Breast cancer detection kit

Abstract

The invention discloses a breast cancer detection kit, the provided detection reagent can perform gene point mutation and gene methylation joint detection on a detected sample, and the detection result can be obtained by detecting the point mutation of MTHFR gene in the detected sample and the promoter region methylation level of MYO1H and BRCA1 genes. The kit ingeniously realizes joint detection of gene point mutation and methylation for judging whether a sample has canceration, is convenient and simple to operate, high in detection sensitivity and good in specificity, and has very positive significance in detection of breast cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biomedical testing, in particular to a breast cancer detection kit. BACKGROUND

[0002] At present, the incidence of breast cancer in various regions of the world is different, but it shows an upward trend. Ultrasound and molybdenum target are the most commonly used imaging examination methods for breast cancer screening. Traditional breast cancer screening mainly relies on physical examination, ultrasound and molybdenum target x-ray examination, and molybdenum target x-ray examination will have certain side effects on the human body. Small cancer foci close to or located on the chest wall and dense breast are prone to missed diagnosis, and it is difficult to detect malignant lesions in the presence of benign and malignant lesions at the same time, and imaging artifacts are easy to mislead. Physical examination and ultrasound examination require breast to produce substantial lesions to be detected, and there is a lack of more sensitive and specific detection methods for early recurrence of breast cancer.

[0003] In recent years, the incidence of breast cancer in China has been increasing year by year, and the age of the disease is showing a trend of younger age. The pathological mechanism of breast cancer is that breast epithelial cells undergo gene mutation under the action of various carcinogenic factors, and change from normal breast cells to tumor cells. Although breast cancer has better treatment effect and longer survival period among all tumors at present, postoperative recurrence and metastasis are still the largest cause of death of breast cancer patients. Therefore, early diagnosis and treatment of breast cancer are of great significance to the prognosis of breast cancer patients, and finding more sensitive and specific tumor markers has very important research value for early detection and prognosis evaluation of breast cancer. With the development of epigenetics, more and more researchers have found that DNA modification plays an important role in the development of breast cancer. The development of breast cancer involves abnormal expression of multiple genes, and DNA methylation and hydroxymethylation play an important role in gene regulation, protein expression and individual development process. Therefore, understanding the relationship between breast cancer gene methylation and hydroxymethylation modification level and gene expression will help to further understand the development mechanism of breast cancer. Therefore, exploring the methylation of genes in breast cancer is of great significance for early diagnosis, accurate prognosis and individualized treatment of breast cancer. SUMMARY

[0004] In view of the prior art, the purpose of the present application is to provide a breast cancer detection kit, which can detect gene point mutation and gene methylation of the tested sample, so as to judge whether the tested sample has canceration. The detection method is simple and convenient, the detection reagent has high sensitivity and good specificity, and the early screening of breast cancer is greatly improved.

[0005] In order to achieve the purpose of the application, the technical scheme provided by the present application is as follows: The application provides a breast cancer detection kit, characterized by comprising MTHFR PCR reaction solution for detecting whether point mutation of MTHFR gene (RS1801131) occurs or not; comprising BRCA1 and MYO1H PCR reaction solution for detecting methylation degree in at least one target region in promoter region of BRCA1 gene and MYO1H gene; further comprising methylation positive control, point mutation positive control and negative control; The MTHFR, BRCA1 and MYO1H genes are all closely related to the progress of breast cancer, and the promoter region is not strictly limited to the region in the promoter fragment, but the gene fragment in the region near the promoter.

[0006] The MTHFR PCR reaction solution comprises MTHFR forward primer, MTHFR reverse primer, MTHFR probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the MTHFR forward primer is ACTCACTTTGTGACCATTCCG, the base sequence of the MTHFR reverse primer is CTGAAGAGCAAGTCCCCC, and the base sequence of the MTHFR probe is AAAGACACTTGCTTCACTGG.

[0007] The sequence of the MTHFR PCR reaction solution for the detection region of MTHFR point mutation is as follows: CAGGGGATGAACCAGGGTCCCCACTCCAGCATCACTCACTTTGTGACCATTCCGGTTTGGTTCTCCCGAGAGGTAAAGAACGAAGACTTCAAAGACACTT[T / G]CTTCACTGGTCAGCTCCTCCCCCCACATCTTCAGCAGCTCCTCCTTGGGGGACTTGCTCTTCAGGTAGAAGAGGTAGTAGTCCTTCAGCTCCCCAAAGGC.

