the reRNA scaffold can be the one shown at bp 12754-12936 of Seq ID No. 1, Seq ID No. 12, or Seq ID No. 2.

[0017] Preferably, when TnpB-type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is as shown in 12754-12936 bp of Seq ID No. 1 or Seq ID No. 12; when IscB-type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No. 2.

[0018] More preferably, when the transposon nuclease used is IsDge10, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No. 1, 12754-12936 bp or Seq ID No. 12; when the transposon nuclease used is IsAam1, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No. 1, 12754-12936 bp or Seq ID No. 12; when the transposon nuclease used is enIscB, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No. 2.

[0019] Specifically, in the reRNA transcription expression cloning unit, the 5' or 3' end of the reRNA scaffold is further fused with lacZα.

[0020] Furthermore, there are enzyme cleavage sites at both ends of lacZα.

[0021] Preferably, the restriction enzyme cleavage site is BsaI.

[0022] Wherein, in the above-mentioned plant genome editing system, the promoter is a constitutive promoter, an inducible promoter or a tissue-specific promoter.

[0023] Wherein, the promoter is rice OsU6 promoter, maize ZmUbi1 promoter, larch LarPE004 promoter, Arabidopsis AtU6 promoter or P35S.

[0024] Furthermore, the nucleotide sequence of the larch LarPE004 promoter is shown in Seq ID No.4.

[0025] Furthermore, in the above-mentioned plant genome editing system, the terminator is pinII, AtHSP, NOS or T35S.

[0026] In particular, in the above-mentioned plant genome editing system, the plant is a monocotyledon or gymnosperm.

[0027] Specifically, the monocotyledonous plant is a grass plant.

[0028] Preferably, the grass plant is rice, corn, sorghum, sugarcane, wheat or barley.

[0029] Specifically, the gymnosperm is larch, masson pine, Chinese pine or elliott pine.

[0030] The present invention also provides a vector, a cell or a host expressing the coding sequence of the aforementioned transposon nuclease.

[0031] The present invention further provides a vector, cell or host containing the above-mentioned plant genome editing system.

[0032] The present invention also provides the use of the above-mentioned vector, cell or host in plant genome editing.

[0033] Particularly, in the above application, the plant is a monocotyledonous plant or a gymnosperm.

[0034] Specifically, the monocotyledonous plant is a grass plant.

[0035] Preferably, the grass plant is rice, corn, sorghum, sugarcane, wheat or barley.

[0036] Specifically, the gymnosperm is larch, masson pine, Chinese pine or elliott pine.

[0037] Beneficial effects of the present invention:

[0038] The transposon nuclease IsDge10, IsAam1 and enIscB encoding genes provided by the present invention are expressed in plants and can recognize TAM (TAM, i.e., Transposon associated motif, TTGAT transposition-related module, identifying 5'-TTAT-3'), and further perform gene editing. The fragment deletion size is mostly larger fragments, which can be used to construct editing systems for editing coding regions, non-coding regions, etc. The transposon nuclease editing system further developed by the present invention using the above-mentioned transposon nuclease encoding gene can be effectively used for plant genome directional editing. The editing system is a compact nuclease system, which is different from the currently commonly used Cas12a and Cas9 CRISPR tools, and its protein is smaller (only 1 / 3 of the former), which is conducive to effective delivery. The results of testing the efficiency of the transposon nuclease editing system of the present invention in plant cells show that the transposon nuclease expressed by the transposon nuclease encoding gene of the present invention can recognize TAM (5'-TTAT-3'); the fragment deletion caused by the transposon nuclease editing system of the present invention is mostly 7 to 12 bp (larger fragments), especially 6 to 10 bp deletions, which can be applied to the editing of coding regions, non-coding regions, etc.; it can be widely used in monocotyledons (rice, corn, sorghum, sugarcane, wheat, barley, etc.), gymnosperms (larch, masson pine, Chinese pine, elliottii pine, etc.), etc. In summary, the present invention provides a new gene-directed modification tool based on transposon-encoded nucleases, which can perform simple, fast and efficient genome-directed knockout editing on plants, and has good application prospects in the field of plant genome editing technology (especially non-coding region editing). BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the vector construction of the transposon nuclease plant genome targeted editing system. A: Transposon nuclease protein expression unit, where the transposon nuclease can be IsDge10, IsAam1, enIscB, or Fanzor. B: reRNA transcription expression cloning unit, where the reRNA scaffold can be IsDge10 scaffold, IsAam1 scaffold, or Fanzor scaffold. C: enIscB reRNA transcription expression unit; D: Transposon nuclease plant genome targeted editing system, where the transposon nuclease can be IsDge10, IsAam1, or Fanzor. The reRNA scaffold can be the scaffold corresponding to the selected nuclease. E: enIscB plant genome targeted editing system. pZmUbi: Maize Ubiquitin promoter; TnpB: TnpB protein gene; NLS: Nuclear localization signal; lacZα: lacZα gene.

[0040] Figure 2 A. Analysis of the editing efficiency of IsDge10 in rice protoplasts. B. Analysis of the editing efficiency of IsAam1 in rice protoplasts. C. Analysis of the editing efficiency of SpuFz in rice protoplasts. D. Analysis of the editing efficiency of enIscB in rice protoplasts.

[0041] Figure 3 , Analysis of the fragment deletion size caused by the IsDge10 plant genome targeted editing system at the TTAT TAM recognition site.

[0042] Figure 4 , larch IsDge10 gene editing backbone vector.

[0043] Figure 5 , editing efficiency and editing feature detection based on the IsDge10 larch genome editing system.

[0044] Figure 6 , Detection of endogenous gene editing efficiency of larch based on the IsDge10 genome editing system. DETAILED DESCRIPTION

[0045] Transposon nucleases have the advantage of small protein size, which provides an advantage for the delivery of genome editing tools. Transposon-encoded nucleases are divided into three categories: TnpB, IscB, and Fanzor. Among them, the TnpB and IscB proteins encoded by prokaryotic transposons are the ancestors of Cas12 and Cas9 nucleases, respectively; Fanzor is a nuclease encoded by eukaryotic transposons. However, currently only TnpB has shown editing efficiency in mammalian cells, and it has not yet been applied in plant genome editing. Therefore, the applicant hopes to obtain a transposon nuclease editing tool that can be widely used in plants.

[0046] To address the aforementioned issues, the applicants, through preliminary work, selected IsDge10 and IsAam1 from the TnpB class, enIscB from the IscB class, and SpuFz from the Fanzor class as targets for research and modification. The inventors first optimized the coding sequences of IsDge10, IsAam1, enIscB, and SpuFz to make them more suitable for expression in plant genomes. They then constructed a plant genome-directed editing system, comprising two core regions: a nuclear transposon nuclease protein expression unit and a reRNA transcription expression cloning unit. The transposon nuclease protein expression unit has a promoter-transposon nuclease-terminator structure, while the reRNA transcription expression cloning unit has a promoter-reRNA scaffold-terminator structure. The promoter, transposon nuclease, and terminator in these two units can be replaced as needed. For example, promoters from different species or with different regulatory properties can be selected based on the editing purpose and the target species (e.g., monocots or gymnosperms. Monocots are grasses such as rice, maize, sorghum, sugarcane, wheat, or barley; gymnosperms can be larch, masson pine, Chinese pine, or elliottii pine). Furthermore, the corresponding reRNA scaffold needs to be replaced based on the selected transposon nuclease.

[0047] After constructing the aforementioned directional editing system, it is loaded onto a backbone vector to obtain a directional modification backbone vector. In order to verify whether the editing system can be used, the applicant selected monocotyledonous plants (taking rice as an example) and gymnosperms (taking larch as an example) for editing experiments. The results showed that among the above-mentioned four transposon nuclease editing systems, the editing systems based on IsDge10, IsAam1 and enIscB can achieve directional modification of the genome, and the SpuFz editing system failed. Analysis of shearing characteristics showed that, unlike the Cas9 editing system, the transposon nuclease editing system can recognize TAM sequences, which is not only suitable for editing coding regions, but also for editing non-coding regions; it can cause deletion of fragments 7 to 12 bp downstream, especially deletions of 6 to 10 bp.

[0048] Example 1 Construction of a plant genome-directed modification backbone vector

[0049] 1. Construction of IsDge10 plant genome-directed modification backbone vector

[0050] The IsDge10 codon was optimized and a new IsDge10 gene editing backbone vector was constructed by assembling different modules. First, module 1 (MOD_A) was designed, which was an IsDge10 nuclease protein expression unit (ZmUbi1-NLS-IsDge10-NLS-AtHSP) containing NLS coding sequences at the 5' and 3' ends. IsDge10 was codon-optimized and handed over to a biological company to synthesize NLS-IsDge10-NLS (Seq ID No. 5, where 46 to 1218 bp is IsDge10). Then, the NLS-IsDge10-NLS unit, the constitutive promoter ZmUbi1 element from maize, and the Arabidopsis AtHSP terminator element were assembled into module 1 ( Figure 1 ), where the promoter unit can be replaced with LarPE004 (Seq ID No. 4, ZL202010619161.4) for constructing the IsDge10 larch genome editing vector.

[0051] Secondly, module 2 (MOD_B) was designed, which was the reRNA transcription expression cloning unit OsU6-IsDge10 scaffold-lacZα-poly T. The rice OsU6 promoter and IsDge10 scaffold-lacZα-poly T were assembled into module 2 ( Figure 1 ), wherein the OsU6 promoter can be replaced by the Arabidopsis thaliana AtU6 promoter.

[0052] Finally, modules 1 and 2 were assembled into pTrans_210d using the Golden Gate method. Competent bacterial transformation, single-clone PCR verification, plasmid extraction, and Sanger sequencing verification were performed to obtain the new IsDge10 gene editing backbone vector, Seq ID No. 1.

[0053] 2. Construction of IsAam1 plant genome-directed modification backbone vector

[0054] The IsAam1 codon was optimized, and a new IsAam1 gene editing backbone vector was constructed by assembling different modules. First, module 1 (MOD_A) was designed, which was an IsAam1 nuclease protein expression unit (ZmUbi1-NLS-IsAam1-NLS-AtHSP) containing NLS coding sequences at the 5' and 3' ends. IsAam1 was codon-optimized and handed over to a biological company to synthesize NLS-IsAam1-NLS (Seq ID No.6, where 46 to 1152 bp are IsAam1). Then, the NLS-IsAam1-NLS unit, the constitutive promoter ZmUbi1 element from maize, and the Arabidopsis AtHSP terminator element were assembled into module 1 ( Figure 1 ), wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4).

