Method for overexpressing recombinant plant lactobacillus gapdh and application thereof
By constructing a recombinant Lactobacillus plantarum overexpressing GAPDH, and utilizing GAPDH as a part-time adhesion protein to enhance the adhesion ability of bacteria to intestinal epithelial cells, the problem of insufficient adhesion and colonization ability of probiotics in the intestine of turbot was solved, and faster and more stable biofilm formation and probiotic function were achieved.
Patent Information
- Application Number
- CN202511346608.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-19
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2045-09-19
AI Technical Summary
Existing technologies are insufficient to effectively improve the adhesion and colonization ability of probiotics in the intestines of turbot, thus affecting their application in aquaculture.
By constructing a recombinant Lactobacillus plantarum overexpressing GAPDH, the recombinant strain was obtained by using GAPDH as a part-time adhesion protein to enhance the adhesion ability of the bacterial cells to intestinal epithelial cells. The specific steps include designing specific primers, inserting a constitutive shuttle expression vector, and electroporation transformation.
It enhanced the adhesion and colonization ability of recombinant plant lactobacillus in the intestines of turbot and the rate of biofilm formation, providing a basis for the stable colonization of probiotics in the intestines and enhancing their probiotic function.
Smart Images

Figure CN120818543B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for obtaining highly adhesive plant lactobacilli through recombination, specifically to a method for overexpressing GAPDH in recombinant plant lactobacilli and its application, belonging to the field of molecular biology technology. Background Technology
[0002] Bacterial diseases are a key bottleneck restricting the sustainable development of turbot farming. Probiotics can control bacterial diseases by regulating gut microbiota homeostasis and host immune responses, but their long-term colonization in the gut after discontinuation remains a core challenge for their efficient application. As an important aquatic probiotic, *Lactobacillus plantarum*'s adhesion and colonization ability is crucial for its stable colonization in the gut and a prerequisite for its effectiveness. Therefore, improving *Lactobacillus plantarum*'s adhesion and colonization ability in the turbot gut is of great significance for fully realizing its probiotic functions.
[0003] Biofilms are bacterial aggregates with specific spatial structures formed by microorganisms encapsulating their cells with extracellular polymers during adhesion to a solid surface. Microorganisms in nature universally possess the ability to form biofilms. This structure allows microorganisms to better survive and reproduce in complex and ever-changing environments. Biofilm formation enhances the adhesion of probiotics to intestinal epithelial cells. This adhesion helps probiotics colonize the gut, forming a stable gut microbiota structure. By tightly binding to intestinal epithelial cells, probiotics can compete for nutrients and adhesion sites, inhibiting the growth of harmful bacteria and maintaining the balance of the intestinal microecology.
[0004] Currently, the methods for obtaining highly adhesive probiotics are to isolate and screen them from nature, optimize culture conditions, use biomaterials for encapsulation, prebiotic synergy, and stress pretreatment to enhance their adhesive properties. However, no effective methods for improving the adhesion and colonization ability of probiotics have been found in aquaculture. Summary of the Invention
[0005] The purpose of this invention is to provide a method for overexpressing GAPDH in recombinant Lactobacillus plantarum, and the resulting recombinant Lactobacillus plantarum has a stronger adhesion and colonization ability than ordinary Lactobacillus plantarum.
[0006] Another objective of this invention is to provide an application of the recombinant lactobacillus expressed above via GAPDH overexpression, which enhances the adhesion and colonization of probiotics in the gut of turbot, providing an important tool for further understanding the adhesion and colonization mechanism of plant lactobacillus in the gut of turbot.
[0007] A method for overexpressing GAPDH in recombinant Lactobacillus plantarum, characterized by comprising the following steps:
[0008] Step 1) First, analyze and predict the structure and basic characteristics of the GAPDH protein from Lactobacillus plantarum. Based on the GAPDH gene sequence, design specific primers containing the FLAG tag to amplify the gene fragment containing the FLAG tag.
[0009] Step 2) Insert the FLAG-GAPDH gene fragment into the constitutive shuttle expression vector pMG-36e to construct the in vitro recombinant expression plasmid FLAG-GAPDH-pMG36e;
[0010] Step 3) Preparation E. coli MC1061F competent cells were transfected with the recombinant expression plasmid using a heat shock transformation method. E. coli MC1061F competent cells expanded extensively afterward;
[0011] Step 4) Extract the above E. coli The recombinant expression plasmid amplified in MC1061F was transformed into wild-type competent Lactobacillus plantarum by electroporation to prepare recombinant Lactobacillus plantarum overexpressing GAPDH.