[0008] The BRCA1 and MYO1H PCR reaction solution comprises BRCA1 forward and reverse primers, BRCA1 probe, MYO1H forward and reverse primers, MYO1H probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the BRCA1 forward primer is TTATTATTTGTTTTTTAAAAC, the base sequence of the BRCA1 reverse primer is TAATCCTCTAAAATCAATAACCTAC, and the base sequence of the BRCA1 probe is GCGTAGATGTGGGTTAGAGCGG; the base sequence of the MYO1H forward primer is TTGATGATATAGTATGGTTTTTTTT, the base sequence of the MYO1H reverse primer is AAAACACTAATCCCCTACCTACTAC, and the base sequence of the MYO1H probe is TTCGCGTATTGTACGTGGATTTTTGC.

[0009] The sequence of the BRCA1 methylation detection region of the BRCA1 and MYO1H PCR reaction solution is as follows: TAGGTAACCGCAGCTGCTTCCTTACCAGCTTCCCGCCCCCGGGGGGCGCCTGCCGGAGGCCAATGCAAGGACCGTCCGCTACCGGCTCTGCCGCTATCCCTGTGGGGTGAATCTAACATGGCGGATAAAGACAGTAACTAGTCCCCTGTTTCTCCGAGTGTTCGCCAAGATGATTGGCTCTCACCACTTGTCCCTCAAAACGACCACGCCATTGATTGGTGGAGATTGCGTCGATGGGGCGGGGCAGAAGCAACCTGAACCCGAACAACAATAACAAACATTGAGGCTGAGGGGCGGAACTAGGAGTGCGCAGATGTGGGCCAGAGCGGATTTCCCCTTCCCCAGGCAAATTCGGCGCCCACTGCGTCCCCGCAGGCCACTGACCTTAGAGGACTACTTGCCCGAGACTCGTGGGGCTGGATGGGAATCGTAGTCTTCCTAGGAGTTGTAGGTATCTTTTTTTGGCCTAGTCTCTGCTCTCAAGATAGGAGAACATAA. The sequence of the MYO1H methylation detection region is as follows: ATTGCCACGGCAGCAACGATATTAGGCACGGCTACCCCCATTCTTTCGTTACTTATTGACGCCTGCTTCTGGGTTCTTCTTCGCATCAGCCCTTGATGACATAGCATGGTCCTCCTTTTGCATGGGGGGAACCCAAAGCCCCGAGCGGCAGTGAGTGGGTCGGCGGCGCACGGGCAGAGCGCGGGCTCCCGCACCTCCCCAGCTCGCGTACTGCACGTGGACCTCTGCGCCGCCCCCACCGAGTGAGGCTCAGGCACCCGAAGCGTCTGGAGTTGTTTTGAGGCTGTCCTCGCGTTATCTACTTCGCAGCAGGCAGGGGACCAGTGTCCCCGCACCTGTGACTGTTTTTTTTTTTTTAAACCCAGTGTTTAAGTTCAGGAAGAACTCAGGGCTCCCCTGGA.

[0010] The base sequence of the ACTB forward primer is TAGGATTTTTATTTAG, the base sequence of the ACTB reverse primer is TGTGAATTTTTGTTAT, and the base sequence of the ACTB probe is TTTTAAGGGAGGAGT.

[0011] The MTHFR probe, the BRCA1 probe, the MYO1H probe, and the ACTB probe are respectively labeled with a fluorescent reporter group and a fluorescent quenching group at two ends; the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5; and the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0012] The methylation positive control is selected from DNA of human breast cancer cells MCF-7, and the point mutation positive control is selected from an MTHFR positive artificial synthesized plasmid; and the negative control is sterile water.

[0013] The Taq enzyme in the MTHFR PCR reaction solution and the BRCA1 and MYO1H PCR reaction solution can be a commonly used Taq DNA polymerase in the art.

[0014] The formula amount of the PCR buffer, MgC12 and dNTP in the MTHFR PCR reaction liquid and the BRCA1 and MYO1H PCR reaction liquid can be selected according to the conventional method in the art, and the appropriate formula amount of individual reagent can be mixed, or a commercial reaction system product can be directly selected, and the difference of these components has no obvious influence on the experimental effect. The PCR buffer can be a conventional buffer in the art, for example, 30-60 mmol / L of Tris and 10-50 mmol / L of KC1, or 30-600 mmol / L of Tris and 10-50 mmol / L of KAc, or 30-60 mmol / L of Tris and 10-50 mmol / L of CsC1, etc. These differences have no significant influence on the reagent and detection result of the present application.

[0015] The MTHFR gene sequence involved in the present application has the NCBI database number of NC_000001.11, the BRCA1 gene and the MYO1H gene have the NCBI database numbers of NC_000017.11 and NC_000012.12, respectively.