[0055] Secondly, module 2 (MOD_B) was designed, which was the reRNA transcription expression cloning unit OsU6-IsAam1 scaffold-lacZα-poly T. The rice OsU6 promoter and IsAam1 scaffold-lacZα-poly T (Seq ID No. 9) were assembled into module 2 ( Figure 1 ), wherein the OsU6 promoter can be replaced by the Arabidopsis thaliana AtU6 promoter.

[0056] Finally, modules 1 and 2 were assembled into pTrans_210d using the Golden Gate method. The new IsAam1 gene editing backbone vector was obtained through bacterial transformation, single-clone PCR verification, extraction of recombinant plasmids, and Sanger sequencing verification.

[0057] 3. Construction of enIscB plant genome-directed modification backbone vector

[0058] The enIscB codon was optimized and a new enIscB gene editing backbone vector was constructed by assembling different modules. First, module 1 (MOD_A) was designed, which was an enIscB nuclease protein expression unit (ZmUbi1-NLS-enIscB-NLS-AtHSP) containing NLS coding sequences at the 5' and 3' ends. After enIscB was codon-optimized, it was handed over to a biological company to synthesize NLS-enIscB-NLS (Seq ID No.7, where the 46th to 1533bp are enIscB). Then, the NLS-enIscB-NLS unit, the constitutive promoter ZmUbi1 element from maize, and the Arabidopsis AtHSP terminator element were assembled into module 1 ( Figure 1 ), wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4).

[0059] Secondly, module 2 (MOD_B) was designed, which was the reRNA transcription expression cloning unit OsU6-lacZα-enIscBscaffold-poly T. The rice OsU6 promoter and lacZα-enIscBscaffold-poly T (Seq ID No. 10) were assembled into module 2 ( Figure 1 ), wherein the OsU6 promoter can be replaced by the Arabidopsis thaliana AtU6 promoter.

[0060] Finally, modules 1 and 2 were assembled into pTrans_210d using the Golden Gate method. The new enIscB gene editing backbone vector was obtained through bacterial transformation, single-clone PCR verification, extraction of recombinant plasmids, and Sanger sequencing verification.

[0061] 4. Construction of SpuFz plant genome-directed modification backbone vector

[0062] The SpuFz codon was optimized and a new SpuFz gene editing backbone vector was constructed by assembling different modules. First, module 1 (MOD_A) was designed, which was a SpuFz nuclease protein expression unit (ZmUbi1-NLS-SpuFz-NLS-AtHSP) containing NLS coding sequences at the 5' and 3' ends. SpuFz was codon-optimized and handed over to a biological company to synthesize NLS-SpuFz-NLS (Seq ID No.8, where 46 to 1959 bp is SpuFz). Then, the NLS-SpuFz-NLS unit, the constitutive promoter ZmUbi1 element from maize and the Arabidopsis AtHSP terminator element were assembled into module 1 ( Figure 1 ), wherein the promoter unit can be replaced by LarPE004 (ZL202010619161.4).

[0063] Secondly, module 2 (MOD_B) was designed, which was the reRNA transcription expression cloning unit OsU6-SpuFz scaffold-lacZα-poly T. The rice OsU6 promoter and SpuFz scaffold-lacZα-polyT (Seq ID No.11) were assembled into module 2 ( Figure 1 ), wherein the OsU6 promoter can be replaced by the Arabidopsis thaliana AtU6 promoter.

[0064] Finally, modules 1 and 2 were assembled into pTrans_210d using the Golden Gate method. The new SpuFz gene editing backbone vector was obtained through bacterial transformation, single-clone PCR verification, extraction of recombinant plasmids, and Sanger sequencing verification.

[0065] Seq ID No.1IsDge10 nuclease protein expression unit (ZmUbi1-NLS-IsDge10-NLS-AtHSP) + reRNA transcription expression cloning unit (OsU6-IsDge10 scaffold-lacZα-poly T), where 11002-12174bp can be replaced with other transposon nucleases. 12754-13509bp can be replaced according to the selected transposon nuclease, that is, the reRNAscaffold-terminator part in the reRNA transcription expression cloning unit (promoter-reRNAscaffold-terminator) can be replaced according to the type of different enzymes. For example, the structure of the 12754-13509bp fragment in Seq ID No.1 is IsDge10 scaffold-lacZα-poly T. The position of the IsDge10 scaffold is located at 12754-12936bp;

[0066] agtgtggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcg

[0067] aagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgctagagcagcttgagcttggatcagattgtcgtttcccgccttcagtttaaact

[0068] atcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagcgtttattagaataatcggatatttaaaagggcgtgaaaaggtttatccgttcgtccatttgta

[0069] tgtgcatgccaaccacagggttcccctcgggatcaaagtactttgatccaacccctccgctgctatagtgcagtcggcttctgacgttcagtgcagccgtcttctgaaaa

[0070] cgacatgtcgcacaagtcctaagttacgcgacaggctgccgccctgcccttttcctggcgttttcttgtcgcgtgtttttagtcgcataaagtagaatacttgcgactagaac

[0071] cggagacattacgccatgaacaagagcgccgccgctggcctgctggggctatgcccgcgtcagcaccgacgaccaggacttgaccaaccaacgggccgaactgca

[0072] cgcggccggctgcaccaagctgttttccgagaagatcaccggcaccaggcgcgaccgcccggagctggccaggatgcttgaccacctacgccctggcgacgttgt

[0073] gacagtgaccaggctagaccgcctggcccgcagcacccggacctactggacattgccgagcgcatccaggaggccggcgcgggcctgcgtagcctggcaga

[0074] gccgtgggccgacaccaccacgccggccggccgcatggtgttgaccgtgttcgccggcattgccgagttcgagcgttccctaatcatcgaccgcacccggagcgg

[0075] gcgcgaggccgccaaggcccgaggcgtgaagtttggcccccgccctaccctcaccccggcacagatcgcgcacgcccgcgagctgatcgaccaggaaggccg

[0076] caccgtgaaagaggcggctgcactgcttggcgtgcatcgctcgaccctgtaccgcgcacttgagcgcagcgaggaagtgacgcccaccgaggccaggcggcgc

[0077] ggtgccttccgtgaggacgcattgaccgaggccgacgccctggcggccgccgagaatgaacgccaagaggaacaagcatgaaaccgcaccaggacggccagg

[0078] acgaaccgtttttcattaccgaagagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacggctcaaccgtgcggctgcatgaaatcct

[0079] ggccggtttgtctgatgccaagctggcggcctggccggccagcttggccgctgaagaaaccgagcgccgccgtctaaaaaggtgatgtgtatttgagtaaaacagct

[0080] tgcgtcatgcggtcgctgcgtatatgatgcgatgagtaaataaacaaatacgcaaggggaacgcatgaaggttatcgctgtacttaaccagaaaggcgggtcaggca

[0081] agacgaccatcgcaacccatctagcccgcgccctgcaactcgccggggccgatgttctgttagtcgattccgatccccagggcagtgcccgcgattgggcggccgt

[0082] gcgggaagatcaaccgctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcggccggcgcgacttcgtagtgatcgacggagcgc

[0083] cccaggcggcggacttggctgtgtccgcgatcaaggcagccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccaccgccgacctggtgga

[0084] gctggttaagcagcgcattgaggtcacggatggaaggctacaagcggcctttgtcgtgtcgcgggcgatcaaaggcacgcgcatcggcggtgaggttgccgaggc

[0085] gctggccgggtacgagctgcccattcttgagtcccgtatcacgcagcgcgtgagctacccaggcactgccgccgccggcacaaccgttcttgaatcagaacccgag

[0086] ggcgacgctgcccgcgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagttaatgaggtaaagagaaaatgagcaaaagcacaaacacgctaag

[0087] tgccggccgtccgagcgcacgcagcagcaaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcagttgccggcggaggatc

[0088] acaccaagctgaagatgtacgcggtacgccaaggcaagaccattaccgagctgctatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaatga

[0089] gtagatgaattttagcggctaaaggaggcggcatggaaaatcaagaacaaccaggcaccgacgccgtggaatgccccatgtgtggaggaacgggcggttggcca

[0090] ggcgtaagcggctgggttgtctgccggccctgcaatggcactggaacccccaagcccgaggaatcggcgtgacggtcgcaaaccatccggcccggtacaaatcg

[0091] gcgcggcgctgggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaagcacgccccggtgaatcgtggcaag

[0092] cggccgctgatcgaatccgcaaagaatcccggcaaccgccggcagccggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcgttc

[0093] cgatgctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgtctgtcgaagcgtgaccgacgagctggcgaggtgatccgctacgag

[0094] cttccagacgggcacgtagaggtttccgcagggccggccggcatggccagtgtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccatgaa

[0095] ccgataccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggacgtactcaagttctgccggcgagccgatggcggaaagcagaaa

[0096] gacgacctggtagaaacctgcattcggttaaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtatccgagggtgaa

[0097] gccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatcgagatcgagctagctgattggatgtaccgcgagatcacagaaggcaag

[0098] aacccggacgtgctgacggttcaccccgattactttttgatcgatcccggcatcggccgttttctctaccgcctggcacgccgcgccgcaggcaaggcagaagccag

[0099] atggttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaagaagttctgtttcaccgtgcgcaagctgatcgggtcaaatgacctgccggagtacg

[0100] atttgaaggaggaggcggggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatccgccggttcctaatgtacggagcagatgc

[0101] tagggcaaattgccctagcaggggaaaaaggtcgaaaaggcctctttcctgtggatagcacgtacattgggaacccaaagccgtacattgggaaccggaacccgta

[0102] cattgggaacccaaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaaggcgatttttccgcctaaaactctttaaaacttattaaaa

[0103] ctcttaaaacccgcctggcctgtgcataactgtctggccagcgcacagcccaagagctgcaaaaagcgcctacccttcggtcgctgcgctccctacgccccgccgct

