Antitetanus toxin antibodies, process for their preparation and use

Abstract

The present application belongs to the field of immunology and genetic engineering, and particularly relates to an anti-tetanus toxin antibody and a preparation method and application thereof. The antibody or antigen binding fragment thereof can specifically recognize and combine with tetanus toxin, tetanus toxoid and / or tetanus toxin C fragment, and has good affinity therewith. Meanwhile, the antibody has a significant neutralization effect on tetanus toxin. The antibody can be used for preparing a product for diagnosing, preventing and / or treating Clostridium tetani infection or diseases caused by the Clostridium tetani, detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin C fragment in a sample, or screening a drug for preventing and / or treating Clostridium tetani infection or diseases caused by the Clostridium tetani.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of immunology and genetic engineering, and particularly relates to an anti-tetanus toxin antibody and a preparation method and application thereof. BACKGROUND

[0002] Tetanus is a potentially fatal disease, which is a bacterial infection caused by Clostridium tetani. Clostridium tetani widely exists in the natural environment. Clostridium tetani invades the human body through skin or mucosal breaks, breeds in an anaerobic environment, and produces exotoxin, causing an acute and toxic disease characterized by sustained rigidity and convulsive spasm of skeletal muscles throughout the body. Severe patients can develop laryngeal spasm, asphyxia, pulmonary infection, and organ failure. Without medical intervention, the mortality rate of severe patients is close to 100%. Even after active comprehensive treatment, the mortality rate worldwide is still 30% to 50%.

[0003] The passive immunization preparations currently used in clinical practice to prevent and treat tetanus mainly include tetanus antitoxin (TAT), equine tetanus immunoglobulin F(ab')2, and human tetanus immunoglobulin (HTIG). However, the above passive immunization preparations have great defects: due to the different physical conditions of the human body and the different acceptance of TAT from horse serum, many people will have adverse reactions such as allergic reaction, anaphylactic shock, or serum sickness. Therefore, TAT from horse serum is not suitable for all people. HTIG can overcome the adverse reactions of TAT from horse serum in clinical use, but due to the difficulty in obtaining human blood sources, the high price, and the risk of contamination by foreign viruses, the industrialized production and clinical application of HTIG have been greatly limited. There is an urgent need in clinical practice for passive immunization preparations for tetanus that are safer, less expensive, and can be industrially produced. SUMMARY

[0004] The first aspect of the present application aims to provide an anti-tetanus toxin antibody or an antigen-binding fragment thereof.

[0005] The second aspect of the present application aims to provide a biomaterial.

[0006] The third aspect of the present application aims to provide a method for preparing the antibody or antigen-binding fragment thereof of the first aspect of the present application.

[0007] The fourth aspect of the present application aims to provide a conjugate.

[0008] The fifth aspect of the present application aims to provide a pharmaceutical composition.

[0009] The sixth aspect of the present application aims to provide a diagnostic or therapeutic kit.

[0010] The seventh aspect of the present application aims to provide use of the antibody or antigen binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect.

[0011] The eighth aspect of the present application aims to provide a method for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0012] The ninth aspect of the present application aims to provide a method.

[0013] To achieve the above-mentioned object, the technical solution adopted by the present application is:

[0014] The first aspect of the present application provides an anti-tetanus toxin antibody or antigen binding fragment thereof, which comprises:

[0015] a1) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 7; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 8; (Ab141)

[0016] a2) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 15; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 16; (Ab142)

[0017] a3) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 23; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 24; (Ab144)

[0018] a4) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 31; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 32; (Ab147)

[0019] a5) HCDR1, HCDR2, and HCDR3 included in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 39; and / or, LCDR1, LCDR2, and LCDR3 included in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO: 40; (Ab163) or

[0020] a6) HCDR1, HCDR2, and HCDR3 having one or more amino acid substitutions, deletions, or additions compared to the HCDR1, HCDR2, and HCDR3 recited in any one of a1) - a5); and / or, LCDR1, LCDR2, and LCDR3 having one or more amino acid substitutions, deletions, or additions compared to the LCDR1, LCDR2, and LCDR3 recited in any one of a1) - a5).

[0021] In some embodiments, the CDRs are defined according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system.

[0022] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises:

[0023] b1) a VH comprising a HCDR1 of an amino acid sequence set forth in SEQ ID NO: 1, a HCDR2 of an amino acid sequence set forth in SEQ ID NO: 2, and a HCDR3 of an amino acid sequence set forth in SEQ ID NO: 3; and / or, a VL comprising a LCDR1 of an amino acid sequence set forth in SEQ ID NO: 4, a LCDR2 of an amino acid sequence set forth in SEQ ID NO: 5, and a LCDR3 of an amino acid sequence set forth in SEQ ID NO: 6; (Ab141)

[0024] b2) a VH comprising a HCDR1 of an amino acid sequence set forth in SEQ ID NO: 9, a HCDR2 of an amino acid sequence set forth in SEQ ID NO: 10, and a HCDR3 of an amino acid sequence set forth in SEQ ID NO: 11; and / or, a VL comprising a LCDR1 of an amino acid sequence set forth in SEQ ID NO: 12, a LCDR2 of an amino acid sequence set forth in SEQ ID NO: 13, and a LCDR3 of an amino acid sequence set forth in SEQ ID NO: 14; (Ab142)

[0025] b3) a VH comprising a HCDR1 of an amino acid sequence as shown in SEQ ID NO: 17, a HCDR2 of an amino acid sequence as shown in SEQ ID NO: 18, and a HCDR3 of an amino acid sequence as shown in SEQ ID NO: 19; and / or, a VL comprising a LCDR1 of an amino acid sequence as shown in SEQ ID NO: 20, a LCDR2 of an amino acid sequence as shown in SEQ ID NO: 21, and a LCDR3 of an amino acid sequence as shown in SEQ ID NO: 22; (Ab144)

[0026] b4) a VH comprising a HCDR1 of an amino acid sequence as shown in SEQ ID NO: 25, a HCDR2 of an amino acid sequence as shown in SEQ ID NO: 26, and a HCDR3 of an amino acid sequence as shown in SEQ ID NO: 27; and / or, a VL comprising a LCDR1 of an amino acid sequence as shown in SEQ ID NO: 28, a LCDR2 of an amino acid sequence as shown in SEQ ID NO: 29, and a LCDR3 of an amino acid sequence as shown in SEQ ID NO: 30; (Ab147)

[0027] b5) a VH comprising a HCDR1 of an amino acid sequence as shown in SEQ ID NO: 33, a HCDR2 of an amino acid sequence as shown in SEQ ID NO: 34, and a HCDR3 of an amino acid sequence as shown in SEQ ID NO: 35; and / or, a VL comprising a LCDR1 of an amino acid sequence as shown in SEQ ID NO: 36, a LCDR2 of an amino acid sequence as shown in SEQ ID NO: 37, and a LCDR3 of an amino acid sequence as shown in SEQ ID NO: 38; (Ab163) or

[0028] b6) a VH comprising a HCDR1, a HCDR2, and a HCDR3 having one or more amino acid substitutions, deletions, or additions compared to the HCDR1, HCDR2, and HCDR3 as shown in any one of b1) - b5); and / or, a VL comprising a LCDR1, a LCDR2, and a LCDR3 having one or more amino acid substitutions, deletions, or additions compared to the LCDR1, LCDR2, and LCDR3 as shown in any one of b1) - b5);

[0029] wherein the CDRs are defined according to the Kabat numbering system.