[0016] The breast cancer detection kit provided by the present application has the following steps in the application method: S1. Extracting the sample DNA1 to be detected from the peripheral blood sample; S2. Part of the sample DNA1 to be detected is treated by bisulfite conversion to obtain purified Bis-DNA for gene methylation detection; S3. MTHFR gene point mutation detection: The sample DNA1 to be detected is used as a template, and the primers and probe combination in the MTHFR PCR reaction liquid are used for PCR amplification reaction, ACTB is selected as an internal reference gene for the target gene MTHFR (RS1801131), and the target gene and the internal reference gene are simultaneously detected according to the multi-channel fluorescent probe labeling; S4. BRCA1 and MYO1H gene methylation detection: The purified Bis-DNA is used as a template, and the primers and probe combination in the BRCA1 and MYO1H PCR reaction liquid are used for PCR amplification reaction, ACTB is selected as an internal reference gene for the target gene and the internal reference gene, and the target gene and the internal reference gene are simultaneously detected according to the multi-channel fluorescent probe labeling; S5. According to the Ct value of the MTHFR gene and the ΔCt value (target Ct value-internal reference Ct value) of the BRCA1 gene and the MYO1H gene obtained according to the above steps S3, S4: X1 = the Ct value of BRCA1 minus the Ct value of ACTB, X2 = the Ct value of MYO1H minus the Ct value of ACTB, the methylation degree is determined by substituting the regression equation Y = 3.445-0.478*X1-0.055*X2, when Y is greater than or equal to 0, it is determined that the sample to be detected is positive for the methylation of the BRCA1 gene and the MYO1H gene; when Y is less than 0, it is determined that the sample to be detected is negative for the methylation of the BRCA1 gene and the MYO1H gene; when the Ct value of the MTHFR gene is less than or equal to 32 and the Ct value of the ACTB gene is less than or equal to 32, it is determined that the MTHFR gene has a mutation; when the Ct value of the MTHFR gene is greater than 32 or there is no Ct value and the Ct value of the ACTB gene is less than or equal to 32, it is determined that the MTHFR gene has no mutation; The detection result is that at least one of the point mutation of the MTHFR gene and the positive methylation occurs, and the sample is determined to be positive; and the point mutation of the MTHFR gene does not occur and the methylation is negative at the same time, and the sample is determined to be negative.

[0017] The present application has the following advantages: 1. The breast cancer detection kit provided by the present application contains detection reagents that can detect the point mutation of the MTHFR gene and the combined detection of the methylation of the BRCA1 and MYO1H genes. The MTHFR gene, the BRCA1 gene and the MYO1H gene are closely related to the progress of breast cancer. The detection of the MTHFR gene includes the mutation of the RS1801131 site, and the methylation detection region of the BRCA1 and MYO1H genes includes multiple CpGs, which reduces the randomness of base changes compared to single base detection. The combined detection of the point mutation of the MTHFR gene, the methylation of the BRCA1 gene and the MYO1H gene effectively supplements the differences caused by site selection and reaction system, improves the accuracy of breast cancer detection, and the application method is simple and convenient, which is suitable for clinical detection.

[0018] 2. The detection reagent provided by the present application selects ACTB as an internal reference gene for three target genes, realizes the simultaneous detection of target genes and internal reference genes according to multi-channel fluorescent probe labeling, and finally determines the experimental results according to the Ct values of the three genes.

[0019] 3. The detection reagent provided by the present application adopts fluorescent quantitative PCR technology to jointly detect point mutations of the MTHFR gene, methylation of the BRCA1 gene and the MYO1H gene of urine cells of a patient, and through Bis-DNA after DNA of a sample and heavy metabisulfite treatment, the detection reagent provided by the present application adopts specific primers and fluorescent probes to amplify nucleic acid, so as to realize rapid detection of point mutations of the MTHFR gene, methylation of the BRCA1 gene and the MYO1H gene, and provide a simpler and more accurate screening for the clinic. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Fig. 1 is a schematic diagram of the overall structure of the breast cancer detection kit of the present application; (Labelling: 1. MTHFR PCR reaction solution, 2. BRCA1 and MYO1H PCR reaction solution, 3. Methylation positive control, 4. Point mutation positive control, 5. Negative control); Figure 2 Fig. 2 is a qPCR instrument fluorescence detection channel selection and amplification cycle parameter setting table in Example 2 of the present application; Figure 3 Fig. 3 is a typical breast cancer peripheral blood sample gene (MTHFR, BRCA1, MYO1H) PCR amplification curve in the verification experiment of the present application; Figure 4 Fig. 4 is a typical normal peripheral blood sample gene (MTHFR, BRCA1, MYO1H) PCR amplification curve in the verification experiment of the present application; Figure 5 Fig. 5 is a comparison table of the detection results of the breast cancer detection kit and the pathological detection results in the verification experiment of the present application; Figure 6 Fig. 6 is a ROC control curve of normal people and breast cancer patients detected by the breast cancer detection kit in the verification experiment of the present application. DETAILED DESCRIPTION