[0104] tcgcgtcggcctatcgcggccgctggccgctcaaaaatggctggcctacggccaggcaatctaccagggcgcggacaagccgcgccgtcgccactcgaccgccg

[0105] gcgcccacatcaaggcaccctgcctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggaaacggtcacagcttgtctgtaagcggatgcc

[0106] gggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgtatactggcttaac

[0107] tatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggccctcttccgcttcctcg

[0108] ctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaaga

[0109] acatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgac

[0110] gctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggat

[0111] acctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaac

[0112] cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatta

[0113] gcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttac

[0114] cttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaa

[0115] gaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgcattctaggtactaaaacaattcatccagtaaaatata

[0116] atattttattttctcccaatcaggcttgatccccagtaagtcaaaaaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgcagaaggcaatgtcat

[0117] accacttgtccgccctgccgcttctcccaagatcaataaagccacttactttgccatctttcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcct

[0118] cttcgggcttttccgtctttaaaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaatccacatcggccagatcgttattcagtaagtaat

[0119] ccaattcggctaagcggctgtctaagctattcgtatagggacaatccgatatgtcgatggagtgaaagagcctgatgcactccgcatacagctcgataatcttttcaggg

[0120] ctttgttcatcttcatactcttccgagcaaaggacgccatcggcctcactcatgagcagattgctccagccatcatgccgttcaaagtgcaggacctttggaacaggcag

[0121] ctttccttccagccatagcatcatgtccttttcccgttccacatcataggtggtccctttataccggctgtccgtcatttttaaatataggttttcattttctcccaccagcttatat

[0122] accttagcaggagacattccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtgatattctcattttagccatttattatttccttcctcttttctacagta

[0123] tttaaagataccccaagaagctaattataacaagacgaactccaattcactgttccttgcattctaaaaccttaaataccagaaaacagctttttcaaagttgttttcaaagtt

[0124] ggcgtataacatagtatcgacggagccgattttgaaaccgcggtgatcacaggcagcaacgctctgtcatcgttacaatcaacatgctaccctccgcgagatcatccgt

[0125] gtttcaaacccggcagcttagttgccgttcttccgaatagcatcggtaacatgagcaaagtctgccgccttacaacggctctcccgctgacgccgtcccggactgatgg

[0126] gctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgttggctggctggtggcaggatatattgtggtgtaaacaaattgacgcttagacaactta

[0127] ataacacattgcggacgtttttaatgtactgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtat

[0128] tttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccctaattcccttatctgggaactactcacacattattatggagaa

[0129] actcgagcttgtcgatcgacagatcccggtcggcatctactctatttctttgccctcggacgagtgctggggcgtcggtttccactatcggcgagtacttctacacagcca

[0130] tcggtccagacggccgcgcttctgcgggcgatttgtgtacgcccgacagtcccggctccggatcggacgattgcgtcgcatcgaccctgcgcccaagctgcatcatc

[0131] gaaattgccgtcaaccaagctctgatagagttggtcaagaccaatgcggagcatatacgcccggagtcgtggcgatcctgcaagctccggatgcctccgctcgaagt

[0132] agcgcgtctgctgctccatacaagccaaccacggcctccagaagaagatgttggcgacctcgtattgggaatccccgaacatcgcctcgctccagtcaatgaccgct

[0133] gttatgcggccattgtccgtcaggacattgttggagccgaaatccgcgtgcacgaggtgccggacttcggggcagtcctcggcccaaagcatcagctcatcgagag

[0134] cctgcgcgacggacgcactgacggtgtcgtccatcacagtttgccagtgatacacatggggatcagcaatcgcgcatatgaaatcacgccatgtagtgtattgaccga

[0135] ttccttgcggtccgaatgggccgaacccgctcgtctggctaagatcggccgcagcgatcgcatccatggcctccgcgaccggctgcagaacagcgggcagttcggt

[0136] ttcaggcaggtcttgcaacgtgacaccctgtgcacggcgggagatgcaataggtcaggctctcgctgaattccccaatgtcaagcacttccggaatcgggagcgcgg

[0137] ccgatgcaaagtgccgataaacataacgatctttgtagaaaccatcggcgcagctatttacccgcaggacatatccacgccctcctacatcgaagctgaaagcacgag

[0138] attcttcgccctccgagagctgcatcaggtcggacacgctgtcgaacttttcgatcagaaacttctcgacagacgtcgcggtgagttcaggctttttcatatctcattgccc

[0139] cccggatctgcgaaagctcgagagagatagatttgtagagagagactggtgatttcagcgtgtcctctccaaatgaaatgaacttccttatatagaggaagggtcttgc

[0140] gaaggatagtgggattgtgcgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgg

[0141] gtgggggtccatctttgggaccactgtcggcagaggcatcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttctactgtccttttga

[0142] tgaagtgacagatagctgggcaatggaatccgaggaggtttcccgatattaccctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgatattcttgg

[0143] agtagacgagagtgtcgtgctccaccatgttcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatcttt

[0144] gggaccactgtcggcagaggcatcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttctactgtccttttgatgaagtgacagatag

[0145] ctgggcaatggaatccgaggaggtttcccgatattaccctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgatattcttggagtagacgagagtg

[0146] tcgtgctccaccatgttggcaagctgctctagccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaa

[0147] agcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata

[0148] acaatttcacacaggaaacagctatgacatgattacgaattcgagctcggtacccgggGATCggcgcgccGGAGctgcagtgcagcgtgacccggtcgtgc

[0149] ccctctctTgagataaGGtgagcattgcatgtctaagttataaaaaattaccacatattttttttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactt

[0150] tactctacgaataatataatctatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattgagtattttgacaacagga

[0151] ctctacagttttatctttttagtgtgcatgtgttctcctttttttttgcaaatagcttcacctatataatacttcatccattttattagtacatccatttagggtttagggttaatggttttt

[0152] atagactaatttttttagtacatctattttattctattttagcctctaaattaagaaaactaaaactctattttagtttttttatttaataatttagatataaaatagaataaaataaagtg

[0153] actaaaaattaaacaaataccctttaagaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacggac

[0154] accaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctctcgagagttccgctccaccgttg

[0155] gacttgctccgctgtcggcatccagaaattgcgtggcggagcggcagacgtgagccggcacggcaggcggcctcctcctcctctcacggcaccggcagctacgg

[0156] gggattcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggagcgcacacac

[0157] acacaaccagaActcccccaaatccacccgtcggcacctccgcttcaaggtacgccgctcgtcctcccccccccccctctctaccttctcAagatcggcgttccggt

[0158] ccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgctActagcgttcgtacacggatgcgacctgtacgtcagacac

[0159] gttctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggttt

[0160] gcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttcAagatcggag

[0161] tagaattaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctag

[0162] gataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttcAagatcgg

[0163] agtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggatag

[0164] gtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataatt

[0165] attttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttttgcttggtactgtttcttttgtcgatgctcaccc

[0166] tgttgtttggtgttacttctgcagcctgcaggAATGGCTCCGAAGAAGAAGGAAGGTTGGCATCCACGGGGTGCCAG

[0167] CTGCTATGACTACCCACCGGAAAGTTTATCGCTATCGCATAGAACCAACACCAGTGCAGGAATCTAA

[0168] ACTGTACATGTTGGCCGGAAGCCGCCGTTTGTGTTCAACTGGGCGCTTGCTAGGAGGAGGGGAGCAC

[0169] TACGCGGAGACAGGAAAAACACTCGGGTACAATGCTCAAGCAGGCGAGCTGACGGCGCTTAAAAAAT

[0170] CAAGAGGAGACATCCTGGTTGAAGGAGTCCGACTCACAACTGCTGCAGCAGGCTTTGAAGGATGTC

[0171] GAGAGGGCTTTTGTCAATTTCTTCGAGAAGCGTGCGCGCTTTCCTAGATTTAAATCCAAGAAAACCG

[0172] ACACGCCGCGGTTCCGTATACCTCCAAAGGGTCAGGATAGAGGGGAGTAGAGTGTATGTACCCAAGG

[0173] TCGGGTGGGTGAAGTTACGTAAAAGCCAGGAAATTGAAGGCAAAACCAAGTCCGCCACCTTCAAAC

[0174] GCGAGGCGGATGGTCACTGGTACGTCCTCCTCGTTTCTGAATTTGAGATGCCTGATGTTCCTCTTCCC

[0175] CCGGTGCCGGAGTCGGAGGTGGTGGGCATCGACCTAGGCCTCAAAGATTTCTACGTACTGTCTGATG

[0176] GCGGCCGGAAGGAAGCTCCGAGGTTTGCACGGAAGGGACAGAGGAAACTTCGGAGAGCGGCGAGG

[0177] CGACATTCAAAATGCACTCGGGGTAGCAACCGCAAGGCCAAGGCCAAAAGGAAGCTCGCCCGCGTC

[0178] CACCGCCAGATTGCCAACCAACGAAAGGACTTCGTGCACAAGGCAACATCAGGACTCGTTCAGCAG

[0179] TATCAAGGGTTCTGCATCGAGAACCTATCAATTAAGGGGATGGCAAAGACAAAGCTGTCAAAGTCC

[0180] GTTCTGGATGCTGCATTAGGTGAGTTCCGGAGGCAGTTAGCCTACAAGGCTCAGTGGCATAGAAAGT

[0181] GGCTGGCAGTCATTGATAGATGGTTCCCGTCCTCCAAGCTCTGCGGAGAATGTGGAAGTATCAATGC

[0182] AGACTTGACGCTCTCCGACCGCGAGTGGACCTGCGAGTGCGGCGCCGTCCATGATCGCGACCTCAAT

[0183] GCCGCCAGGAACATCAAGCGGGAAGGTTTGTCGCAAATTGTTGTGGCGGGCCATGCTGAAACTCTC

[0184] AACGCCAGAGGCGAAGGGGTAAGGCCAGCGATCGCCGGCAGTCCAAGAAAGCGGCCAGCGGCGAC

[0185] GAAGAAGGCGGGCAGGCGAAGAAGAAGTAAGTGAGCTTctcgagtatatgaagatgaattgaaaatttggtgtgtcaaataa