[0030] It is understood by a person skilled in the art that the above amino acid substitutions are conservative substitutions.

[0031] In some embodiments, the heavy chain variable region of the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a framework region of a heavy chain variable region.

[0032] In some embodiments, the framework region of the heavy chain variable region comprises a framework region of a heavy chain variable region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, marten, chicken, duck, or goose, or a mutant thereof; further comprising a framework region of a heavy chain variable region of an immunoglobulin derived from a human, or a mutant thereof.

[0033] In some embodiments, the light chain variable region of the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a framework region of a light chain variable region.

[0034] In some embodiments, the framework region of the light chain variable region comprises a framework region of a light chain variable region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, marten, chicken, duck, or goose, or a mutant thereof; further comprising a framework region of a light chain variable region of an immunoglobulin derived from a human, or a mutant thereof.

[0035] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises:

[0036] c1) a heavy chain variable region (VH) comprising the amino acid sequence set forth in SEQ ID NO: 7, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; and / or, a light chain variable region (VL) comprising the amino acid sequence set forth in SEQ ID NO: 8, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto (Ab141);

[0037] c2) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 15, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 16, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab 142);

[0038] c3) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 23, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 24, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab 144);

[0039] c4) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 31, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 32, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab 147); or

[0040] c5) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 39, or an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 40, or an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto (Ab163).

[0041] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region.

[0042] In some embodiments, the heavy chain constant region comprises at least a portion of a heavy chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, mink, chicken, duck, or goose, or a mutant thereof; further comprising at least a portion of a heavy chain constant region of an immunoglobulin derived from a human, or a mutant thereof.

[0043] In some embodiments, the light chain constant region comprises at least a portion of a light chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, mink, chicken, duck, or goose, or a mutant thereof; further comprising a light chain constant region of an immunoglobulin derived from a human, or a mutant thereof.

[0044] In some embodiments, the heavy chain constant region comprises a heavy chain constant region derived from an IgAl, IgA2, IgD, IgE, IgGl, IgG2, IgG3, IgG4, or IgM immunoglobulin; further comprising a heavy chain constant region derived from an IgGl immunoglobulin.

[0045] In some embodiments, the heavy chain constant region comprises an amino acid sequence encoded by a nucleotide sequence as set forth in SEQ ID NO: 51, or an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0046] In some embodiments, the light chain constant region comprises a light chain constant region derived from a kappa and lambda type immunoglobulin.

[0047] In some embodiments, the light chain constant region comprises an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 52 or 53, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0048] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof is a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody; further, a fully human antibody.

[0049] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof can include, but is not limited to, a monoclonal antibody, a bispecific antibody, a multispecific antibody, a nanobody, a Fab fragment, a Fab' fragment, a Fab'-SH fragment, a F(ab')2 fragment, a Fv fragment, a single-chain Fv (scFv), a dsFv, or a Fd fragment.

[0050] In a second aspect of the present application, there is provided a biological material comprising any one of n1) - n9):

[0051] n1) a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of the first aspect of the present application;

[0052] n2) an expression cassette comprising the nucleic acid molecule of n1);

[0053] n3) a vector comprising the nucleic acid molecule of n1);

[0054] n4) a vector comprising the expression cassette of n2);

[0055] n5) a cell comprising the nucleic acid molecule of n1);

[0056] n6) a cell comprising the expression cassette of n2);

[0057] n7) a cell comprising the vector of n3);

[0058] n8) a cell comprising the vector of n4);

[0059] n9) a cell comprising the antibody or antigen-binding fragment thereof of the first aspect of the present application;

[0060] Any of the cells of n5) - n9) do not comprise reproductive material.

[0061] It will be understood by those skilled in the art that nucleotides in the nucleic acid molecule can be substituted according to codon degeneracy. In some embodiments, the nucleotide sequence of the nucleic acid molecule is codon-optimized.

[0062] In some embodiments, the nucleic acid molecule encoding the antibody or antigen binding fragment thereof of the first aspect of the application comprises a nucleic acid molecule encoding the heavy chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application and a nucleic acid molecule encoding the light chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application.

[0063] In some embodiments, the nucleic acid molecule encoding the heavy chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 41, 43, 45, 47, or 49, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0064] In some embodiments, the nucleic acid molecule encoding the light chain variable region of the antibody or antigen binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 42, 44, 46, 48, or 50, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0065] In some embodiments, the nucleic acid molecule encoding the antibody or antigen binding fragment thereof of the first aspect of the application comprises a nucleic acid molecule encoding the heavy chain constant region of the antibody or antigen binding fragment thereof of the first aspect of the application and a nucleic acid molecule encoding the light chain constant region of the antibody or antigen binding fragment thereof of the first aspect of the application.

[0066] In some embodiments, the nucleic acid molecule encoding the heavy chain constant region of the antibody or antigen binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 51, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0067] In some embodiments, the nucleic acid molecule encoding the light chain constant region of the antibody or antigen-binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 52 or 53, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0068] In some embodiments, any of the vectors of n3) - n4) can be an expression vector. In some embodiments, the expression vector can comprise a eukaryotic expression vector and / or a prokaryotic expression vector. In some embodiments, the eukaryotic expression vector can comprise, for example, but not limited to, a yeast expression vector, a mammalian expression vector, and an insect expression vector. For example, the expression vector can comprise, but not limited to, a plasmid, a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector.

[0069] In some embodiments, the vector can be selected from a nanoparticle, a liposome, an exosome, a microvesicle, or a gene gun.

[0070] In some embodiments, any of the cells of n5) - n9) can be a host cell routinely used in the art, as long as the expression vector can stably express the nucleic acid molecule carried thereby as the above-mentioned antibody or antigen-binding fragment thereof of the application. In some embodiments, the host cell can be a prokaryotic cell, for example, which can comprise E. coli, and / or a eukaryotic cell, for example, which can comprise a CHO cell, a HEK293 cell, a BHK cell, an NS0 cell, an SP2 / 0 cell, a YO myeloma cell, a P3X63 mouse myeloma cell, a PER cell, a PER.C6 cell, a HeLa cell, a Vero cell, an Expi293 cell, a hybridoma cell, a yeast cell, and an insect cell.