[0012] The specific primers used in step 1) are as follows:
[0013] Table 1. Specific primers containing the FLAG tag
[0014] Primer name Primer sequence (5'-3') Enzyme cleavage sites GAPDH-F <![CDATA[ GAGCTC GCATGTCTGTAAAAATTGGTATTAATGGTTTCGGACGT]]> I GAPDH-R <![CDATA[ AAGCTT A CTTGTCATCGTCGTCCTTGTAATC AGTGGCGAACTTCAAT]]> Ⅲ .
[0015] The pMG36e is a constitutive plasmid that can serve as a shuttle vector in Lactobacillus-Escherichia coli. E. coli It replicates autonomously in MC1061F and Lactobacillus.
[0016] Step 3) describes the method for preparing competent cells as follows:
[0017] LP-PO23 stored at -80 °C was inoculated into MRS liquid medium and incubated overnight. 90 mL of MRS medium was taken, and 10 mL of 10% glycine stock solution was added. Fresh bacterial culture was then transferred to the medium until the OD600 reached 0.25. The culture was incubated at 37 °C for 2–4 h until the OD600 reached 0.6. The cells were centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded. The cells were gently resuspended in 50 mL of 1 mM MgCl2 and centrifuged at 5000 rpm for 5 min at 4 °C. 50 mL of 30% PEG1500 was added to the precipitate, and the cells were gently resuspended by pipetting and centrifugation. The cells were resuspended in 1 mL of 30% PEG1500, aliquoted into centrifuge tubes (40 μL each), and stored at -80 °C for later use.
[0018] Step 4) The method for electroporation transformation of the reexpression plasmid into wild-type Lactobacillus plantarum is as follows:
[0019] Take 40 μL of LP-PO23 competent cells and incubate on ice for 5 min; add 2 μL of recombinant plasmid DNA (DNA volume ≤ 1 / 20 of the competent cell volume) and mix gently; transfer the mixture to an electroporation cuvette with a 2 mm electrode spacing (pre-cooled to -20 °C), avoiding air bubbles and ensuring the cell suspension is evenly distributed at the bottom of the cuvette; place the cuvette in an electroporator and set the voltage to 1.5 kV for electroporation; immediately after the electroporation pulse ends, add 1 mL of MRSSM and transfer the bacterial culture to a centrifuge tube; anaerobic culture at 37 °C for 2 h; centrifuge the bacterial culture and spread it on an MRS plate containing 100 μg / mL EM; invert the plate and place it in an anaerobic culture bag, and incubate at 37 °C for 3 days; pick a single colony and incubate it in 100 μg / mL EMMRS medium for 12 h. The white precipitate at the bottom was collected by centrifugation to extract the plasmid. The extracted plasmid was used as a template for PCR. After agarose gel electrophoresis, the PCR products of positive bacteria were sequenced. The recombinant plasmid was double-digested to verify its correctness.
[0020] The application of the recombinant plant lactobacillus obtained by the method is characterized in that the recombinant plant lactobacillus overexpressing GAPDH is used to improve the rate and ability of biofilm formation.
[0021] The application of the recombinant plant lactobacillus obtained by the method is characterized by the application of the recombinant plant lactobacillus overexpressing GAPDH in enhancing intestinal adhesion and colonization ability.
[0022] The adhesion and colonization of Lactobacillus in the gut is fundamental to its probiotic effects. We discovered that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) exists on the cell surface of *Lactobacillus plantarum*, acting as a part-time adhesion protein that effectively enhances probiotic adhesion. GAPDH possesses the ability to bind to host epithelial mucins or fibronectin and plasminogen in the cytoplasm, thus becoming an essential mediator of host-microbe interactions. In *Lactobacillus*, GAPDH, as a part-time adhesin, exists freely on the cell wall surface and can mediate the adhesion of bacterial cells to intestinal mucins, cardiomyocytes, and Caco-2 cells.
[0023] GAPDH is a cytoplasmic protein involved in glycolysis, and also has many other physiological functions. After being secreted, GAPDH can reattach itself to the intestinal epithelial cell wall as a non-anchored protein, and plays a part-time protein role in the colonization of the intestinal mucosa by lactic acid bacteria. GAPDH exists as a non-anchored molecule on the surface of *Lactobacillus plantarum* and *Lactobacillus curvatureii*, and participates in the colonization of probiotics in the gut through its non-glycolytic part-time protein role.