[0021] Example 1

[0022] The nucleotide sequences of the MTHFR, BRCA1, MYO1H genes to be detected, the MTHFR forward and reverse primers, the MTHFR probe, the BRCA1 forward and reverse primers, the BRCA1 probe, the MYO1H forward and reverse primers, the MYO1H probe, the ACTB forward and reverse primers, and the ACTB probe are submitted to the State Intellectual Property Office in the form of annexes, and the sequence list conforms to the ST.26 standard.

[0023] As Figure 1As shown, the breast cancer detection kit is characterized in that it comprises MTHFR PCR reaction liquid 1 for detecting whether point mutation of MTHFR gene (RS1801131) occurs; BRCA1 and MYO1H PCR reaction liquid 2 for detecting the methylation degree in at least one target region in the promoter region of BRCA1 gene and MYO1H gene; and methylation positive control 3, point mutation positive control 4, and negative control 5; the MTHFR, BRCA1 and MYO1H genes are closely related to the progress of breast cancer, and the promoter region is not strictly limited to the region in the promoter fragment, but the gene fragment in the region near the promoter.

[0024] The MTHFR PCR reaction liquid comprises MTHFR forward and reverse primers, MTHFR probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the MTHFR forward primer is ACTCACTTTGTGACCATTCCG, the base sequence of the MTHFR reverse primer is CTGAAGAGCAAGTCCCCC, and the base sequence of the MTHFR probe is AAAGACACTTGCTTCACTGG.

[0025] The BRCA1 and MYO1H PCR reaction liquid comprises BRCA1 forward and reverse primers, BRCA1 probe, MYO1H forward and reverse primers, MYO1H probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the BRCA1 forward primer is TTATTATTTGTTTTTTAAAAC, the base sequence of the BRCA1 reverse primer is TAATCCTCTAAAATCAATAACCTAC, and the base sequence of the BRCA1 probe is GCGTAGATGTGGGTTAGAGCGG; the base sequence of the MYO1H forward primer is TTGATGATATAGTATGGTTTTTTTT, the base sequence of the MYO1H reverse primer is AAAACACTAATCCCCTACCTACTAC, and the base sequence of the MYO1H probe is TTCGCGTATTGTACGTGGATTTTTGC.

[0026] The base sequence of the internal reference ACTB forward primer is TAGGATTTTTATTTAG, the base sequence of the internal reference ACTB reverse primer is TGTGAATTTTTGTTAT, and the base sequence of the internal reference ACTB probe is TTTTAAGGGAGGAGT.

[0027] The two ends of the MTHFR probe, the BRCA1 probe, the MYO1H probe and the ACTB probe are respectively labeled with a fluorescent reporter group and a fluorescent quenching group; the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; and the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0028] In the embodiment of the present application, the fluorescent reporter group and the fluorescent quenching group of the MTHFR probe and the internal reference probe in the MTHFR PCR reaction solution are set as follows: the 5' end reporter group of the MTHFR fluorescent probe is FAM, the 3' end quenching group is BHQ1, the 5' end fluorescent reporter group of the internal reference gene fluorescent probe is VIC, and the 3' end quenching group is BHQ1. In the BRCA1 and MYO1H PCR reaction solution, the fluorescent reporter group and the fluorescent quenching group of the BRCA1 probe, the MYO1H probe and the ACTB probe are set as follows: the 5' end reporter group of the BRCA1 fluorescent probe is FAM, the 3' end quenching group is BHQ1; the 5' end reporter group of the MYO1H fluorescent probe is VIC, the 3' end quenching group is BHQ1; and the 5' end fluorescent reporter group of the internal reference gene fluorescent probe is ROX, and the 3' end quenching group is BHQ1.

[0029] The Taq enzyme in the MTHFR PCR reaction solution and the BRCA1 and MYO1H PCR reaction solution can be the commonly used Taq DNA polymerase in the art.