[0071] In some embodiments, any of the cells of n5) - n9) can be an immune cell. In some embodiments, the immune cell can comprise, but not limited to, a T cell, an NK cell, a DC cell, and a macrophage.

[0072] In a third aspect of the application, there is provided a method of producing the antibody or antigen-binding fragment thereof of the first aspect of the application, by culturing the cell of the second aspect of the application.

[0073] In a fourth aspect of the application, there is provided a conjugate comprising the antibody or antigen-binding fragment thereof of the first aspect of the application; and, a conjugating moiety.

[0074] In some embodiments, the conjugating moiety can include, but is not limited to, a detectable label or a therapeutic agent.

[0075] In some embodiments, the detectable label can be any substance that can be detected by fluorescent, spectroscopic, photochemical, biochemical, immunological, electrical, optical, chemical, or other means. Such labels are well known in the art and include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, beta-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g., 3H, 125I, 35S, 14C, or 32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas Red, rhodamine, quantum dot, or a cyanine dye derivative (e.g., Cy7, Alexa 750)), acridinium esters, magnetic beads, calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads, and biotin for subsequent binding to avidin (e.g., streptavidin) modified with the above labels. In some embodiments, such labels can be suitable for use in immunological detection (e.g., enzyme-linked immunoassay, radioimmunoassay, fluorescent immunoassay, chemiluminescent immunoassay, etc.). In some embodiments, the detectable label is selected from the group consisting of a radioisotope, a fluorescent substance, a luminescent substance, a colored substance, or an enzyme. In some embodiments, the detectable label as described above can be linked to the antibody or antigen-binding fragment thereof of the present application via linkers of different lengths to reduce potential steric hindrance.

[0076] In some embodiments, the detectable label can include, but is not limited to, an enzyme (e.g., horseradish peroxidase), a radionuclide, a fluorescent dye, a luminescent substance (e.g., a chemiluminescent substance), a colored substance, biotin, etc.

[0077] In some embodiments, the therapeutic agent can include, for example, but is not limited to, a drug for preventing and / or treating Clostridium tetani (Clostridium tetanomorphum, Clostridium tetanomorphum, Clostridium tetani ) infection or a disease caused thereby.

[0078] In some embodiments, the conjugating moiety is selected from the group consisting of substances capable of improving the biological properties of the antibody (e.g., increasing the serum half-life), which can be, for example, a chemical group such as polyethylene glycol (PEG), a methyl group, an ethyl group, or a sugar group.

[0079] In a fifth aspect of the present application, a pharmaceutical composition is provided, which includes: the antibody or antigen-binding fragment thereof of the first aspect of the present application, the biomaterial of the second aspect of the present application, or the conjugate of the fourth aspect of the present application; and a pharmaceutically acceptable carrier.

[0080] In some embodiments, the pharmaceutical composition can further comprise an additional pharmaceutically active agent.

[0081] In some embodiments, the additional pharmaceutically active agent can be a drug having a biological activity, for example, a drug capable of preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0082] In some embodiments, the antibody or antigen-binding fragment thereof and the additional pharmaceutically active agent are provided as separate components or as a mixture.

[0083] In some embodiments, the pharmaceutical composition can be administered by, for example, parenteral, subcutaneous injection, sublingual, rectal, nasal, intravenous injection, intramuscular injection, oral, ocular, topical, etc.

[0084] In some embodiments, the pharmaceutical composition is in the form of, for example, an aqueous solution, a suspension, a powder, a tablet, a capsule, a granule, a powder, a pill, a disintegrant, a syrup, a spray, a gel, an emulsion, an injection, an elixir, a lozenge, a suppository, etc.

[0085] In a sixth aspect of the present application, there is provided a diagnostic or therapeutic kit comprising: the antibody or antigen-binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect.

[0086] In some embodiments, the kit can further comprise an instruction and / or a device for administration.

[0087] In some embodiments, the kit can be used for diagnosing Clostridium tetani infection or a disease caused thereby, detecting Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanolysin C fragment in a sample, or drug screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0088] In some embodiments, the kit can be used for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0089] In the present application, the disease caused by Clostridium tetani infection includes tetanus.

[0090] In a seventh aspect of the present application, there is provided use of the antibody or antigen-binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect in any one of c1) to c6):

[0091] c1) for the manufacture of a product for diagnosing Clostridium tetani infection or a disease caused thereby;

[0092] c2) preparing a product for preventing and / or treating Clostridium tetani infection or a disease caused thereby;

[0093] c3) preparing a product for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysoid C fragment in a sample;

[0094] c4) detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysoid C fragment;

[0095] c5) preparing a product for drug screening, the drug being for preventing and / or treating Clostridium tetani infection or a disease caused thereby;

[0096] c6) drug screening, the drug being for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0097] In some embodiments, the use of c4), c6) does not involve diagnosis, treatment of a disease.

[0098] In some embodiments, the sample is selected from at least one of body fluid, tissue, cell, excretion of a subject to be tested.

[0099] In some embodiments, the body fluid comprises at least one of blood, lymph.

[0100] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spot, whole blood.

[0101] In some embodiments, the excretion comprises at least one of urine, feces, tears.

[0102] In some embodiments, the subject to be tested comprises a mammal, such as a human, a non-human primate (e.g., chimpanzee, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a livestock (e.g., horse, cow, sheep, pig, rabbit).

[0103] In some embodiments, the subject to be tested comprises a human.

[0104] In some embodiments, the product is a pharmaceutical product, a reagent or a kit.

[0105] In an eighth aspect, the present application provides a method for preventing and / or treating Clostridium tetani infection or a disease caused thereby, the method comprising administering to a subject in need thereof an effective amount of the antibody or antigen binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect or the pharmaceutical composition of the fifth aspect.

[0106] In a ninth aspect, the present application provides a method comprising contacting a sample with an antibody or antigen-binding fragment thereof of the first aspect of the present application under conditions that allow the antibody or antigen-binding fragment thereof of the first aspect of the present application to form a complex with tetanus toxin, tetanus toxoid or tetanus toxin C fragment, and detecting the formation of the complex;

[0107] The method is used in any one of f1) - f3):

[0108] f1) diagnosing Clostridium tetani infection or a disease caused thereby;

[0109] f2) detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin C fragment in a sample;

[0110] f3) screening for a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0111] In some embodiments, the sample is the sample in the seventh aspect of the present application.