[0024] This invention constructed a *Lactobacillus plantarum* strain overexpressing GAPDH. Using LP-PO23 bacterial genomic DNA as a template, the FLAG-GAPDH gene was amplified using specific expression primers. After enzyme digestion, the gene was ligated into the constitutive expression vector pMG36e. The recombinant plasmid was transformed into LP-PO23 cells using a high-voltage pulsed electroporation method. Positive transformants were screened using erythromycin-resistant MRS solid medium, and the plasmids from positive transformants were extracted for sequencing. Furthermore, the successful transformation of GAPDH was verified by Western blotting and immunofluorescence experiments. Experiments comparing biofilm formation and adhesion to turbot intestinal epithelial cells confirmed that overexpression of GAPDH enhances the adhesion and colonization ability of *Lactobacillus plantarum* LP-PO23. Attached Figure Description
[0025] Figure 1 Agarose gel electrophoresis image of PCR-amplified GAPDH gene fragment;
[0026] Where M: Marker; 1: GAPDH gene.
[0027] Figure 2 PCR results of pMG36e-GAPDH colonies;
[0028] Where M: Marker; 1: PCR test result.
[0029] Figure 3 Western blotting results of recombinant plasmid expression in Escherichia coli;
[0030] Wherein, M: Marker; 1: MC1061F incubated mouse anti-Flag monoclonal antibody (negative control); 2: GAPDH-MC1061F incubated mouse anti-Flag monoclonal antibody; 3: MC1061F incubated mouse anti-GAPDH polyclonal antibody (negative control); 4: GAPDH-MC1061F incubated mouse anti-GADPH polyclonal antibody.
[0031] Figure 4 Immunofluorescence detection of pMG-36e-GAPDH expression in LP-PO23 (scale bar = 10 μm).
[0032] Figure 5Western blotting was used to detect pMG-36e-GAPDH expression.
[0033] Wherein, M: Marker; 1: LP-PO23-incubated mouse anti-GAPDH polyclonal antibody; 2: LP-pMG-36e-incubated mouse anti-GAPDH polyclonal antibody; 3: LP-GAPDH-incubated mouse anti-GAPDH polyclonal antibody; 4: LP-PO23-incubated mouse anti-Flag monoclonal antibody; 5: LP-pMG-36e-incubated mouse anti-Flag monoclonal antibody; 6: LP-GAPDH-incubated mouse anti-Flag monoclonal antibody.
[0034] Figure 6 : Biofilm formation curve.
[0035] Figure 7 Differences in adhesion of LP-PO23 and GAPDH-LP-PO23 to turbot intestinal epithelial cells (scale bar = 5 μm);
[0036] Among them, A: wild-type strain LP-PO23; B: recombinant strain GAPDH-LP-PO23. Detailed Implementation
[0037] This invention uses bioinformatics software (such as DNAStar and IEDB software) to analyze and predict the structure and basic characteristics of the GAPDH protein from Lactobacillus plantarum.
[0038] Based on the GAPDH gene sequence, specific primers containing the FLAG tag were designed to amplify the FLAG-GAPDH gene.
[0039] The GAPDH gene fragment was inserted into the constitutive expression vector pMG36e, successfully constructing the in vitro recombinant expression plasmid pMG36e-GAPDH. The plasmid map of pMG36e-GAPDH was plotted using Snapgene software.
[0040] The recombinant plasmid pMG36e-GAPDH was transformed into competent E. coli cells by heat shock: after culture, the recombinant plasmid pMG36e-GAPDH was extracted and transformed into competent DH5α cells of E. coli by heat shock, and then electroporated into competent LP-PO23 cells.
[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.
[0042] Example
[0043] 1: Method for overexpressing recombinant Lactobacillus plantarum with GAPDH
[0044] I. Obtaining the GAPDH gene
[0045] The GAPDH gene sequence of Lactobacillus plantarum was obtained from the NCBI database, and primers containing the FLAG-tag gene sequence were designed.
[0046] After centrifuging and collecting the bacterial cells from the *Lactobacillus plantarum* culture that had reached the logarithmic growth phase, genomic DNA was extracted and amplified to obtain the GAPDH gene fragment containing the FLAG-tag; the agarose gel electrophoresis image of the PCR amplified GAPDH gene fragment is shown below. Figure 1 As shown.