[0030] The formula amount of the PCR buffer, MgC12 and dNTP in the MTHFR PCR reaction solution and the BRCA1 and MYO1H PCR reaction solution can be selected according to the conventional method in the art, and the appropriate formula amount of a single reagent can be mixed by itself, or a commercially available reaction system product can be directly selected. The difference of these components has no obvious influence on the experimental effect. The PCR buffer can be the conventional buffer in the art, for example, 30-60 mmol / L of Tris and 10-50 mmol / L of KC1, or 30-600 mmol / L of Tris and 10-50 mmol / L of KAc, or 30-60 mmol / L of Tris and 10-50 mmol / L of CsC1, etc. These differences have no significant influence on the reagents and detection results of the present application.

[0031] The preferred implementation specification of the breast cancer detection kit of the present application is prepared by the following components in the ratio (as shown in Table 1): The MTHFR PCR reaction liquid 400ul includes MTHFR forward primer 0.2umol / L-0.5umol / L, MTHFR reverse primer 0.2umol / L-0.5umol / L, MTHFR probe 0.1-0.5umol / L, internal reference ACTB forward primer 0.2umol / L-0.5umol / L, internal reference ACTB reverse primer 0.2umol / L-0.5umol / L, internal reference ACTB probe 0.1-0.5umol / L, PCR buffer, MgCl2 2-8mmol / L, dNTP 0.2-0.4mmol / L and Taq enzyme 200U / ml-1000U / ml; The BRCA1 and MYO1H PCR reaction liquid 400ul includes BRCA1 forward primer 0.2umol / L-0.5umol / L, BRCA1 reverse primer 0.2umol / L-0.5umol / L, BRCA1 probe 0.1-0.5umol / L, MYO1H forward primer 0.2umol / L-0.5umol / L, MYO1H reverse primer 0.2umol / L-0.5umol / L, MYO1H probe 0.1-0.5umol / L, PCR buffer, MgCl2 2-8mmol / L, dNTP 0.2-0.4mmol / L and Taq enzyme 200U / ml-1000U / ml.

[0032] Methylation positive control, 50ul; Point mutation positive control, 50ul; Negative control, 50ul.

[0033] Table 1. Kit component table Component Main component Specification MTHFR PCR reaction solution MTHFR forward primer, MTHFR reverse primer, MTHFR probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, PCR buffer, dNTP, MgCl2 and Taq enzyme. 400ul BRCA1 and MYO1H PCR reaction solution BRCA1 and MYO1H forward primer, BRCA1 and MYO1H reverse primer, BRCA1 and MYO1H probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, 10x buffer, PCR buffer, dNTP, MgCl2 and Taq enzyme. 400ul Methylation positive control DNA of human breast cancer cell MCF-7 50ul Point mutation positive control MTHFR positive artificial synthesis plasmid 50ul Negative control Sterile water 50ul Further, the methylation positive control is selected from the DNA of human breast cancer cells MCF-7, and the point mutation positive control is selected from MTHFR positive artificial plasmid: Further, the negative control is sterile water.

[0034] Example 2 The present embodiment provides the application method of the breast cancer detection kit (prepared according to the specifications and components of Table 1) of Example 1, which specifically includes the following steps: S1. Extracting the DNA 1 of the sample to be detected from the human peripheral blood sample; After the extraction is completed, the concentration and OD260 / OD280 of the DNA are determined using a Nano-500 type microspectrophotometer, and the OD260 / OD280 is between 1.6-2.0.

[0035] S2. The part of the sample DNA 1 is treated by bisulfite conversion, and the purified Bis-DNA is used for gene methylation detection; The sample DNA 1 is treated by bisulfite conversion, and the unmethylated cytosine c is converted into uracil (U), while the methylated cytosine (C) remains unchanged, and the purified Bis-DNA is obtained. The Bis-DNA should be detected in time, and can be stored at -20°C for detection, and the storage period is generally not more than 4 months, and long-term storage should be placed at -80°C.