[0112] The present application has the following advantages:

[0113] The present application provides an anti-tetanus toxin antibody or antigen-binding fragment thereof, which can specifically recognize and bind to tetanus toxin, tetanus toxoid and / or tetanus toxin C fragment, and has good affinity therewith; at the same time, it has a significant neutralizing effect on tetanus toxin; it can be used for preparing a product for diagnosing, preventing and / or treating Clostridium tetani infection or a disease caused thereby, detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin C fragment in a sample, or screening a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0114] Further, the fully humanized anti-tetanus toxin antibody or antigen-binding fragment thereof has the characteristics of high affinity, high specificity and small toxic side effects, avoids the problems of large adverse reactions and short half-life of animal-derived monoclonal antibodies, and can be prepared in large quantities by mammalian cells, has clear and stable components, is free of allergens and exogenous virus pollution, is safe, and can be widely used in various populations; it can be used as a new generation of passive immunization preparation for tetanus, and has important medical value. BRIEF DESCRIPTION OF DRAWINGS

[0115] Figure 1 The binding curve of the antibody to tetanus toxoid or tetanus toxin C fragment is shown.

[0116] Figure 2 The results of the mouse challenge protection experiment are shown. DETAILED DESCRIPTION

[0117] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0118] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0119] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0120] Tetanus toxin ( Tetanospasmin TeNT (tetrafluoroethylenediamine) is a neurotoxin with extremely high toxicity, second only to botulinum toxin (BoNT). This toxin has a special affinity for the central nervous system, preventing the release of inhibitory neurotransmitters from inhibitory synaptic terminals. This leads to an imbalance between excitation and inhibition in muscle activity, resulting in simultaneous and strong contractions of extensor and flexor muscles, causing muscle rigidity and spasms, and forming the characteristic symptoms of tetanus such as trismus and opisthotonus. TeNT is a polypeptide chain with a molecular weight of 150 kDa. After translation by bacteria or host proteases, it is cleaved into an active double-chain form linked by a single disulfide bond: a light chain (fragment A) and a heavy chain (fragments B and C), with molecular weights of 50 kDa and 100 kDa, respectively. Fragment A is a zinc metalloproteinase that cleaves the membrane proteins on nerve cell membranes that transmit neurotransmitters, inhibiting the release of neurotransmitters and allowing continuous transmission of excitation. Fragment B encodes a translocation domain, mediating the entry of the active site of the toxin into the cell. Fragment C is a receptor-binding domain, enabling retrograde axonal transport into the central nervous system. Numerous studies have shown that antibodies against fragment C are highly likely to have neutralizing activity.

[0121] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value. In an embodiment, the term "about" indicates a range of ±1% of the following value.

[0122] The term "specifically binds" as used herein refers to having binding selectivity for an antigen and can be distinguished from non-specific or nonspecific binding. The ability of an antigen binding molecule to bind to a particular antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to one of skill in the art (e.g., surface plasmon resonance (SPR) techniques as well as traditional binding assays).

[0123] The term "affinity" or "binding affinity" as used herein refers to the strength of the noncovalent interaction between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Binding affinity can generally be expressed as an affinity constant (KD), which is the ratio of the dissociation rate constant (kd) to the association rate constant (ka). Thus, equivalent affinities can include different rate constants, as long as the ratio of the rate constants remains the same. Affinity can be measured by conventional methods known in the art, such as surface plasmon resonance (SPR). In some embodiments, the antibody binds with an equilibrium dissociation constant (KD) of about less than 10 -6 M, about less than 10 -7 M, about less than 10 -8 M, about less than 10 -9 M, about less than 10 -10 M, about less than 10

[0124] The term "antibody" as used herein encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies or trispecific antibodies), single chain molecules, and antibody fragments, as long as they exhibit the desired antigen binding activity. Within the light and heavy chains of an antibody, the variable and constant regions are joined by a "J" region of about 12 or more amino acids. The heavy chain also contains a "D" region of about 3 or more amino acids. Each heavy chain is composed of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region is comprised of one domain, CL. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0125] Unless otherwise indicated, "antibody active fragment", "antibody fragment", "target binding fragment" and "antigen binding fragment" are interchangeable in the context of the present application and mean an antibody fragment that is capable of specifically binding an antigen, e.g., a fragment that retains one or more CDR regions. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fab'-SH, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules, e.g., single-chain Fv (scFv); nanobodies formed from antibody fragments; dsFv, Fd fragments, and multispecific antibodies.

[0126] The term "variable region" or "variable domain" as used herein refers to the domain of an antibody heavy or light chain that is involved with binding the antibody to an antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) in a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs). A single VH or VL domain can be sufficient to confer antigen-binding specificity. The term "variable" refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies, and are used in the binding and specifity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. Instead, it is concentrated in three segments called hypervariable regions (HVRs) that are interposed between framework regions (FRs). The more highly conserved portions of the variable domains are called the framework regions (FRs). The variable domains of the heavy chain and light chain each comprise four FR regions, largely adopting a beta-sheet configuration, connected by three HVRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The HVRs in each chain are held together in part by the FR regions of the HVRs, and, with the HVRs from the other chain, contribute to the formation of the antigen binding site of antibodies. The constant domains are not involved directly in binding an antibody to an antigen, but exhibit other effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity.

[0127] The term "hypervariable region" or "HVR", as used herein, refers to the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Generally, native four-chain antibodies comprise six HVRs: three in the VH (H1, H2, H3), and three in the VL (L1, L2, L3). HVRs generally comprise amino acid residues from the hypervariable loops and / or from the "complementarity determining regions" (CDRs), which have the highest sequence variability and / or involve in antigen recognition. It is understood by those skilled in the art that the "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., variable region) are understood to encompass the "CDRs" and "complementarity determining regions" as defined by any one of the art-known schemes, unless otherwise specified. It is well known in the art that CDRs of an antibody can be defined by various methods, e.g., according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system. It is understood by those skilled in the art that the term "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., variable region) are understood to encompass the CDRs defined by any one of the above-mentioned known schemes described herein, unless otherwise specified, and the corresponding amino acid sequences defined by the rules of the CDRs are also intended to fall within the scope of the present application.

[0128] The term "chimeric antibody", as used herein, refers to an antibody that combines the antibody fragments from different species. Specifically, for example, a monoclonal antibody from one species (e.g., mouse), whose Fc constant region is replaced by the Fc constant region from one species (e.g., human) via DNA recombination technology.

[0129] The term "humanized antibody", as used herein, refers to an antibody comprising a human immunoglobulin framework region and one or more CDRs from a non-human (e.g., mouse, rat, rabbit, or synthetic) immunoglobulin. Except for the CDRs, all other parts of the humanized antibody are essentially the same as the corresponding parts of the natural human immunoglobulin sequence.

[0130] The term "fully human antibody", as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. As used herein, the term "fully human antibody" refers to a protein molecule having virtually each of its parts (e.g., CDRs, FRs, CL, HC domains (e.g., CH1, CH2, CH3), hinge, VL, VH) essentially non-immunogenic in humans, with only minor sequence changes or variations relative to a human natural immunoglobulin. Thus, a fully human antibody is distinguished from a chimeric or humanized antibody. It is noted that a fully human antibody can be produced by a human cell, a non-human animal, or a prokaryotic or eukaryotic cell capable of expressing a functionally rearranged human immunoglobulin (e.g., heavy and / or light chain) gene.