[0047] II. Construction of pMG36e-GAPDH recombinant plasmid
[0048] (1) Select appropriate restriction endonucleases, establish an enzyme digestion system, and digest the PCR product of the GAPDH target gene and the pMG-36e empty plasmid using restriction endonucleases. Sac I and Hind III. Simultaneously perform enzyme digestion to recover the target fragment;
[0049] (2) Sca I / Hind The GAPDH gene fragment purified by double enzyme digestion (III) was mixed with the pMG-36e vector, T4 DNA ligase was added, and ligation was performed overnight at 16°C in a metal bath to obtain the recombinant plasmid pMG-36e-GAPDH. The correctness of the ligation was verified by colony PCR and restriction enzyme digestion.
[0050] (3) The recombinant plasmid pMG-36e-GAPDH was transformed into Escherichia coli DH5α competent cells by heat shock: First, the DH5α competent cells were placed in an ice bath to thaw, then the recombinant plasmid ligation product was added and gently mixed; the bacterial culture was evenly spread on the surface of an MRS solid medium plate containing erythromycin, the plate was inverted, and incubated overnight in a 37°C incubator. After single colony formation, a single colony was picked and inoculated into 5 mL of MRS liquid medium (containing erythromycin); the plasmid was extracted using a plasmid miniprep kit to construct the recombinant plasmid pMG36e-GAPDH. The PCR results of pMG36e-GAPDH colonies are shown below. Figure 2 As shown.
[0051] III. Recombinant plasmids in E. coli Expression in MC1061F
[0052] preparation E. coli Preparation method of MC1061F competent cells:
[0053] (1) Inoculate LP-PO23 stored at -80 °C into MRS liquid medium and rejuvenate overnight;
[0054] (2) Take 90 mL of MRS medium, add 10 mL of 10% glycine stock solution, and transfer the fresh bacterial culture to the medium until the OD600 is about 0.25;
[0055] (3) Incubate at 37 °C for 2-4 h until the OD600 of the bacterial culture is about 0.6;
[0056] (4) Centrifuge at 5000 rpm and 4 °C for 5 min, discard the supernatant and collect the bacterial cells;
[0057] (5) Gently resuspend the bacterial cells in 50 mL of 1 mM MgCl2 (pre-cooled at 4 °C), centrifuge at 5000 rpm and 4 °C for 5 min to collect the bacterial cells;
[0058] (6) Add 50 mL of 30% PEG1500 (pre-cooled at 4 °C) to the precipitate, gently resuspend by pipetting, and centrifuge;
[0059] (7) The bacterial body was resuspended in 1 mL of 30% PEG1500, and 40 μL was dispensed into centrifuge tubes (pre-cooled at -20 °C) and stored at -80 °C for later use.
[0060] The constructed pMG36e-GAPDH recombinant plasmid was transformed using thermal excitation. E. coli After the recombinant plasmid induced expression of MC1061F was completed, a positive expression strain was selected and named GAPDH-MC1061F. SDS-PAGE and Western spectroscopy analyses revealed that the recombinant plasmid... E. coli Successful expression in MC1061F. Western blotting results of recombinant plasmid expression in *E. coli* are shown below. Figure 3 As shown.
[0061] IV. Expression of pMG36e-GAPDH in LP-PO23
[0062] Recombinant plasmid pMG36e-GAPDH was electroporated into LP-PO23 cells, and protein expression was verified by SDS-PAGE electrophoresis and Western blotting. Immunofluorescence was used to detect pMG-36e-GAPDH expression in LP-PO23 cells. Figure 4 As shown, Western blotting detected pMG-36e-GAPDH expression as follows: Figure 5 As shown.