[0036] S3. MTHFR gene point mutation detection: An appropriate amount of MTHFR PCR reaction liquid in the kit and an appropriate amount of sample DNA 1 in step S1 are taken and added into PCR reaction tubes, and an MTHFR gene PCR reaction system is prepared, and the MTHFR gene PCR reaction system is composed as follows: the volume of MTHFR PCR reaction liquid is 15 uL, the volume of DNA 1 template is 2-5 uL, and the volume of sterile water up to is 20 uL; Then, the qPCR instrument is used for PCR amplification reaction and detection: taking the sample DNA 1 as the template, the primers and the probe combination in the MTHFR PCR reaction liquid are used for PCR amplification reaction, ACTB is selected as the internal reference gene for the target gene MTHFR (RS1801131), and the simultaneous detection of the target gene and the internal reference gene is realized according to the multi-channel fluorescent probe labeling; S4. BRCA1 and MYO1H gene methylation detection: An appropriate amount of BRCA1 and MYO1H PCR reaction liquid in the kit and an appropriate amount of Bis-DNA in step S2 are taken and added into PCR reaction tubes, and a BRCA1 and MYO1H gene PCR reaction system is prepared, and the BRCA1 and MYO1H PCR reaction system is composed as follows: the volume of BRCA1 and MYO1H PCR reaction liquid is 15 uL, the volume of Bis-DNA template is 2-5 uL, and the volume of sterile water up to is 20 uL; Then, the qPCR instrument is used for PCR amplification reaction and detection: taking the purified Bis-DNA as the template, the primers and the probe combination in the BRCA1 and MYO1H PCR reaction liquid are used for PCR amplification reaction, ACTB is selected as the internal reference gene for the two target genes BRCA1 and MYO1H, and the simultaneous detection of the target gene and the internal reference gene is realized according to the multi-channel fluorescent probe labeling; S5. The Ct value of the MTHFR gene and the ΔCt value (target Ct value-internal reference Ct value) of the BRCA1 gene and the MYO1H gene are obtained according to the above steps S3 and S4: X1 = the Ct value of BRCA1 minus the Ct value of ACTB, and X2 = the Ct value of MYO1H minus the Ct value of ACTB, which are substituted into the regression equation Y = 3.445-0.478*X1-0.055*X2 to determine the degree of methylation, when Y≥0, it is determined that the sample to be detected is positive for the methylation of the BRCA1 gene and the MYO1H gene; when Y<0, it is determined that the sample to be detected is negative for the methylation of the BRCA1 gene and the MYO1H gene; when the Ct value of the MTHFR gene is ≤32 and the Ct value of the ACTB gene is ≤32, it is determined that the MTHFR gene has a mutation; when the Ct value of the MTHFR gene is >32 or no Ct value and the Ct value of the ACTB gene is ≤32, it is determined that the MTHFR gene has no mutation; The detection result is that at least one of the MTHFR gene point mutation and the methylation is positive, and the sample is determined to be positive; and the MTHFR gene point mutation and the methylation are both negative, and the sample is determined to be negative.

[0037] In the above steps S3 and S4, the PCR reaction tube is an eight-row tube, the PCR reaction system is prepared to have a final volume of 20 μL per tube, the tube cap is tightly covered, and the tube is centrifuged at a low speed for a short time, and then PCR amplification and detection are performed on a qPCR instrument.

[0038] Before PCR amplification and detection, the fluorescence detection channel selection and amplification cycle parameter setting are performed on the qPCR instrument according to the data shown in Table 2 in the above embodiment. Figure 2 Note: ROX correction is not selected, and the quenching group is selected as None; after the setting is completed, the file is saved, and the reaction program is run.

[0039] Example 3 This example is a verification experiment of the breast cancer detection kit of the present application.

[0040] The kit detection and clinical pathological detection are performed on 60 peripheral blood samples in the verification experiment.

[0041] The results of the combined detection of gene point mutation and methylation (MTHFR, BRCA1, and MYO1H) of the 60 peripheral blood samples by using the breast cancer detection kit of the present application are shown in Tables 2 and 3. Figure 3 Figure 4

[0042] Figure 3 The PCR amplification curves of the typical breast cancer peripheral blood sample genes (MTHFR, BRCA1, and MYO1H) in the verification experiment of the present application are shown in FIG. 1. The kit primer probe combinations used are MTHFR (F / R / P), BRCA1 (F / R / P), and SC21 (F / R / P).​​Figure 3 It is shown that the Ct value of at least one of the MTHFR gene, the BRCA1 gene and the MYO1H gene in the breast cancer sample is ≤32.

[0043] Figure 4 It is a typical normal human peripheral blood sample gene (MTHFR, BRCA1, MYO1H) PCR amplification curve in the verification experiment of the application. The primer probe combination of the kit used is MTHFR (F / R / P), BRCA1 (F / R / P), SC21 (F / R / P), Figure 4 It is shown that the Ct value of the MTHFR gene, the BRCA1 gene and the MYO1H gene in the normal human peripheral blood sample is >32.

[0044] Logistic regression analysis: The logistic regression equation for judging the methylation of the genes of the normal sample, the breast cancer sample and the above conditions obtained through experiments is Y=3.445-0.478*X1-0.055*X2; wherein A0, A1 and A2 are clinical coefficients, and the weight relationship of the clinical coefficients is as follows: the proportion coefficient of BRCA1 is A1=-0.478, the proportion coefficient of MYO1H is A2=-0.059, and the proportion coefficient of the constant is A0=-0.55.