[0131] The term "nucleic acid molecule" as used herein refers to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide.

[0132] "Percent homology," "% homology," or "% sequence identity" as used herein in the context of the present application is used to describe the degree of similarity between two nucleotide sequences or two amino acid sequences, and has the same meaning as "percent identity." The percent homology of two sequences can be calculated as the number of positions at which the residues are identical, divided by the total number of positions in the aligned sequences, multiplied by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, e.g., the BLAST suite available on the NCBI website. As used herein, having "at least 80% sequence identity" to a sequence means having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence.

[0133] The term "vector" or "expression vector" as used herein interchangeably with "expression construct" is a DNA molecule that directs the introduction of a particular gene with which it is operably linked into a target cell and directs expression. The vector includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. The expression vectors of the present application comprise an expression cassette. The expression vector can be transcribed to produce a large number of stable mRNAs. Once the expression vector is within the target cell, the ribonucleic acid molecule or protein encoded by the gene is produced by the cellular transcription and / or translation machinery.

[0134] The term "cell" as used herein interchangeably with "host cell" refers to a cell into which a foreign nucleic acid has been introduced, and also includes the progeny of such a cell. Host cells include "transformants" and "transformed cells," including primary transformed cells as well as progeny derived therefrom. The nucleic acid of the progeny can not be identical to that of the parent cell from which it was derived, and can contain mutations. Host cells include cultured cells, e.g., cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, yeast cells, insect cells, and plant cells. Host cells of the present disclosure also include cells contained within a transgenic animal, a transgenic plant, or a cultured plant or animal tissue.

[0135] The term "pharmaceutical composition" as used herein includes the antibodies or antigen-binding fragments thereof of the present application and a pharmaceutically acceptable carrier. The pharmaceutical composition can be in various oral or parenteral formulation forms. The pharmaceutical composition is formulated using conventional diluents or excipients including fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Solid oral formulations include tablets, pills, powders, granules, capsules, and the like. These solid formulations can be prepared by mixing at least one compound with one or more excipients, for example, starch, calcium carbonate, sucrose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate or talc can also be used. In addition, liquid oral formulations include suspensions, solutions, emulsions, and syrups, and the like. In addition to water and liquid paraffin, which are generally used as simple diluents, various excipients such as wetting agents, sweeteners, flavorings, preservatives, and the like can be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized agents, suppositories, and the like. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used as non-aqueous solvents and suspending agents. The main components of suppositories can include semi-synthetic fatty acid esters, polyethylene glycols, Tween 61, cocoa butter, lauric butter, glycerol gelatin, and the like.

[0136] The pharmaceutical composition of the present application can be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to any medical treatment. The effective dose level of the composition can be determined depending on the type of the subject, the severity of the disease, the age and gender of the subject, the drug activity, the sensitivity to the drug, the administration time, the administration route, the excretion rate, the treatment time, the drugs used in combination with the composition, and other known factors in the medical field. The pharmaceutical composition of the present application can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms. It is important to administer the composition at the minimum amount capable of exhibiting the maximum effect without causing side effects, which can be easily determined by those skilled in the art, considering all the above factors.

[0137] The term "pharmaceutically acceptable carrier" as used herein means a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. The pharmaceutically acceptable carriers that can be used to formulate the composition of the present application in the form of a liquid solution include physiological saline, sterile water, Ringer's solution, buffered saline solution, glucose solution, maltodextrin solution, glycerol, ethanol, and a mixture of two or more thereof. If necessary, the composition of the present application can also contain other conventional additives such as antioxidants, buffers, and bacteriostats. In addition, the composition of the present application can also include diluents, dispersants, surfactants, binders, and lubricants to configure it into injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, and tablets.

[0138] The term "treat" a disease in a subject or "treat" a subject having or suspected of having a disease, as used herein, means to administer a drug treatment, e.g., one or more agents, to a subject, so as to reduce or prevent at least one symptom of the disease from worsening. Thus, in one embodiment, "treat" refers to, inter alia, delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing efficacy of or reducing resistance to alternative therapies, or combinations thereof.

[0139] The term "diagnose" or "detect" as used herein includes determining the presence or absence of tetanus toxin in a subject or in a sample to be tested. Accordingly, it is possible to determine whether the subject or a subject from which the sample was derived is infected with Clostridium tetani.

[0140] The term "prevent" as used herein means to apply or administer a drug to a subject at risk of developing a disease, with the purpose to prevent the onset of the disease in the future, to reduce, alleviate, ameliorate, suppress, inhibit or reduce the severity of, and / or reduce one or more symptoms or features of the disease. The compositions of the present application can be administered as a food product, e.g., a nutritional supplement. Generally, the compositions of the present application are used to treat humans, although they can be used to treat animals, e.g., poultry, swine, cats, dogs, horses or rabbits. If administered to an animal, oral gavage can be used.

[0141] The term "conservative substitution" as used herein means an amino acid substitution that does not adversely affect or alter the intended properties of a protein / polypeptide comprising the amino acid sequence. For example, conservative substitutions can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitutions of an amino acid residue with an amino acid residue having a similar side chain, e.g., substitutions that take place within a family of amino acid residues that are physicochemically or functionally similar, e.g., have similar size, shape, charge, chemical properties, including ability to form covalent or hydrogen bonds, etc. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of an amino acid residue with another amino acid residue from the same side chain family is preferred. Methods for identifying amino acid conservative substitutions are well known in the art (see, e.g., Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl Acad. Set USA 94:412-417 (1997), which are incorporated herein by reference).

[0142] Examples and figures are provided below to assist in the understanding of the present application. It is understood that the examples and figures are intended to be illustrative only and that no limitations are thereby placed upon the scope of the present application. The true scope of the application is set forth in the attached claims. It should be appreciated that any modifications and changes can be made without departing from the spirit and scope of the application. The reagents and / or kits used in the following examples are commercially available or can be synthesized by known methods.

[0143] It should be noted that, in the examples, the specific conditions not specified are carried out according to the conventional conditions, the manufacturer's recommendations or the reported experimental conditions in the public domain. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be purchased on the market. The reagents used are specified by the manufacturer, and similar products from other manufacturers have substitutability.

[0144] Example 1. Flow cytometric sorting of B cells and screening and preparation of anti-tetanus toxin antibodies

[0145] Peripheral Blood Mononuclear Cell (PBMC) was isolated from the blood of volunteers immunized with commercial tetanus vaccine and producing protective antibodies, and monoclonal antibodies capable of specifically binding to full-length tetanus toxin and its C fragment were screened, and five antibodies were further screened, and the sequences are shown in Table 1.

[0146] Table 1 CDR region and variable region sequence of five antibodies

[0147]

[0148]

[0149]

[0150] Note: The CDR in the table is defined according to the Kabat numbering system.