[0186] aaagcttgtgtgcttaagtttgtgtttttttcttggcttgttgtgttatgaatttgtggctttttctaatattaaatgaatgtaagatcacattataatgaataaacaaatgtttctataa

[0187] tccattgtgaatgttttgttggatctcttctgcagcatataactactgtatgtgctatggtatggactatggaatatgattaaagataagCGCTgagctcGGACggcg

[0188] cgccGGATCATGAACCAACGGCCTGGCTGTATTTGGTGGTTGTGTAGGGAGATGGGGAGAAAAAAAG

[0189] CCCGATTCTCTTCGCTGTGATGGGCTGGATGCATGCGGGGGAGCGGGAGGCCCAAGTACGTGCACG

[0190] GTGAGCGGCCCACAGGGCGAGTGTGAGCGCGAGAGGCGGGAGGAACAGTTTAGTACCACATTGCCC

[0191] AGCTAACTCGAACGCGACCAACTTAATAACCCGCGCGCTGTCCGCTTGTGTGTGGAGCGGTTCACGAC

[0192] CGCGACCTCAACGCCGCCCGGAACATCAAGCGGGAAGGGCTTTCGCAAATCGTCGTCGCGGGGCAC

[0193] GCGGAGACGTTAAACGCTCGGGGAGAGGGTGTCAGACCTGCGATAGCGGGCAGCCCTCGAtgaAGCG

[0194] AGAATCCAACGGCTTTAGCCGTTGGAGTGTCAAGGAGACCTTACAGTTGGACACAGGCCaacttgtgaagat

[0195] tgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcgccgctacagggcgcgtccca

[0196] ttcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttggg

[0197] taacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggt

[0198] cctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgag

[0199] ccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccGCTTTCCACCGGTGGTCTCATTTTTTTGAGCTCccggggcgcgccGATATCgagctc。

[0200] Seq ID No.4 Larch LarPE004 Promoter:

[0201] ttccttttttggactattttatcataaaagttaatttcattctagtcttcccctcttcttttatacaattttattattaattgtctaacaactaaattctttaacaaccaatatatttcatcca

[0202] tcgactttctcttatctatcttacaatcttatatgggtcacgtaatgatggatggagtgtccacttgaaacattggatcatttcaaaacaaataaaaaaaaaaattagaaaat

[0203] tttattgcaaaaaattacaaaaatgtactagtaaaaaagattaaatttatccatttattaactcactccattcctccctacctacttatgggaacctattcattttacctccttatg

[0204] ggaccctctattcattttacacaccattatcattaggaagaattggatgtatgcacattgaatcccaaccatggtgggcaagggagggggcaggtgtttaaaagaaaa

[0205] agaaaaattattaatatcgtggttatcttgaagacgaacctaaggaaaaactcaaaaacattaaaataatgaaaggtactaccacaactttcccattcttgatgccaat

[0206] gcaagttagttcctttcttatacttggcatgccaatacttacttgagaaaaaagtaataaagtgatagaatggtcaataattttgaacactaaggctcccacataatttgtttat

[0207] acttatcattaaaaaaaataagaaacaataacccctaaggcacataatttgttttccctcatcatttaaaaaaaaaagagaacataactcctaaagaataccttatcacaacttga

[0208] tagagatatcaattgatgataaagaaggtctaaccctatttatatctccccctcaagtccttgccttgtgggctaagtaaaagctttggtgcaaggagctttaggggg

[0209] gcggtgacttatttatttattattaattaattatttttaaaataaggaccggccctattatttatttattattataattaattatttttaaaataatttatttaattattaactatttgtttgtgtggttac

[0210] tttcaacacaatgtatctagacactttcggtcaattattgaccaaaatttaagctttaagataattatttgatgcaattgatgtggtaaatgatcatcagtttggcatgtgcccaa

[0211] ccactacagagcccgcgggaccaagcaaccttatcttttcttcgttacggagccaatcaaaattttagaagggagaatactttaaggcggctccaccgaccttatcccac

[0212] ttgcacaagtggcctcctagaagctgacacctgtcttaatatgaatggacttcattgggcgggtcgtcgatatggtgaatttaaatacggctccacccctcattattcattgt

[0213] gatttcttgatttggagagttttccacgaacggcaggcgaagcaaccgagagcgtctctctatcgattgagttcaggtaacgtgttcttcgtctcgatttctttctttgtatttttta

[0214] atgtctctggttctcatttaactgtggtaggcttgctcttcttgatcttcgttttgaatcccaaatcagaaggctattctccggatctcgttttgaattccaaatcagaggtttttat

[0215] ttcgttattgtgatttattttctggaattattgttttgataaaaggttttcgtttaatttcatcggttatggcttgatgaggaataccaaatcctatttgcttcttgtgtgatttgttgttc

[0216] ctctatttctgggttttaatggagttatttgccagtttgtgttttatagggttttgaatccgtgaatcctcgacagcttgtagcctagggttttattttgcatctgcgggttattatcatttattgttcaggttttcagactatccttattgtttctgactatttcttatggttgtgcaggtggtgggttattctttattgaaaacttcaatat。

[0217] Seq ID No.5 NLS-IsDge10-NLS:

[0218] ccgaagaagaagaggaaggttggcatccacggggtgccagctgctatgactacccaccggaaagtttatcgctatcgcatagaaccaacaccagtgcaggaatcta

[0219] aactgtacatgttggccggaagccgccgttttgtgttcaactgggcgcttgctaggaggagggagcactacgcggagacaggaaaaacactcgggtacaatgctca

[0220] agcaggcgagctgacggcgcttaaaaatcaagaggagacatcctggttgaaggagtccgactcacaactgctgcagcaggctttgaaggatgtcgagagggctttt

[0221] gtcaatttcttcgagaagcgtgcgcgctttcctagatttaaatccaagaaaaccgacacgccgcggttccgtatacctcaaagggtcaggatagaggggagtagagtg

[0222] tatgtacccaaggtcgggtgggtgaagttacgtaaaagccaggaaattgaaggcaaaaccaagtccgccaccttcaaacgcgaggcggatggtcactggtacgtcc

[0223] tcctcgtttctgaatttgagatgcctgatgttcctcttcccccggtgccggagtcggaggtggtgggcatcgacctaggcctcaaagatttctacgtactgtctgatggcg

[0224] gccggaaggaagctccgaggtttgcacggaagggacagaggaaacttcggagagcggcgaggcgacattcaaaatgcactcggggtagcaaccgcaaggcca

[0225] aggccaaaaggaagctcgcccgcgtccaccgccagattgccaaccaacgaaaggacttcgtgcacaaggcaacatcaggactcgttcagcagtatcaagggttct

[0226] gcatcgagaacctatcaattaaggggatggcaaagacaaagctgtcaaagtccgttctggatgctgcattaggtgagttccggaggcagttagcctacaaggctcagt

[0227] ggcatagaaagtggctggcagtcattgatagatggttcccgtcctccaagctctgcggagaatgtggaagtatcaatgcagacttgacgctctccgaccgcgagtgga

[0228] cctgcgagtgcggcgccgtccatgatcgcgacctcaatgccgccaggaacatcaagcgggaaggtttgtcgcaaattgttgtggcgggccatgctgaaactctcaacgccagaggcgaaggggtaaggccagcgatcgccggcagtccaagaaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaagtga。

[0229] Seq ID No.6 NLS-IsAam1-NLS:

[0230] ccgaagaagaagaggaaggttggcatccacggggtgccagctgctatggttaacaaatcctacaaatttagactctaccccacaaaagaacaagaacagctgctcg

[0231] ccaagacctttggctgcgtgaggtttgtgtacaacaagatgttggaggagcgtatacagatctacgagaagttcaaagacgataaggaggctcttaagaaacaaacatt

[0232] ccctacgcctgcaaagtacaaaaaggaattcccatggctcaaagaggttgatagcctggcgctagctaatgcacaactaaacctccagaaggcgttccagaatttcttc

[0233] tctggtcgggcaggttttcccaagtttaagaaccgcaaggccaagcaatcatacactacaaatgtggttaatggcaacatccagctttccgacggctacattaagttacc

[0234] aaaattaaagtgggtcaaattcaagcagcatagggagatcccggcccaccacatcatcaaagcctgcaccataaaaaaaactaaaactggaaaatattatgtgtcgatt

[0235] ctgaccgagtatgaacaccagccggtgccgaaggagattcaaactgttgtcggattggacttctccatgaacgggctgttcgtggattcagaaggaaaacgagcgaa

[0236] ctatccacgcttctaccggcaggccctcgaaaagttggccaaggagcagcgcatactgtcgcgtcgcaagaagggtagtaacagatggcacaagcagagactgaa

[0237] ggtggctaagctccacgagaagatcgcaaatcagaggaaggattttcttcataaaaagagttatgagctggccaagcaatatgattgtgtcgttattgagaatctgaaca

[0238] tgaagggaatgagccaagtgcttaacttcggcaagtctgtacatgataatgggtggggcatgtttaccaccttcctccaatacaagttggaagaacaggggaagaaac

[0239] ttattaagattgataaatggtttccttcctccaagacgtgtagctgctgcgaccaggtcaaggaaagcctctctctttcagagcggacgtttagatgtgagtgcggcttcga

[0240] gtcggacagggacgtcaatgctgccatcaatataaagcatgaggggatgaaaaggctagcgatcgctaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaag。

[0241] Seq ID No.7 NLS-enIscB-NLS:

[0242] ccgaagaagaagaggaaggttggcatccacggggtgccagctgctatgatggccgtggtatacgtgatcagcaagtctggtaaaccactgatgccaacaacaaggt

[0243] gtggacatgtccgaatacttctcaaggaagggaaggctagggtggttgagaggaagccgttcaccatacaattgacatatgagagtgcggaggaaacacagccgct

[0244] cgtgctgggcattgatccaggtagaacgaatattgggatgtccgtcgtcaccgagtccggtgaatcagtgttcaatgctcaaattcgcacgcgtaacaaggacgtccct

[0245] aaattgatgaaggatcggaagcaatatcggatggcgcaccgccgcctcaagcgccggtgcaaaaggaggaggcgcgcgaaggcggcgggaactgcatttgaag