[0063] The method for electroporation transformation of recombinant plasmids into wild-type Lactobacillus plantarum is as follows:
[0064] (1) Take 40 μL of LP-PO23 competent cells and incubate on ice for 5 min;
[0065] (2) Add 2 μL of recombinant plasmid DNA (DNA volume ≤ 1 / 20 of competent cell volume) and mix gently;
[0066] (3) Transfer the mixed solution to an electroporation cup with a 2 mm electrode spacing (pre-cooled to -20 °C) to avoid air bubbles and to ensure that the cell suspension is evenly distributed at the bottom of the electroporation cup;
[0067] (4) Place the electric shock cup into the electric converter and set the voltage to 1.5 kV for electric shock;
[0068] (5) Immediately after the electrical pulse ends, add 1 mL of MRSSM and transfer the bacterial culture to a centrifuge tube;
[0069] (6) Anaerobic culture at 37 °C for 2 h;
[0070] (7) After centrifuging the bacterial culture, spread it on an MRS plate containing 100 μg / mL EM;
[0071] (8) Place the plate upside down in an anaerobic culture bag and incubate at 37 °C for 3 days;
[0072] (9) Pick a single colony and incubate it in 100 μg / mL EM MRS medium for 12 h;
[0073] (10) Centrifuge to collect the white precipitate at the bottom and extract plasmid. Use the extracted plasmid as a template for PCR. After agarose gel electrophoresis, sequence the PCR products of positive bacteria.
[0074] (11) Verify the correctness by double enzyme digestion of the recombinant plasmid.
[0075] 2: Detection of GAPDH-LP-PO23 biofilm formation in this invention
[0076] (1) Inoculate LP-PO23 and GAPDH-LP-PO23 strains into MRS medium and culture overnight;
[0077] (2) Dilute the cultured bacterial solution to OD. 600 =1;
[0078] (3) Take a 96-well plate and accurately add 200 μL of diluted LP-PO23 or GAPDH-LP-PO23 bacterial solution to each well. Then, place the culture plate in a 37℃ incubator and incubate for 6 h, 12 h, 24 h, 48 h, and 72 h respectively.
[0079] (4) After incubation for different periods, the supernatant in the culture plate was aspirated, washed twice with 200 μL PBS, and dried;
[0080] (5) Add 200 μL of methanol to each well for 10 min to fix the methanol. After removing the methanol, wash with 200 μL of PBS and air dry.
[0081] (6) Add 100 μL of 0.1% crystal violet staining solution to each well and let it stand for 10 min to stain;
[0082] (7) After staining, wash three times with PBS to remove excess stain;
[0083] (8) Add 100 μL of acetic acid solution to each well to dissolve and mix thoroughly by pipetting. Use an ELISA reader to measure the OD value of the sample. 600 The absorbance value at that location.
[0084] (9) The results showed that the amount of biofilm formed by both strains gradually increased with increasing incubation time. Compared with the wild-type strain, the recombinant strain exhibited faster and more stable biofilm formation. The biofilm formation curves are shown below. Figure 6 As shown.
[0085] 3: The adhesion of GAPDH-LP-PO23 to the intestinal epithelial cells of turbot in this invention
[0086] 1. Extraction of intestinal epithelial cells from turbot:
[0087] (1) Disinfect the surface of the fish with 75% ethanol and dissect the fish;
[0088] (2) Remove the intestine, remove the mesentery and place it in sterile D-Hanks solution to wash away the surface mucus;
[0089] (3) Gently flush the intestines with digestive A solution to remove intestinal contents;
[0090] (4) Slowly inject digestive solution B into the intestinal lumen, seal and fix both ends with sterile swallowtail clips, place on a horizontal shaker and incubate for 10 min, and drain digestive solution B after incubation;
[0091] (5) Inject the digestive C solution into the intestine, place it on a shaker and incubate for 2 min, and collect the digestive C solution in a centrifuge tube;
[0092] (6) Repeatedly inject digestive solution C into the intestine, incubate for 4 min, 6 min, 10 min and 15 min in sequence and collect digestive solution C;
[0093] (7) The collected digestion solution C was centrifuged at 300 g for 10 min at 4°C and washed twice with PBS;
[0094] (8) Use a blood cell counting chamber to count the number of extracted epithelial cells.
[0095] 2. In vitro adhesion of lactobacilli to intestinal epithelial cells:
[0096] (1) Adjust the intestinal epithelial cell density to 1×10 8 cells / mL;
[0097] (2) Add 100 μL of cell suspension to the center of a clean glass slide, place the slide in a humidified chamber, and let it stand at room temperature for 30 min to allow the cells to settle fully. Then gently remove the supernatant and air dry the slide.
[0098] (3) Block the cell droplets with 4% BSA in PBS for 2 h and then wash them three times with PBS;
[0099] (4) Add 100 μL of bacterial solution (5×10) dropwise. 8 The cells were incubated with (CFU / mL) at 37°C for 2 h. After incubation, excess liquid on the surface was discarded.