[0151] The screening and preparation method of the antibody is as follows:

[0152] 1. PBMC isolation and memory B cell sorting

[0153] 10 mL of venous blood was collected from volunteers immunized with commercial tetanus vaccine (from Chengdu Oulin Biotechnology Co., Ltd.) and producing protective antibodies, and placed in an anticoagulant tube containing sodium citrate. 10 mL of blood sample was separated by Ficoll (polyfructose) to obtain PBMC. After counting the PBMC, tetanus toxoid (from: Sinovac Biotech Co., Ltd. uses Clostridium tetani CMCC 64008 after fermentation culture, purification and detoxification, which has the same immunogenicity as tetanus toxin) and tetanus toxin C fragment (synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., sequence as shown in SEQ ID NO: 54) were used as sorting antigens, and SONY SH800 flow cytometry was used to sort single antigen-specific memory B cells from PBMC into 96-well PCR (Polymerase Chain Reaction) plates, so that each well contains 1 B cell. The 96-well plate containing B cells was placed in a refrigerator at -80 ℃, and stored for standby.

[0154] 2. Single-cell PCR amplification of fully humanized monoclonal antibodies

[0155] 1) Reverse transcription PCR: Add all IgG1 subtype-specific primers for heavy chain and kappa light chain to the 96-well PCR plate containing single B cells, and reverse transcribe at 50°C for 30 min, and inactivate the reverse transcriptase at 85°C for 5 min. The obtained cDNA product was stored at -80°C.

[0156] 2) Nested PCR:

[0157] First round reaction: 2 μL cDNA product as template, hot start ultra-high fidelity DNA polymerase for rapid PCR (TransStart(®) FastPfu DNA Polymerase, full Genomics), dNTPs and nested PCR primers were added. Reaction conditions: pre-denaturation at 98℃ for 5 min, then 40 cycles of PCR, each cycle at 98℃ for 30 s, 55℃ (heavy chain VH, kappa light chain VK) for 1 min, 72℃ for 1 min, and finally extension at 72℃ for 5 min.

[0158] Second round reaction: the first round of reaction PCR product as template, hot start ultra-high fidelity DNA polymerase for rapid PCR (TransStart(®) FastPfu DNA Polymerase, full Genomics), dNTPs and nested PCR primers were added. Reaction conditions: pre-denaturation at 98℃ for 5 min, then 35 cycles of PCR, each cycle at 98℃ for 30 s, 58℃ (heavy chain VH) / 60℃ (kappa light chain VK) for 1 min, 72℃ for 1 min, and finally extension at 72℃ for 5 min, to obtain the nested PCR amplification product containing heavy chain and light chain variable region sequences.

[0159] The sequences of IgG1 subtype specific primers for heavy chain, kappa light chain and lambda light chain, and the sequences of the above nested PCR primers are described in Liao HX, Levesque MC, Nagel A, et al. High-throughput isolation of immunoglobulin genes from single human B cells and expression as monoclonal antibodies. J Virol Methods. 2009; 158(1-2): 171-179.

[0160] 3) Agarose gel electrophoresis

[0161] 5 μL of the nested PCR amplification product was taken for 1.5% agarose gel electrophoresis detection, and paired positive clones were sequenced to obtain antibody variable region sequences, which were used for linear expression frame construction.

[0162] 3. Construction of recombinant antibody linear expression frame to express antibody

[0163] A commercial pcDNA3.4 vector was used as a backbone, and a signal peptide (ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC, SEQ ID NO: 55) and a heavy chain constant region sequence (SEQ ID NO: 51, heavy chain constant region of IgG1 immunoglobulin), a signal peptide (SEQ ID NO: 55) and a kappa light chain constant region sequence (SEQ ID NO: 52), and a signal peptide (SEQ ID NO: 55) and a lambda light chain constant region sequence (SEQ ID NO: 53) were introduced into the XbaI site in the form of homologous recombination, respectively, to construct three expression plasmids, pcDNA3.4-H, pcDNA3.4-κ, and pcDNA3.4-λ. The above plasmids were synthesized by Baiying Biotechnology Co., Ltd.

[0164] The enhancer sequence, the promoter sequence, and the signal peptide fragment were obtained by PCR amplification using the CMV primer-F: GGCTTGACCGACAATTGCATGAAGAATC (SEQ ID NO: 57) and the CMV primer-R: GGCCCTCACCCCAGTCAG (SEQ ID NO: 58) and any of the above plasmids (pcDNA3.4-H, pcDNA3.4-κ, or pcDNA3.4-λ) as a template.

[0165] The heavy chain constant region sequence, WPRE, and Poly (A) fragment were obtained by PCR amplification using the heavy chain constant region primer-F: GCTAGCACCAAGGGCCCA (SEQ ID NO: 59) and the poly (A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60) and the pcDNA3.4-H plasmid as a template.

[0166] The kappa light chain constant region sequence, WPRE, and Poly (A) fragment were obtained by PCR amplification using the kappa light chain constant region primer-F: CGTACGGTGGCTGCACCAT (SEQ ID NO: 61) and the poly (A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60) and the pcDNA3.4-κ plasmid as a template.

[0167] The λ light chain constant region primer-F: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 62) and poly (A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60) were used as primers, and the pcDNA3.4-λ plasmid was used as a template to amplify the λ light chain constant region sequence, WPRE and Poly (A) fragments by PCR.

[0168] All the above amplified fragments were purified by magnetic bead purification method. The nested PCR amplification product containing the heavy chain and light chain variable region sequence was used to construct a linear expression frame with the above expression elements (enhancer + promoter + signal peptide), constant region (heavy chain, κ light chain, λ light chain), WPRE and Poly (A) fragments using overlap PCR technology: the light chain constant region of Ab141, Ab142, Ab147 and Ab163 is κ light chain constant region, and the light chain constant region of Ab144 is λ light chain constant region. After completion, 5 μL of the linear expression frame amplification product was detected by 1% agarose gel electrophoresis, and sequencing was performed to identify that the constructed antibody linear expression frame was correct.

[0169] The correctly constructed and purified heavy chain and light chain linear expression frames were co-transfected into 293 cells using transfection reagent PEI. The cells were cultured in a 37 ℃ 5% CO2 incubator for 72 h, and the cell supernatant was collected for detection.