[0246] aaggcgagaagcagagacttcttcccggctgcttcaagcccatcacatgcaagtcaattcggaataaagaagcacgtttcaacaataggaaacgaccagttggctgg

[0247] ctcacgcctactgccaaccatttactcgtaacccaccttaatgtggttaagaaagtgcagaaaatcctgccggtcgccaaggttgttctggagctgaaccgtttctccttc

[0248] atggcaatgaataaccccaaggttcaacggtggcagtaccagcgcgggccgctctacggcaaaggcagcgtagaggaggccgtgtccatgcagcaggacggcc

[0249] actgcctgttctgcaagcatggaatcgaccactaccaccacgtcgttccacgacgcaaaaatggaagtgaaactttggagaatagagtcggcctttgtgaggagcacc

[0250] acaggctcgtccacactgacaaagagtgggaggcgaacctagcctccaagaagtccggcatgaacaagaagtatcatgctttatctgtcttgaatcaaatcatcccgt

[0251] acttggctgatcagctcgccgacatgtttcctggaaacttttgtgttacatctggacaagatacatacctcttcagggaggagcacggcattcctaaagatcattatttgga

[0252] cgcctactgcattgcttgttctgctctcaccgacgcaaaaaaggtcagctcgcccaaaggtcgtccttatatggtgaggcagtttaggaggcacgataggcaagcatgc

[0253] cataaagctaatcttaacaggagatattacatgggcggcaagctcgtggccaccaaccggcataaggccatggatcaaaagactgacagcctcgaagagtaccgcg

[0254] ccgctcattctgcggccgatgtgtcaaagctgacggtgaagcacccgtcggcacagtacaaggatatgtcaaggatcatgccgggctccatacttgttagtggggag

[0255] gggaaactttttaccctacgtcggtcggaaggtaggaacaaaggacaggtgaactacttcgtgtcgacggagggcatcaagtactgggcgcgcaagtgccagtatctgcggaataatgggggtctgcagatatatgttaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaag。

[0256] Seq ID No.8 NLS-SpuFz-NLS:

[0257] ccgaagaagaagaggaaggttggcatccacggggtgccagctgctatgcctcccaagaaaaagcagaagctggagcggttgaagaagctcgacaaacctactttg

[0258] cacacgtgcaataagacttcatttgcaaaggccttcctcccaaatgagacatacagacagcgcctgttggattatatagctatcatccatcagcttgccgatcatgcttcc

[0259] catgctttgaagttttacatcttatcgacctctacgtccagcttccccgttgttcatgaagataccatcgaggccatactgtatctactgaacaagggcgaggcatggcacc

[0260] ctagaaaagaggccaagaaggcctggcgcgattgcctcctgccgtatgtccaaagatactgccagattgttgggtttattcatccaaatcttagaggggagcaacaatc

[0261] tatcaactacctaactgtctccatgatgactaatctcaaggtgaatgttcaggagcacttcatgcagatgctgctgaggtatatcaatttaagatttgacgtgaagggacag

[0262] aaacaaaggctcccgcccaaatccgacgcccggaaggcattctttactcgactccgctacttgaaaagtgtgttcctctttgatgttgtacctgaactggagttcctcgac

[0263] gacctcaccccattggagtcagaagtgttagaggagatctggtcactggaccttccatttctgccgaatgaccctcttgcctacgcgatagtcgccgatccgatgtctttc

[0264] tttccggcttattgcaagctatcgggcctgtacgagcagtatggttttcaaaggttttctgccattcccctgcggcgatcgctgatacagagccatgtgaggattgacaca

[0265] attatattgtaccagcacattctatgtattacacgcagagatgctgaaactgtagagaaagatgatctgtggatgagagtctgcaacctccgtacgaaggccttccgcag

[0266] ccgctgcggcatgcattttgaaggtagtatcaccacggatggtgcatcagtcagtgtgtatttaaagcatcccgaagctgataagtatggaaagcgcggcgcgaggaa

[0267] gagtgcaaatacagttgccgcggaggtaaaagcgctatatgttgagaacaacttgccggcctgccgcgccgctgagaatgtggtagtcatcgacccgaataaaaga

[0268] gacatactttactgtcaagattccaatggcacaaccttccgttacaccgccaaccaacgcgccgtggaaacaggttccaggaggttcgctaaacgccgtgaggcgat

[0269] gaaggaggaagccggcgtcgatcttattgaaagtcgaataccgtcgcacaagacgatgaacctcatggacttcactcgttacctgctcgtccggcgggcggactggg

[0270] accgcagaaaggaattctactcgcaccccgcgcacacaaggtggaagtggcactccttcatcaacagacagaagtccgagtccaagctcatcagcaacatgagga

[0271] acaaatatggacggaacttcacggtggtgatgggcgattggagcgatgctggaaggactgcacgattccagacatctagcaagaccaaggggtggcggacgctgtt

[0272] taaaaggaatagaatcgactgcttccttttagatgagtacaagacaagttcagtctgtccaagatgctctagctccgagttcgtcgaaaaaaagttcaagacccgccctc

[0273] actctaggccgtggaggcggagggaggggaaaattgagaaggttcacggcctactcggttgtaccaacccaaactgcctgcaacaggcgtggacatcaggaatgc

[0274] ggtactggaacagggacatgctctcaacatgtaatatgttgctcattgtacggagcatgcttgacgggcatggccggccggaagttttctcgcgctctgtgcctgcagtggcgaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaag。

[0275] Seq ID No.9 Is Aam1 scaffold-lacZα-poly T (where 1 - 182bp is IsAam1 scaffold):

[0276] GACAGGGACGTCAATGCGGCAATCAATATCAAACATGAGGGCATGAAACGATTAGCAATAGCCTAACT

[0277] TGTCCTCGAACCGTGGGACACACGGGGATCGCTCAGTCAACTTCCCGTCATGAGATGGGATTACCTGA

[0278] GAAGCCCCCACCTCTAAGCGAAGCGTAGGTGGTGGGAGCATGTCACGGAGACCTTACAGTTGGACAC

[0279] AGGCCaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcg

[0280] ccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtg

[0281] ctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggt

[0282] accgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctca

[0283] caattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccGCTTTCCACCGGTGGTCTCATTTTTTT。

[0284] Seq ID No.10 lacZα - enIscB scaffold - poly T (where 560 - 750bp is enIscB scaffold):

[0285] Ttacagttggacacaggccaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggaggcagtgcatgcatcgcgcaatgcactgacgggtgcccccctg

[0286] gagacgggcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaa

[0287] agggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagg

[0288] gcgaattgggtaccgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaatt

[0289] gttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcaCTG

[0290] CCCGCTTTCCACCGGTGGTCTCAGGCTCGTCCAACTGCGGTTGAACGAGCACAGGCTGAGACATTCG

[0291] TAAGGCCGAAAGGCCGGACGCACCCTGGGATTTCCCCAGTCCCCGGAACTGCATAGCGGATGCCAGT

[0292] TGATGGAGCAATCTATCAGATAAGCCAGGGGGAACAATCACCTCTCTGTATCAGAGAGAGTTTTACAAAAGGAGGAACGGTTTTTTT。

[0293] Seq ID No.11 SpuFz scaffold-lacZα-poly T (where 1 - 351bp is SpuFz scaffold):

[0294] GAGTTTGTGGAGAAAAAATTCAAAACACGACCTCATTCAAGACCTTGGCGCCGTCGTGAAGGCAAGA

[0295] TTGAAAAAGTCCACGGACTGCTGGGTTGTACCAACCCTAACTGTTTGCAGCAAGCCTGGACATCGGG

[0296] AATGCGCTACTGGAATCGAGATATGCTGTCAACCTGCAACATGCTATTGATTGTGAGATCAATGTTGGA

[0297] TGGACACGGTAGACCAGAAGTGTTCAGCAGGAGTGTTCCAGCCGTAGCGTAGAACGTAGATTGGTTA

[0298] GATTAGGTTTTCCGAGCCGGTTGTCGCGCGGTTCAATCCCTGGTGCGGGTGCTAGTGCCAATACCCAC

[0299] CGGCTCCGCACTAGGAGACCTTACAGTTGGACACAGGCCaacttgtgaagattgcaaaacgtggcggcgtgaccgcaatggag

[0300] gcagtgcatgcatcgcgcaatgcactgacgggtgcccccctggagacgggcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagg

[0301] gcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaa

[0302] aacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattgggtaccgggccccccctcgaggtcctccagcttttgttccctttagtgagggttaattgc

[0303] gcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccGCTTTCCACCGGTGGTCTCATTTTTTT。

[0304] Seq ID No.12IsAam1 scaffold:

[0305] gacagggacgtcaatgcggcaatcaatatcaaacatgagggcatgaaacgattagcaatagcctaacttgtcctcgaaccgtgggacacacggggatcgctcagtc aacttcccgtcatgagatgggattacctgagaagcccccacctctaagcgaagcgtaggtggtgggagcatgtcac。

[0306] Seq ID No.2 enIscB scaffold:

[0307] ggctcgtccaactgcggttgaacgagcacaggctgagacattcgtaaggccgaaaggccggacgcaccctgggatttccccagtccccggaactgcatagcggat gccagttgatggagcaatctatcagataagccagggggaacaatcacctctctgtatcagagagagttttacaaaaggaggaacgg。

[0308] Seq ID No.3 SpuFz scaffold:

[0309] gagtttgtggagaaaaaattcaaaacacgacctcattcaagaccttggcgccgtcgtgaaggcaagattgaaaaagtccacggactgctgggttgtaccaaccctaac

[0310] tgtttgcagcaagcctggacatcgggaatgcgctactggaatcgagatatgctgtcaacctgcaacatgctattgattgtgagatcaatgttggatggacacggtagac

[0311] cagaagtgttcagcaggagtgttccagccgtagcgtagaacgtagattggttagattaggttttccgagccggttgtcgcgcggttcaatccctggtgcgggtgctagtgccaatacccaccggctccgcacta。

[0312] Seq ID No.13 Coding sequence of IsDge10:

[0313] atgactacccaccggaaagtttatcgctatcgcatagaaccaacaccagtgcaggaatctaaactgtacatgttggccggaagccgccgttttgtgttcaactgggcgc