[0045] The difference between the amplification cycle numbers of the BRCA1 gene and the MYO1H gene and the internal reference gene ACTB is X1 and X2 respectively. X1=the Ct value of BRCA1 minus the Ct value of ACTB, and X2=the Ct value of MYO1H minus the Ct value of ACTB. The methylation degree is determined by substituting the regression equation Y=3.445-0.478*X1-0.055*X2. When Y≥0, it is determined that the sample to be detected is breast cancer methylation positive; and when Y<0, it is determined that the sample to be detected is breast cancer methylation negative.

[0046] Through the analysis of the methylation fitting regression of the BRCA1 gene and the MYO1H gene and the combined detection of the MTHFR point mutation on breast cancer lesions, the sensitivity and specificity are much higher than the detection and analysis results of the single gene of MTHFR, BRCA1 and MYO1H.

[0047] Figure 5 It is a comparison table of the detection results of the breast cancer detection kit and the pathological detection results in the verification experiment of the application.

[0048] Figure 6 It is a ROC control curve of the normal person and the breast cancer patient detected by the breast cancer detection kit of the application in the verification experiment of the application, as shown in Figure 6As shown by the ROC curve, the detection kit provided by the present invention can clearly distinguish breast cancer patients from normal people, and the area under the ROC curve (AUC) is 0.907 (95% CI 0.82-0.993; P < 0.001).

[0049] pass Figure 3 、 Figure 4 The experimental data were compared with the clinical pathological diagnosis results (such as Figure 5 shown), and Figure 6 As shown in the ROC curve, the accuracy of the breast cancer detection kit provided in Example 1 of the present invention can reach 88.3%, and the detection sensitivity and specificity are 87% and 90% respectively.

[0050] The above experiments demonstrate that the detection reagent in the breast cancer detection kit provided by the present invention has high sensitivity and specificity, with a high detection accuracy rate. The detection reagent provided by the present invention uses specific primers and fluorescent probes to amplify nucleic acids to achieve rapid detection of MTHFR gene point mutations, BRCA1 gene methylation, and MYO1H gene methylation, providing a simpler and more accurate clinical screening. The breast cancer detection reagent provided by the present invention effectively compensates for differences that may be caused by site selection and reaction system by combining MTHFR point mutations, BRCA1, and MYO1H methylation detection, improving the accuracy of breast cancer detection. Its application method is simple and convenient, making it suitable for clinical testing.

Claims

1. A breast cancer detection kit, characterized by, The kit comprises MTHFR PCR reaction solution for detecting whether point mutation of MTHFR gene (RS1801131) occurs; BRCA1 and MYO1H PCR reaction solution for detecting methylation degree in at least one target region in promoter region of BRCA1 gene and MYO1H gene; and methylation positive control, point mutation positive control and negative control; the MTHFR, BRCA1 and MYO1H genes are closely related to the progress of breast cancer, and the promoter region is not strictly limited to the region in the promoter fragment, but the gene fragment in the region near the promoter.

2. The breast cancer detection kit according to claim 1, wherein The MTHFR PCR reaction solution comprises MTHFR forward primer, MTHFR reverse primer, MTHFR probe, ACTB internal reference forward primer, ACTB internal reference reverse primer, ACTB internal reference probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the MTHFR forward primer is ACTCACTTTGTGACCATTCCG, the base sequence of the MTHFR reverse primer is CTGAAGAGCAAGTCCCCC, and the base sequence of the MTHFR probe is AAAGACACTTGCTTCACTGG.

3. The breast cancer detection kit according to claim 1 or 2, characterized in that, The MTHFR PCR reaction solution is for detecting the target region of MTHFR point mutation, and the sequence is as follows: CAGGGGATGAACCAGGGTCCCCACTCCAGCATCACTCACTTTGTGACCATTCCGGTTTGGTTCTCCCGAGAGGTAAAGAACGAAGACTTCAAAGACACTT[T / G]CTTCACTGGTCAGCTCCTCCCCCCACATCTTCAGCAGCTCCTCCTTGGGGGACTTGCTCTTCAGGTAGAAGAGGTAGTAGTCCTTCAGCTCCCCAAAGGC.

4. The breast cancer detection kit according to claim 1, wherein The BRCA1 and MYO1H PCR reaction solution comprises BRCA1 forward primer, BRCA1 reverse primer, BRCA1 probe, MYO1H forward primer, MYO1H reverse primer, MYO1H probe, ACTB internal reference forward primer, ACTB internal reference reverse primer, ACTB internal reference probe, PCR buffer, MgCl2, dNTP and Taq enzyme; the base sequence of the BRCA1 forward primer is TTATTATTTGTTTTTTAAAAC, the base sequence of the BRCA1 reverse primer is TAATCCTCTAAAATCAATAACCTAC, and the base sequence of the BRCA1 probe is GCGTAGATGTGGGTTAGAGCGG; the base sequence of the MYO1H forward primer is TTGATGATATAGTATGGTTTTTTTT, the base sequence of the MYO1H reverse primer is AAAACACTAATCCCCTACCTACTAC, and the base sequence of the MYO1H probe is TTCGCGTATTGTACGTGGATTTTTGC.