[0170] 4. ELISA screening of candidate antibodies with binding activity

[0171] The tetanus toxoid or tetanus toxin C fragment (wherein the tetanus toxoid is derived from: Kexing Zhongwei uses Clostridium tetani CMCC 64008 for fermentation culture, purification and detoxification, and has the same immunogenicity as tetanus toxin; the tetanus toxin C fragment is synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., and the sequence is: KNLDCWVDNEEDIDVILKKSTILNLDINNDIISDISGFNSSVITYPDAQLVPGINGKAIHLVNNESSEVIVHKAMDIEYNDMFNNFTVSFWLRVPKVSASHLEQYDTNEYSIISSMKKYSLSIGSGWSVSLKGNNLIWTLKDSAGEVRQITFRDLSDKFNAYLANKWVFITITNDRLSSANLYINGVLMGSAEITGLGAIREDNNITLKLDRCNNNNQYVSIDKFRIFCKALNPKEIEKLYTSYLSITFLRDFWGNPLRYDTEYYLIPVAYSSKDVQLKNITDYMYLTNAPSYTNGKLNIYYRRLYSGLKFIIKRYTPNNEIDSFVRSGDFIKLYVSYNNNEHIVGYPKDGNAFNNLDRILRVGYNAPGIPLYKKMEAVKLRDLKTYSVQLKLYDDKDASLGLVGTHNGQIGNDPNRDILIASNWYFNHLKDKTLTCDWYFVPTDEGWIN, SEQ ID NO: 54) is used as an antigen, and the antigen is diluted to 2 μg / mL with a coating solution to coat a 96-well ELISA plate, each well containing 100 μL of overnight coating at 4°C, and then blocked with a blocking solution at 37°C for 2 h. The collected supernatant containing the antibody is used as a primary antibody and incubated at 37°C for 1 h, a goat anti-human IgG-HRP (1:20,000 dilution) is used as a secondary antibody and incubated at 37°C for 1 h, a substrate developing solution is added and incubated at room temperature for 10 min, and the reaction is stopped with 2M sulfuric acid, and detected and analyzed at a wavelength of 450 nm. The results show that no less than 100 strains of monoclonal antibodies can specifically bind to tetanus toxoid and / or tetanus toxin C fragment.

[0172] 5. Expression plasmid construction and antibody preparation

[0173] After sequence alignment, repeated sequences and similar sequences are removed, and finally five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 are selected for further study, and the CDR region and variable region sequences of the antibodies are shown in Table 1.

[0174] The expression plasmids of the above 5 candidate antibodies were constructed respectively, and the antibodies were prepared. The specific method is as follows: using the seamless cloning kit (One Step Seamless Cloning Mix, Kangwei Century), the linear expression frame amplification product (obtained in step 3 above) containing the heavy chain and light chain of the 5 antibodies was respectively connected with the reverse PCR amplified pcDNA3.4-H, pcDNA3.4-κ and pcDNA3.4-λ expression vector framework, and the vector framework amplification primers were as follows:

[0175] H-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 63), and heavy chain reverse primer 3.4-R: GCTAGCACCAAGGGCCCA (SEQ ID NO: 64) (pcDNA3.4-H vector framework); the amplification template is pcDNA3.4-H;

[0176] L-κ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 65), and κ light chain reverse primer 3.4-R: CGTACGGTGGCTGCACCAT (SEQ ID NO: 66) (pcDNA3.4-κ vector framework); the amplification template is pcDNA3.4-κ;

[0177] L-λ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 67), and λ light chain reverse primer 3.4-R: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 56) (pcDNA3.4-λ vector framework). The amplification template is pcDNA3.4-λ.

[0178] Take 1 μL of the linear expression cassette fragment and 2 μL of the corresponding vector frame (e.g., 1 μL of the heavy chain linear expression cassette fragment and 2 μL of the pcDNA3.4-H expression vector frame; 1 μL of the κ light chain linear expression cassette fragment and 2 μL of the pcDNA3.4-κ expression vector frame), add 5 μL of 2× cloning premix ligase, and add water to a final volume of 10 μL. Reaction conditions: PCR at 50℃ for 15 min. After the reaction, cool the reaction mixture on ice and transform it into DH5α competent cells to obtain the expression plasmid. Add PEI transfection reagent to a plasmid DNA tube (containing both heavy and light chain plasmids) diluted with OPM-293 CD05 medium, mix well, and incubate the complex at room temperature for 20 min, then culture at 37℃, 120 rpm, 6% CO2 for 5-7 days. The supernatant was collected by centrifugation at 300g for 5 min, filtered through a 0.2μm filter, purified by protein A affinity, and the collected antibody was replaced with PBS. The antibody concentration was then measured.

[0179] Example 2. ELISA detection of antibody binding activity

[0180] 1. Experimental Procedure

[0181] Tetanus toxoid or tetanus toxoid C fragment (the tetanus toxoid was obtained by Sinovac Biotech through fermentation, purification, and detoxification of Clostridium tetani CMCC 64008, and has the same immunogenicity as tetanus toxoid; the tetanus toxoid C fragment was synthesized and expressed by Wuhan Huamei Biotechnology Co., Ltd., and its sequence is shown in SEQ ID NO: 54) were used as antigens. The antigens were diluted to 2 μg / mL with coating buffer and coated onto 96-well ELISA plates. The volume of each well was 100 μL. Coating was carried out overnight at 2–8°C and blocked with blocking buffer at 37°C for 2 h. The five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 expressed and purified in Example 1 were serially diluted and added to the blocked ELISA plate as test samples. The plates were incubated at 37°C for 1 hour. After washing, the plates were incubated with goat anti-human IgG-HRP (1:20000 dilution) at 37°C for 1 hour. After adding the substrate chromogenic solution, the plates were placed at room temperature in the dark for 10 minutes. The reaction was stopped with 2M sulfuric acid, and the samples were detected and analyzed at OD450 / 630nm wavelength.

[0182] 2. Results

[0183] The results are as follows Figure 1 As shown, the expressed and purified antibodies, diluted to a concentration (conc) of approximately 0.0024 μg / mL, can still bind to tetanus toxoid or tetanus toxoid C fragment. Therefore, the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 expressed and purified in Example 1 all have extremely strong binding activity.

[0184] Example 3. SPR detection of affinity constant of antibodies and affinity kinetics analysis

[0185] 1. Capture assay

[0186] The antibody affinity test was performed by capture method. Biacore T200 (GE Healthcare) biomacromolecule interaction system was used, and the buffer was 1x HBS-EP+ buffer (GE Healthcare). The five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 were diluted to a concentration of 2 μg / mL, and injected into the Protein A capture chip experiment channel (Fc2) (GE Healthcare) at a flow rate of 10 μl / min, and captured for 15 s to make the capture level about 70 RU. The reference channel (Fc1) did not need to be captured with ligand. The analyte tetanus toxoid (the source of tetanus toxoid was: obtained by fermentation culture, purification and detoxification of Clostridium tetani CMCC64008, and it had the same immunogenicity as tetanus toxin) was sequentially flowed through the chip at gradually increasing concentrations to obtain signal curves respectively. Each concentration was a cycle, and after completing a cycle, the chip was regenerated with a regeneration solution to restore the original state of uncaptured antibodies, and the regeneration time was 60 s. The signal curves obtained were analyzed by GE Healthcare BiaCore T-200 system software to obtain the affinity activity detection results of the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 and tetanus toxoid.