[0314] ttgctaggaggagggagcactacgcggagacaggaaaaacactcgggtacaatgctcaagcaggcgagctgacggcgcttaaaaatcaagaggagacatcctgg

[0315] ttgaaggagtccgactcacaactgctgcagcaggctttgaaggatgtcgagagggcttttgtcaatttcttcgagaagcgtgcgcgctttcctagatttaaatccaagaa

[0316] aaccgacacgccgcggttccgtatacctcaaagggtcaggatagaggggagtagagtgtatgtacccaaggtcgggtgggtgaagttacgtaaaagccaggaaatt

[0317] gaaggcaaaaccaagtccgccaccttcaaacgcgaggcggatggtcactggtacgtcctcctcgtttctgaatttgagatgcctgatgttcctcttcccccggtgccgg

[0318] agtcggaggtggtgggcatcgacctaggcctcaaagatttctacgtactgtctgatggcggccggaaggaagctccgaggtttgcacggaagggacagaggaaact

[0319] tcggagagcggcgaggcgacattcaaaatgcactcggggtagcaaccgcaaggccaaggccaaaaggaagctcgcccgcgtccaccgccagattgccaaccaa

[0320] cgaaaggacttcgtgcacaaggcaacatcaggactcgttcagcagtatcaagggttctgcatcgagaacctatcaattaaggggatggcaaagacaaagctgtcaaa

[0321] gtccgttctggatgctgcattaggtgagttccggaggcagttagcctacaaggctcagtggcatagaaagtggctggcagtcattgatagatggttcccgtcctccaag

[0322] ctctgcggagaatgtggaagtatcaatgcagacttgacgctctccgaccgcgagtggacctgcgagtgcggcgccgtccatgatcgcgacctcaatgccgccaggaacatcaagcgggaaggtttgtcgcaaattgttgtggcgggccatgctgaaactctcaacgccagaggcgaaggggtaaggccagcgatcgccggcagtccaaga. Seq ID No.14 Is the coding sequence of Aam1:

[0323] atggttaacaaatcctacaaatttagactctaccccacaaaagaacaagaacagctgctcgccaagacctttggctgcgtgaggtttgtgtacaacaagatgttggagg

[0324] agcgtatacagatctacgagaagttcaaagacgataaggaggctcttaagaaacaaacattccctacgcctgcaaagtacaaaaaggaattcccatggctcaaagag

[0325] gttgatagcctggcgctagctaatgcacaactaaacctccagaaggcgttccagaatttcttctctggtcgggcaggttttcccaagtttaagaaccgcaaggccaagc

[0326] aatcatacactacaaatgtggttaatggcaacatccagctttccgacggctacattaagttaccaaaattaaagtgggtcaaattcaagcagcatagggagatcccggc

[0327] ccaccacatcatcaaagcctgcaccataaaaaaaactaaaactggaaaatattatgtgtcgattctgaccgagtatgaacaccagccggtgccgaaggagattcaaac

[0328] tgttgtcggattggacttctccatgaacgggctgttcgtggattcagaaggaaaacgagcgaactatccacgcttctaccggcaggccctcgaaaagttggccaagga

[0329] gcagcgcatactgtcgcgtcgcaagaagggtagtaacagatggcacaagcagagactgaaggtggctaagctccacgagaagatcgcaaatcagaggaaggattt

[0330] tcttcataaaaagagttatgagctggccaagcaatatgattgtgtcgttattgagaatctgaacatgaagggaatgagccaagtgcttaacttcggcaagtctgtacatga

[0331] taatgggtggggcatgtttaccaccttcctccaatacaagttggaagaacaggggaagaaacttattaagattgataaatggtttccttcctccaagacgtgtagctgctg

[0332] cgaccaggtcaaggaaagcctctctctttcagagcggacgtttagatgtgagtgcggcttcgagtcggacagggacgtcaatgctgccatcaatataaagcatgaggggatgaaaaggctagcgatcgct。

[0333] Coding sequence of Seq ID No.15 enIscB:

[0334] atgatggccgtggtatacgtgatcagcaagtctggtaaaccactgatgccaacaacaaggtgtggacatgtccgaatacttctcaaggaagggaaggctagggtggtt

[0335] gagaggaagccgttcaccatacaattgacatatgagagtgcggaggaaacacagccgctcgtgctgggcattgatccaggtagaacgaatattgggatgtccgtcgt

[0336] caccgagtccggtgaatcagtgttcaatgctcaaattcgcacgcgtaacaaggacgtccctaaattgatgaaggatcggaagcaatatcggatggcgcaccgccgcc

[0337] tcaagcgccggtgcaaaaggaggaggcgcgcgaaggcggcgggaactgcatttgaagaaggcgagaagcagagacttcttcccggctgcttcaagcccatcaca

[0338] tgcaagtcaattcggaataaagaagcacgtttcaacaataggaaacgaccagttggctggctcacgcctactgccaaccatttactcgtaacccaccttaatgtggttaa

[0339] gaaagtgcagaaaatcctgccggtcgccaaggttgttctggagctgaaccgtttctccttcatggcaatgaataaccccaaggttcaacggtggcagtaccagcgcgg

[0340] gccgctctacggcaaaggcagcgtagaggaggccgtgtccatgcagcaggacggccactgcctgttctgcaagcatggaatcgaccactaccaccacgtcgttcc

[0341] acgacgcaaaaatggaagtgaaactttggagaatagagtcggcctttgtgaggagcaccacaggctcgtccacactgacaaagagtgggaggcgaacctagcctc

[0342] caagaagtccggcatgaacaagaagtatcatgctttatctgtcttgaatcaaatcatcccgtacttggctgatcagctcgccgacatgtttcctggaaacttttgtgttacat

[0343] ctggacaagatacatacctcttcagggaggagcacggcattcctaaagatcattatttggacgcctactgcattgcttgttctgctctcaccgacgcaaaaaaggtcagc

[0344] tcgcccaaaggtcgtccttatatggtgaggcagtttaggaggcacgataggcaagcatgccataaagctaatcttaacaggagatattacatgggcggcaagctcgtg

[0345] gccaccaaccggcataaggccatggatcaaaagactgacagcctcgaagagtaccgcgccgctcattctgcggccgatgtgtcaaagctgacggtgaagcacccg

[0346] tcggcacagtacaaggatatgtcaaggatcatgccgggctccatacttgttagtggggaggggaaactttttaccctacgtcggtcggaaggtaggaacaaaggacaggtgaactacttcgtgtcgacggagggcatcaagtactgggcgcgcaagtgccagtatctgcggaataatgggggtctgcagatatatgtt。

[0347] Example 2 Directional Editing of Rice Endogenous Genes Based on the IsDge10 System

[0348] 1. Design of the Guide reRNA for Directional Editing of the Rice Endogenous Genome

[0349] To test the editing efficiency of the constructed IsDge10 system in plant genomes, the rice genome was scanned to identify six spacer sites with TAMs of TTAT (see Table 1) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 1 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0350] Table 1 Genome editing reRNA design sites and sequences

[0351]

[0352]

[0353] 2. Construction of IsDge10+reRNA recombinant expression vector

[0354] IsDge10-based expression vector construction: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, and reRNA06-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The TnpB plant genome-directed editing backbone vector, the sticky-end insert, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction products were then transformed into Escherichia coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and finally the recombinant expression vectors IsDge10-reRNA01, IsDge10-reRNA02, IsDge10-reRNA03, IsDge10-reRNA04, IsDge10-reRNA05 and IsDge10-reRNA06 were obtained through sequencing verification.

[0355] 3. Rice protoplast transformation of IsDge10 recombinant expression vector

[0356] The specific process of protoplast isolation, transformation and DNA extraction of IsDge10 recombinant expression vector in rice Nipponbare refers to the experimental method disclosed in the literature (Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. 2006. A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant, 9(7): 1088-1091.).

[0357] 4. Targeted Editing Result Detection

[0358] The detection and analysis of genomic NHEJ editing events were performed as follows: After rice protoplast transformation, the cells were cultured in the dark at 32°C for 48 hours, and the transformed cells were harvested. The CTAB method was used to extract genomic DNA from the rice protoplasts. This DNA was used as a template for PCR amplification and NGS verification analysis. The primers used are shown in Table 2. The specific experimental procedures were based on the experimental methods published in the literature (Zhong Z, Zhang Y, You Q, Tang X, Ren Q, Liu S, Yang L, Wang Y, Liu X, Liu B, Zhang T, Zheng X, Le Y, Zhang Y, Qi Y. 2018. Molecular Plant. Plant genome editing using FnCpf1 and LbCpf1 nucleases at redefined and altered PAM sites. Mol Plant, 11: 999-1002). The PCR products were gel-purified and then sequenced by Novogene (Tianjin, China) using the NovaSeq 6000-PE150 sequencing strategy. The data were analyzed using CRISPRMatch software (You, Q., Zhong, Z., Ren, Q., Hassan, F., Zhang, Y., and Zhang, T. 2018. CRISPRMatch: an automatic calculation and visualization tool for high-throughput CRISPR genome-editing data analysis. Int. J. Biol. Sci. 14: 858–862.) to calculate the mutation efficiency (i.e., editing efficiency).

[0359] Table 2 Genome editing PCR primer sequence information

[0360] Primer name Primer sequences use IsDge10-site01-F aagagatgtgctcgaatcagc Site01 NGS upstream primer IsDge10-site01-R tcttcatttctgggatcgca Site01 NGS downstream primers IsDge10-site02-F atggctggtactagcagaataag Site02 NGS upstream primer IsDge10-site02-R gtgtattcttgtgggatatcttgg Site02 NGS downstream primers IsDge10-site03-F tgcatgtttgttgacagaaaaga Site03 NGS upstream primer IsDge10-site03-R aaccttgcaatgcgattgtat Site03 NGS downstream primers IsDge10-site04-F tttgcttttcttatctggctttgtt Site04 NGS upstream primer IsDge10-site04-R catcaccatgtgataccaaagttg Site04 NGS downstream primers IsDge10-site05-F gaaacaagcaagctcacctg Site05 NGS upstream primer IsDge10-site05-R ctgttcgtaaatgaatagtcccaa Site05 NGS downstream primers IsDge10-site06-F gtagccttctcatctgtaactatctt Site06 NGS upstream primer IsDge10-site06-R cctgaagatgcgatgaccag Site06 NGS downstream primers

[0361] Depend on Figure 2 A: Based on the compact IsDge10 plant genome editing tool constructed by the present invention, IsDge10 can edit all 6 sites tested in rice, with an editing efficiency of about 2% to 13%. The shearing characteristic analysis showed that the system can recognize the TAM (5'-TTAT-3') sequence, causing the deletion of the fragment 7 to 12 bp downstream, with the majority of deletions being 6 to 10 bp ( Figure 3 ). The above shows that IsDge10 can effectively edit endogenous sites in the rice genome.