5. The breast cancer detection kit according to claim 1 or 5, wherein The BRCA1 and MYO1H PCR reaction liquid, the sequence of the to-be-detected region of BRCA1 methylation thereof is as follows: TAGGTAACCGCAGCTGCTTCCTTACCAGCTTCCCGCCCCCGGGGGGCGCCTGCCGGAGGCCAATGCAAGGACCGTCCGCTACCGGCTCTGCCGCTATCCCTGTGGGGTGAATCTAACATGGCGGATAAAGACAGTAACTAGTCCCCTGTTTCTCCGAGTGTTCGCCAAGATGATTGGCTCTCACCACTTGTCCCTCAAAACGACCACGCCATTGATTGGTGGAGATTGCGTCGATGGGGCGGGGCAGAAGCAACCTGAACCCGAACAACAATAACAAACATTGAGGCTGAGGGGCGGAACTAGGAGTGCGCAGATGTGGGCCAGAGCGGATTTCCCCTTCCCCAGGCAAATTCGGCGCCCACTGCGTCCCCGCAGGCCACTGACCTTAGAGGACTACTTGCCCGAGACTCGTGGGGCTGGATGGGAATCGTAGTCTTCCTAGGAGTTGTAGGTATCTTTTTTTGGCCTAGTCTCTGCTCTCAAGATAGGAGAACATAA. The sequence of the to-be-detected region of MYO1H methylation thereof is as follows: ATTGCCACGGCAGCAACGATATTAGGCACGGCTACCCCCATTCTTTCGTTACTTATTGACGCCTGCTTCTGGGTTCTTCTTCGCATCAGCCCTTGATGACATAGCATGGTCCTCCTTTTGCATGGGGGGAACCCAAAGCCCCGAGCGGCAGTGAGTGGGTCGGCGGCGCACGGGCAGAGCGCGGGCTCCCGCACCTCCCCAGCTCGCGTACTGCACGTGGACCTCTGCGCCGCCCCCACCGAGTGAGGCTCAGGCACCCGAAGCGTCTGGAGTTGTTTTGAGGCTGTCCTCGCGTTATCTACTTCGCAGCAGGCAGGGGACCAGTGTCCCCGCACCTGTGACTGTTTTTTTTTTTTTAAACCCAGTGTTTAAGTTCAGGAAGAACTCAGGGCTCCCCTGGA.

6. The breast cancer detection kit according to claim 2 or 4, wherein The base sequence of the internal reference ACTB forward primer is TAGGATTTTTATTTAG, the base sequence of the internal reference ACTB reverse primer is TGTGAATTTTTGTTAT, and the base sequence of the internal reference ACTB probe is TTTTAAGGGAGGAGT.

7. The breast cancer detection kit according to claim 2, wherein The MTHFR PCR reaction solution comprises 0.2-0.5 μmol / L of the MTHFR forward primer, 0.2-0.5 μmol / L of the MTHFR reverse primer, 0.1-0.5 μmol / L of the MTHFR probe, 0.2-0.5 μmol / L of the internal reference ACTB forward primer, 0.2-0.5 μmol / L of the internal reference ACTB reverse primer, 0.1-0.5 μmol / L of the internal reference ACTB probe, a PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme.

8. The breast cancer detection kit according to claim 4, wherein The BRCA1 and MYO1H PCR reaction solution comprises 0.2-0.5 μmol / L of the BRCA1 forward primer, 0.2-0.5 μmol / L of the BRCA1 reverse primer, 0.1-0.5 μmol / L of the BRCA1 probe, 0.2-0.5 μmol / L of the MYO1H forward primer, 0.2-0.5 μmol / L of the MYO1H reverse primer, 0.1-0.5 μmol / L of the MYO1H probe, a PCR buffer, 2-8 mmol / L of MgCl2, 0.2-0.4 mmol / L of dNTP, and 200-1000 U / ml of Taq enzyme.

9. The breast cancer detection kit according to claim 1, wherein The methylation positive control is selected from the DNA of human breast cancer cells MCF-7, and the point mutation positive control is selected from an MTHFR positive artificial synthetic plasmid; and the negative control is sterile water.

Images