[0187] 2. Results

[0188] As shown in Table 2, the affinity of each antibody to tetanus toxoid reached the order of 10 -9 M, indicating that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 had very high affinity activity, and the antibody binding / complex had good stability.

[0189] Table 2. Affinity activity detection results of antibodies and tetanus toxoid

[0190]

[0191] Example 4. Determination of neutralization protection efficacy in mice

[0192] 1. Tetanus toxin L+ assay

[0193] Take a tetanus toxin (from China Food and Drug Inspection Research Institute), using sterile glycerol and borate buffer diluent (from Shanghai Shangbao Biological Technology Co., Ltd.) mixed with an equal amount (volume) of solution to prepare the toxin storage solution. When used, add an appropriate amount of borate buffer diluent to a brown bottle, take an appropriate amount of toxin storage solution and add it to the brown bottle, prepare the toxin application solution, and the volume of each test dose solution is 1 mL. Take the tetanus human immunoglobulin (Homologous tetanus immune globulin, hTIG) standard (from China Food and Drug Inspection Research Institute), add borate buffer diluent to dilute to 0.5 IU / mL, take 1 mL and add to each toxin application solution brown bottle, mix well, seal, and incubate at 37°C for 1 hour. Immediately subcutaneously inject NIH mice on the abdomen, 3 mice per test dose, 0.4 mL per mouse, observe for 5 days, morning and afternoon each time, and the minimum toxin amount that causes all mice to die within 72-120 hours is the test dose (1 / 10L+).

[0194] 2. In vivo neutralization protection experiment

[0195] The experiment is divided into a negative control group, an hTIG group (0.5 IU / mL), and five antibody groups (10 μg / mL, Ab141, Ab142, Ab144, Ab147, and Ab163 prepared in Example 1). The toxin is diluted with borate buffer to contain 5 test amounts (1 / 10L+) per 1 ml, the hTIG group is diluted with borate buffer to 0.5 IU / mL, the five antibody groups are diluted with borate buffer to 10 μg / mL, and the negative control group is borate buffer. Diluted toxin is mixed with diluted negative control group, hTIG group and five antibody groups in equal volume, incubated at 37°C for 1 h, and the incubated sample is injected subcutaneously on the abdomen of mice with 0.4 ml, i.e. the hTIG group, each mouse is injected with 0.2 mL toxin + 0.2 mL hTIG; the antibody group, each mouse is injected with 0.2 mL toxin + 0.2 mL antibody; the negative control group, each mouse is injected with 0.2 mL toxin + 0.2 mL borate buffer. Each group has 6 mice.

[0196] 3. Results

[0197] The results are as follows Figure 2As shown, under the same conditions, when challenged by tetanus toxin, all mice in the negative control group died within 48 h, and all mice in the hTIG group (0.5 IU / ml) and each antibody group (10 μg / mL) survived within 14 days, indicating that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 can effectively protect animals against lethal dose of tetanus toxin challenge at 2 μg, and the effect is equivalent to 0.1 IU hTIG. Thus, it can be shown that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 can effectively neutralize tetanus toxin and protect mice.

[0198] The technical solutions of the present application are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present application fall within the protection scope of the present application.

Claims

1. An antitetracycline toxin antibody or its antigen-binding fragment, wherein the antitetracycline toxin antibody or its antigen-binding fragment comprises: HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 15; and LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO:

16. The CDR is defined according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system.

2. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The anti-tetanus toxin antibody or its antigen-binding fragment includes: VH comprising the following three CDRs: HCDR1 with the amino acid sequence shown in SEQ ID NO: 9, HCDR2 with the amino acid sequence shown in SEQ ID NO: 10, and HCDR3 with the amino acid sequence shown in SEQ ID NO: 11; and / or VL comprising the following three CDRs: LCDR1 with the amino acid sequence shown in SEQ ID NO: 12, LCDR2 with the amino acid sequence shown in SEQ ID NO: 13, and LCDR3 with the amino acid sequence shown in SEQ ID NO: 14; The CDR is defined according to the Kabat numbering system.

3. The antibody or its antigen-binding fragment according to claim 2, characterized in that, The heavy chain variable region of the antitetracycline antibody or its antigen-binding fragment further includes the framework region of the heavy chain variable region; or The light chain variable region of the antitetracycline antibody or its antigen-binding fragment further includes the framework region of the light chain variable region; or The antitetracycline antibody or its antigen-binding fragment further includes a heavy chain constant region and / or a light chain constant region.

4. The antibody or its antigen-binding fragment according to claim 3, characterized in that, The anti-tetanus toxin antibody or its antigen-binding fragment includes: Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO: 15; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO: 16; or The heavy chain constant region comprises the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 51; or The light chain constant region comprises the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 52 or 53; or The anti-tetanus toxin antibody or its antigen-binding fragment is a murine antibody, chimeric antibody, humanized antibody, or fully human antibody; or The anti-tetanus toxin antibody or its antigen-binding fragment includes monoclonal antibodies, Fab fragments, Fab' fragments, Fab'-SH fragments, F(ab')2 fragments, single-chain Fv or dsFv.

5. Biomaterials, including any one of n1)-n9): n1) A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof as described in any one of claims 1-4; n2) An expression cassette containing the nucleic acid molecule described in n1); n3) A carrier containing the nucleic acid molecule described in n1); n4) A carrier containing the expression box described in n2); n5) A cell containing the nucleic acid molecules described in n1); n6) Cells containing the expression cassette described in n2); n7) Cells containing the carrier described in n3); n8) Cells containing the carrier described in n4); n9) Cells comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1-4; None of the cells described in n5)-n9) contain reproductive material.

6. Coupled items, including: The antibody or antigen-binding fragment thereof as described in any one of claims 1-4; and, the coupled part; The coupling portion is a detectable marker.

7. A pharmaceutical composition comprising: The antibody or antigen-binding fragment thereof as described in any one of claims 1-4, or the conjugate as described in claim 6; and a pharmaceutically acceptable carrier.

8. Diagnostic or therapeutic reagent kits, comprising: The antibody or antigen-binding fragment thereof according to any one of claims 1-4, the conjugate according to claim 6, or the pharmaceutical composition according to claim 7.

9. The use of the antibody or antigen-binding fragment thereof according to any one of claims 1-4, the conjugate according to claim 6, or the pharmaceutical composition according to claim 7 in any one of c1)-c4): c1) Prepare products for the diagnosis of Clostridium tetani infection or diseases caused by it; c2) Prepare products for the prevention and / or treatment of Clostridium tetani infection or diseases caused by it; c3) Prepare products for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanus toxin C fragment in a sample. c4) Detect the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanus toxin C fragment; c4) The application described does not involve the diagnosis or treatment of diseases.

10. A method for preparing the antibody or antigen-binding fragment thereof according to any one of claims 1-4, wherein the antibody is obtained by culturing the cells described in claim 5.

Images