[0362] Example 3 Targeted editing of rice endogenous genes based on the IsAam1 system

[0363] 1. Design of reRNA as a guide for targeted editing of rice endogenous genome

[0364] To test the editing efficiency of the constructed IsAam1 (Seq ID No. 6) system in plant genomes, the rice genome was scanned to identify six spacer sites with TAMs of TTTAA (see Table 3) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 3 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0365] Table 3 Genome editing reRNA design sites and sequences

[0366]

[0367] 2. Construction of IsAam1+reRNA recombinant expression vector

[0368] To construct an expression vector based on the IsAam1 backbone vector, reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, and reRNA06-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The IsAam1 plant genome-directed editing backbone vector, the sticky-end insert, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction products were then transformed into Escherichia coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and finally the recombinant expression vectors IsAam1-reRNA01, IsAam1-reRNA02, IsAam1-reRNA03, IsAam1-reRNA04, IsAam1-reRNA05 and IsAam1-reRNA06 were obtained through sequencing verification.

[0369] 3. Rice protoplast transformation of IsAam1 recombinant expression vector

[0370] The specific method for rice protoplast transformation is the same as that in Example 2.

[0371] 4. Targeted Editing Result Detection

[0372] The detection and analysis methods for genomic NHEJ editing events were as follows: After rice protoplast transformation, the cells were cultured in the dark at 32°C for 48 hours, and the transformed cells were harvested. Genomic DNA from the rice protoplasts was extracted using the CTAB method, and PCR amplification and NGS validation analysis were performed using this DNA as a template. The primers used are shown in Table 4. The analysis and data calculation methods were consistent with those in Example 2.

[0373] Table 4 Genome editing PCR primer sequence information

[0374]

[0375]

[0376] Depend on Figure 2 B shows that the compact IsAam1 plant genome editing tool constructed based on the present invention can edit two of the six sites tested in rice, with an editing efficiency of approximately 2.5% to 3.6%, indicating that IsAam1 can edit endogenous sites in the rice genome.

[0377] Example 4 Targeted editing of rice endogenous genes based on the enIscB system

[0378] 1. Design of reRNA as a guide for targeted editing of rice endogenous genome

[0379] To test the editing efficiency of the constructed enIscB (Seq ID No. 7) system in plant genomes, the rice genome was scanned to identify six spacer sites with TAMs of either TTGGAA or CAGGAA (see Table 5) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 5 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0380] Table 5 Genome editing reRNA design sites and sequences

[0381]

[0382] 2. Construction of enIscB+reRNA recombinant expression vector

[0383] Construction of an expression vector based on the enIscB backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, and reRNA06-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The enIscB plant genome-directed editing backbone vector, the sticky-end insert, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction product was then transformed into E. coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and finally the recombinant expression vectors enIscB-reRNA01, enIscB-reRNA02, enIscB-reRNA03, enIscB-reRNA04, enIscB-reRNA05 and enIscB-reRNA06 were obtained through sequencing verification.

[0384] 3. Rice protoplast transformation of enIscB recombinant expression vector

[0385] The specific method for rice protoplast transformation is the same as that in Example 2.

[0386] 4. Targeted Editing Result Detection

[0387] The detection and analysis methods for genomic NHEJ editing events were as follows: After rice protoplast transformation, the cells were cultured in the dark at 32°C for 48 hours, and the transformed cells were harvested. Genomic DNA from the rice protoplasts was extracted using the CTAB method and used as a template for PCR amplification and NGS validation analysis. The primers used are shown in Table 6. The analysis and data calculation methods were consistent with those in Example 2.

[0388] Table 6 Genome editing PCR primer sequence information

[0389]

[0390]

[0391] Depend on Figure 2 D shows that the compact enIscB plant genome editing tool constructed based on the present invention can edit 5 of the 6 sites tested in rice, with an editing efficiency of approximately 2.1% to 6.1%. This shows that enIscB can edit endogenous sites in the rice genome.

[0392] Example 5 Targeted editing of rice endogenous genes based on the SpuFz system

[0393] 1. Design of reRNA as a guide for targeted editing of rice endogenous genome

[0394] To test the editing efficiency of the constructed SpuFz (Seq ID No. 8) system in plant genomes, the rice genome was scanned to identify six spacer sites with TAMs of CATA (see Table 7) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 7 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0395] Table 7 Genome editing reRNA design sites and sequences

[0396]

[0397] 2. Construction of SpuFz+reRNA recombinant expression vector

[0398] Construction of an expression vector based on the SpuFz backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, and reRNA06-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The SpuFz plant genome-directed editing backbone vector, the sticky-end insert, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction product was then transformed into Escherichia coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and finally the recombinant expression vectors SpuFz-reRNA01, SpuFz-reRNA02, SpuFz-reRNA03, SpuFz-reRNA04, SpuFz-reRNA05 and SpuFz-reRNA06 were obtained through sequencing verification.

[0399] 3. Rice protoplast transformation of SpuFz recombinant expression vector

[0400] The specific method for rice protoplast transformation is the same as that in Example 2.

[0401] 4. Targeted Editing Result Detection

[0402] The detection and analysis methods for genomic NHEJ editing events were as follows: After rice protoplast transformation, the cells were cultured in the dark at 32°C for 48 hours, and the transformed cells were harvested. Genomic DNA from the rice protoplasts was extracted using the CTAB method and used as a template for PCR amplification and NGS validation analysis. The primers used are shown in Table 8. The analysis and data calculation methods were consistent with those in Example 2.

[0403] Table 8 Genome editing PCR primer sequence information

[0404] Primer name Primer sequences use SpuFz-site01-F ATCACGtatgtgccagttccacgagc Site01 NGS upstream primer SpuFz-site01-R CAAAAGcacctgcaccaataattgatgga Site01 NGS downstream primers SpuFz-site02-F AGTCAAgttccatgggccctcaaaga Site02 NGS upstream primer SpuFz-site02-R CACGATcacaccaggcgtatgttcct Site02 NGS downstream primers SpuFz-site03-F ATCACGgcatggcgcatgttttcctt Site03 NGS upstream primer SpuFz-site03-R TCCCGAtccagtcctctgaagaaaggt Site03 NGS downstream primers SpuFz-site04-F CCGTCCcgacatcataccaaatgtgccc Site04 NGS upstream primer SpuFz-site04-R ACTGATacagctcttggatcccatca Site04 NGS downstream primers SpuFz-site05-F CAGATCagggatggagggagaatagtt Site05 NGS upstream primer SpuFz-site05-R ATGAGCccttcagcttgagcctacca Site05 NGS downstream primers SpuFz-site06-F CGTACGgaccagcacttcgatagcct Site06 NGS upstream primer SpuFz-site06-R TACAGCcacaagttatctgacagaggcct Site06 NGS downstream primers

[0405] Depend on Figure 2 C shows that: based on the compact SpuFz plant genome editing tool constructed according to the present invention, no editing was detected in the six sites tested in rice.

[0406] Example 6 Construction of a larch genome-directed modification editing system

[0407] 1. Construction of IsDge10 larch genome-directed modification backbone vector

[0408] The promoter unit was optimized, and different modular assembly methods were used to construct the larch IsDge10 gene editing backbone vector. First, module 1 (MOD_A) was designed, which was an IsDge10 nuclease protein expression unit (ZmUbi1-NLS-IsDge10-NLS-AtHSP) containing NLS coding sequences at the 5' and 3' ends. IsDge10 was codon-optimized and then delivered to a biotechnology company for synthesis of NLS-IsDge10-NLS (Seq ID No. 5, where bp 46 to 1218 are IsDge10). Module 1 was then assembled using the GoldenGate method from the NLS-IsDge10-NLS unit, the constitutive promoter LarPE004 (Seq ID No. 4, ZL202010619161.4) element from larch, and the Arabidopsis thaliana AtHSP terminator element.

[0409] Secondly, module 2 (MOD_B) was designed, which was the reRNA transcription expression cloning unit OsU6-IsDge10 scaffold-lacZα-poly T. The rice OsU6 promoter and IsDge10 scaffold-lacZα-poly T were assembled into module 2 by the Gibson Assembly method.

[0410] Finally, module 1 and module 2 were assembled into pTrans_210d by the Golden Gate method. After transformation into competent bacteria, monoclonal PCR verification, extraction of recombinant plasmids, and Sanger sequencing verification, the larch IsDge10 gene editing backbone vector ( Figure 4 ).

[0411] 2. Editing efficiency test based on the IsDge10 larch genome editing system

[0412] To test the editing efficiency of the constructed IsDge10 larch genome editing system in plant genomes, the rice genome was scanned to identify two spacer sites with TAMs corresponding to TTAT (see Table 9) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 1 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0413] Table 9 Genome editing reRNA design sites and sequences

[0414]

[0415] 3. Construction of IsDge10+reRNA recombinant expression vector

[0416] To construct an expression vector based on the larch IsDge10 backbone vector, reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, reRNA04-F / R, reRNA05-F / R, and reRNA06-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The IsDge10 plant genome-directed editing backbone vector, the sticky-end insert, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction products were then transformed into Escherichia coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and the IsDge10-reRNA01 and IsDge10-reRNA02 recombinant expression vectors were finally obtained through sequencing verification.

[0417] 3. Rice protoplast transformation of IsDge10 recombinant expression vector

[0418] The specific process of protoplast isolation, transformation and DNA extraction of IsDge10 recombinant expression vector in rice Nipponbare refers to the experimental method disclosed in the literature (Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF, Zhang Y. 2006. A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant, 9(7): 1088-1091.).