[0100] (5) Add an appropriate amount of PFA to the cell slide, fix the cells for 30 min, wash with PBST 3 times and air dry the slide;
[0101] (6) After Gram staining, the adhesion of wild-type strain LP-PO23 and recombinant strain GAPDH-LP-PO23 to intestinal epithelial cells was observed under a microscope. The results showed that the number of GAPDH-LP-PO23 cells adhering to intestinal epithelial cells was 33.75±5.32, while the number of LP-PO23 cells adhering to turbot intestinal epithelial cells was 23.50±4.65, approximately two-thirds of the number of recombinant strains. The differences in adhesion between LP-PO23 and GAPDH-LP-PO23 to turbot intestinal epithelial cells are as follows: Figure 7 As shown.
Claims
1. A method of overexpressing GAPDH in a recombinant plant Lactobacillus, characterized by Comprising the following steps: Step 1) First, analyze the structure of the predicted Lactobacillus plantarum GAPDH protein and the basic characteristics of the protein, design specific primers containing FLAG tags according to the GAPDH gene sequence, and amplify the gene fragment containing FLAG; Step 2) Insert the FLAG-GAPDH gene fragment into the constitutive shuttle expression vector pMG-36e to construct the in vitro recombinant expression plasmid FLAG-GAPDH-pMG36e; Step 3) Preparation E.coli MC1061F competent cells, the recombinant expression plasmid was transformed into E.coli MC1061F competent cells and then amplified in large quantities; Step 4) extraction of the above E.coli The recombinant expression plasmid amplified in MC1061F was transformed into wild-type competent Lactobacillus plantarum by electroporation to prepare a recombinant Lactobacillus plantarum overexpressing FLAG-GAPDH.
2. The method for overexpressing GAPDH of recombinant Lactobacillus plantarum according to claim 1, wherein the specific primers in step 1) are as follows: Primer name: GAPDH-F, Primer sequence (5'-3'): GAGCTCGCATGTCTGTAAAAATTGGTATTAATGGTTTCGGACGT, Enzymatic cleavage sites: Sac I; Primer name: GAPDH-R, Primer sequence (5'-3'): AAGCTTA CTTGTCATCGTCGTCCTTGTAATC AGTGGCGAACTTCAAT, Enzymatic cleavage sites: Hind III.
3. The recombinant plant lactobacillus method of overexpressing GAPDH of claim 1, wherein Step 3) The plant lactobacillus competent cells are prepared by the following method: LP-PO23 stored at -80 °C was inoculated into MRS liquid medium and rejuvenated overnight; 90 mL of MRS medium was taken and 10 mL of 10% glycine stock solution was added, and the fresh bacterial liquid was transferred into the medium to OD600 0.25; 37 °C static culture for 2-4 h, the OD600 of the bacterial liquid is 0.6; 5000 rpm, 4 °C centrifugation for 5 min, discard the supernatant and collect the bacterial body; the bacterial body was gently resuspended with 50 mL of 1 mM MgCl2, and the bacterial body was collected by centrifugation at 5000 rpm and 4 °C for 5 min; 50 mL of 30% PEG1500 was added to the precipitate, and the bacterial body was resuspended by gently blowing; centrifugation; The bacterial body was resuspended in 1 mL of 30% PEG1500, 40 μL per tube was dispensed into a centrifuge tube, and stored in a -80 °C freezer for standby.
4. The method for overexpressing GAPDH of recombinant Lactobacillus plantarum according to claim 1, wherein the method for electroporating the recombinant expression plasmid into wild-type Lactobacillus plantarum in step 4) is as follows: Take 40 μL of LP-PO23 competent cells, stand on ice for 5 min; add 2 μL of recombinant plasmid DNA, mix gently; transfer the mixed solution to an electric shock cup with a 2 mm electrode spacing, avoid air bubbles, and make the cell suspension evenly distributed at the bottom of the electric shock cup; place the electric shock cup into the electroporation instrument, set the voltage to 1.5 kV for electric shock; after the electric pulse is over, immediately add MRSSM to 1 mL, and transfer the bacterial solution to a centrifuge tube; 37 °C anaerobic culture for 2 h; after centrifugation, spread the bacterial solution on an MRS plate containing 100 μg / mL EM; invert the plate and place it in an anaerobic culture bag, and culture at 37 °C for 3 days; pick a single colony in 100 μg / mL EM MRS medium and culture for 12 h.
Citation Information
Patent Citations
Method for promoting activity enhancement of lactic acid bacteria
CN120350049A