[0419] 4. Targeted Editing Result Detection

[0420] The detection and analysis methods of genomic NHEJ editing events are as follows: After rice protoplast transformation, the cells were cultured in the dark at 32 ° C for 48 hours, the transformed cells were collected, and the genomic DNA of the rice protoplasts was extracted by CTAB method. The DNA was used as a template for PCR amplification and NGS verification analysis. The primers used are shown in Table 10. The specific experimental method flow refers to the experimental method disclosed in the reference (Zhong Z, Zhang Y, You Q, Tang X, Ren Q, Liu S, Yang L, Wang Y, Liu X, Liu B, Zhang T, Zheng X, Le Y, Zhang Y, Qi Y. 2018. Molecular Plant. Plant genome editing using FnCpf1 and LbCpf1 nucleases at redefined and altered PAM sites. Mol Plant, 11: 999-1002). The PCR product was gel purified and then sequenced by Novogene (Tianjin, China) using the NovaSeq 6000-PE150 sequencing strategy. The data were analyzed using CRISPRMatch software (You, Q., Zhong, Z., Ren, Q., Hassan, F., Zhang, Y., and Zhang, T. 2018. CRISPRMatch: an automatic calculation and visualization tool for high-throughput CRISPR genome-editing data analysis. Int. J. Biol. Sci. 14: 858–862.) to calculate the mutation efficiency.

[0421] Table 10 Genome editing PCR primer sequence information

[0422] Primer name Primer sequences use IsDge10-site01-F atcagctgacgcggttaatg Site01 NGS upstream primer IsDge10-site01-R ccaggggaaagaaagcttgt Site01 NGS downstream primers IsDge10-site02-F gaggcagggaaacgttggta Site02 NGS upstream primer IsDge10-site02-R agcatcaccaagatacagagca Site02 NGS downstream primers

[0423] Based on the compact IsDge10 larch genome editing tool constructed by the present invention, IsDge10 can edit the two sites detected in rice, with an editing efficiency of about 6% to 15%. The shearing characteristic analysis showed that the system can recognize the TAM (5'-TTAT-3') sequence, causing the deletion of the fragment 7 to 12 bp downstream, with the majority of deletions being 6 to 10 bp. The above shows that the larch IsDge10 editing system can effectively edit endogenous sites in the rice genome ( Figure 5 ).

[0424] Example 7 Targeted editing of endogenous genes in larch based on the IsDgel0 genome editing system

[0425] 1. Design of reRNA as a guide for targeted editing of the endogenous genome of larch

[0426] To test the editing efficiency of the constructed IsDge10 larch genome editing system in plant genomes, the larch genome was scanned to identify four spacer sites with TAMs of TTAT (see Table 11) for reRNA design. Based on the designed reRNA site nucleic acid sequences, corresponding forward and reverse oligonucleotide chains were synthesized. The specific sequences are shown in Table 9 (the first four bases at the 5' end represent the cohesive ends complementary to the backbone vector; the subsequent sequence is the designed specific guide crRNA site).

[0427] Table 11 Genome editing reRNA design sites and sequences

[0428]

[0429]

[0430] 2. Construction of IsDge10+reRNA recombinant expression vector

[0431] Construction of an expression vector based on the IsDge10 larch genome editing backbone vector: reRNA01-F / R, reRNA02-F / R, reRNA03-F / R, and reRNA04-F / R were mixed in equal proportions and reacted at 95°C for 10 minutes. The mixture was then cooled and annealed to form double-stranded DNA with sticky ends, which served as inserts for constructing the recombinant vector. The IsDge10 larch genome editing backbone vector, the sticky-end inserts, BsaI endonuclease, and T4 DNA ligase were added to a 200 μL PCR tube. Enzyme digestion and ligation were performed at 37°C for 5 minutes, 16°C for 10 minutes (15 cycles), 37°C for 10 minutes, 65°C for 10 minutes, and 4°C for 10 minutes. The reaction products were then transformed into Escherichia coli. Positive transformants were identified through kanamycin resistance screening, colony PCR and enzyme digestion, and finally the recombinant expression vectors IsDge10-reRNA01, IsDge10-reRNA02, IsDge10-reRNA03 and IsDge10-reRNA04 were obtained through sequencing verification.

[0432] 3. Transformation of larch protoplasts with IsDge10 recombinant expression vector

[0433] Through the preparation of larch protoplasts and transient transformation system, the endogenous gene targeting site-directed mutation vectors of different larch gene directed editing systems were introduced into larch protoplast cells. After culturing for 48 hours, the protoplast genomic DNA was extracted, and high-throughput sequencing primers were designed to amplify different target gene sites.

[0434] 4. Targeted Editing Result Detection

[0435] The detection and analysis methods for genomic NHEJ editing events are as follows: After transformation, larch protoplasts were cultured in the dark for 48 hours, the transformed cells were harvested, and genomic DNA from the larch protoplasts was extracted using the CTAB method. This DNA was used as a template for PCR amplification and NGS validation analysis. The primers used are shown in Table 12. The analysis and data calculation methods were consistent with those in Example 2.

[0436] Table 12 Genome editing PCR primer sequence information

[0437] Primer name Primer sequences use LarMYB06-F GCATGTGTAAACAGATTAGATC LarMYB06 NGS upstream primer LarMYB06-R GATATGTAAGACAAAAAAAAGAAGA LarMYB06 NGS downstream primers LarCKX01-F AGAGCATTCTAGCGCAGAATGA LarCKX01 NGS upstream primer LarCKX01-R CTCTGTCCTGGAGCAAGGATAG LarCKX01 NGS downstream primers Lar_miR1314-F GAATTCCAAGGCTGAATCTG Lar_miR1314 NGS upstream primer Lar_miR1314-R AGGTCGAGATGGAATCAAGT Lar_miR1314 NGS downstream primers

[0438] Based on the compact IsDge10 plant genome editing tool constructed by the present invention, IsDge10 can effectively edit the Lar_miR1314 site detected in larch with an editing efficiency of 1.4%. This shows that IsDge10 can effectively edit endogenous sites in the larch genome ( Figure 6 ).

Claims

1. A coding sequence for a transposon nuclease suitable for plant genome editing, characterized in that: is the coding sequence of IsDge10, IsAam1 or enIscB; the coding sequence of IsDge10 is shown in Seq ID No.13; the coding sequence of IsAam1 is shown in Seq ID No.14; and the coding sequence of enIscB is shown in Seq ID No.

15.

2. Use of the coding sequence of the transposon nuclease according to claim 1 in constructing a plant genome editing system.

3. A plant genome editing system based on transposon nucleases, characterized by: The invention comprises a transposon nuclease protein expression unit, the structure of which is a promoter-transposon nuclease-terminator.

4. The plant genome editing system according to claim 3, characterized in that: The transposon nuclease is a TnpB transposon nuclease or an IscB transposon nuclease; Preferably, the TnpB-type transposon nuclease is IsDge10 or IsAam1; or, the IscB-type transposon nuclease is enIscB.

5. The plant genome editing system according to claim 4, characterized in that: The coding sequence of IsDge10 is shown as Seq ID No. 13; alternatively, the coding sequence of IsAam1 is shown as Seq ID No. 14; alternatively, the coding sequence of enIscB is shown as Seq ID No.

15.

6. The plant genome editing system according to claim 3, characterized in that: In the transposon nuclease protein expression unit, the 5' or / and 3' end of the transposon nuclease is further fused with an NLS.

7. The plant genome editing system according to claim 3, characterized in that: The plant genome editing system also includes a reRNA transcription expression cloning unit, the structure of which is promoter-reRNA scaffold-terminator; Preferably, the nucleotide sequence of the reRNAscaffold is shown as bp 12754 to 12936 of Seq ID No. 1, Seq ID No. 12, or Seq ID No. 2; Preferably, when a TnpB-type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is as shown in 12754 to 12936 bp of Seq ID No. 1 or Seq ID No. 12; when an IscB-type transposon nuclease is used, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No. 2; More preferably, when the transposon nuclease used is IsDge10, the nucleotide sequence of the reRNAscaffold is as shown in 12754-12936 bp of Seq ID No. 1 or Seq ID No. 12; when the transposon nuclease used is IsAam1, the nucleotide sequence of the reRNAscaffold is as shown in 12754-12936 bp of Seq ID No. 1 or Seq ID No. 12; when the transposon nuclease used is enIscB, the nucleotide sequence of the reRNA scaffold is as shown in Seq ID No.

2.

8. The plant genome editing system according to claim 13, wherein: The reRNA transcription expression cloning unit, the 5' end or 3' end of the reRNA scaffold is further fused with lacZα; Preferably, both ends of lacZα are provided with enzyme cleavage sites; Preferably, the restriction enzyme cleavage site is BsaI.

9. The plant genome editing system according to any one of claims 3 to 8, characterized in that: The promoter is a constitutive promoter, an inducible promoter or a tissue-specific promoter; or, the terminator is pinII, AtHSP, NOS or T35S; Preferably, the promoter is rice OsU6 promoter, maize ZmUbi1 promoter, Arabidopsis AtU6 promoter, larch LarPE004 promoter or P35S; Preferably, the nucleotide sequence of the larch LarPE004 promoter is shown in Seq ID No.

4.

10. The plant genome editing system according to any one of claims 3 to 9, characterized in that: In the above-mentioned plant genome editing system, the plant is a monocot or a gymnosperm; Preferably, the monocotyledonous plant is a grass plant; or, the gymnosperm is larch, masson pine, Chinese pine or elliott pine; preferably, the grass plant is rice, corn, sorghum, sugarcane, wheat or barley.

11. A vector, cell or host expressing the coding sequence of the transposon nuclease according to claim 1.

12. A vector, cell or host containing the plant genome editing system according to any one of claims 3 to 10.

13. Use of the vector, cell or host according to claim 11 or 12 in plant genome editing.

14. The use according to claim 13, characterized in that: The plant is a monocotyledon or a gymnosperm; Preferably, the monocotyledonous plant is a grass plant; or the gymnosperm is larch, masson pine, Chinese pine or elliott pine; Preferably, the grass plant is rice, corn, sorghum, sugarcane, wheat or barley.

Images