Low temperature response transcription factor and application thereof in regulating starch degradation of syzygium samarangense fruit
By cloning and expressing the low-temperature-responsive transcription factor AaHATL, the activity of amylase in custard apple and tomato fruits was inhibited, solving the problem of starch degradation in fruits at low temperatures, thereby increasing the starch content and extending the shelf life of the fruits and improving fruit quality.
Patent Information
- Application Number
- CN202511368048.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-24
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-09-24
AI Technical Summary
Custard apples are prone to physiological diseases under low temperature conditions, which delays ripening. Current technology lacks effective gene regulation methods to increase the starch content of the fruit and delay ripening and softening.
The low-temperature-responsive transcription factor AaHATL was cloned and expressed. By binding to the promoter of the β-amylase gene AaBAM3 in custard apple and tomato fruits, it inhibited starch degradation, increased the starch content of the fruits, and delayed ripening and softening.
It significantly increases the starch content of tomatoes and custard apples, extends their shelf life, and improves fruit quality. It is suitable for improving tomato and custard apple varieties, delaying fruit ripening and softening, and promoting storage and transportation.
Smart Images

Figure CN120842348B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biology, specifically relating to a low-temperature responsive transcription factor and its application in regulating starch degradation in custard apple fruit. Background Technology
[0002] Custard apple (scientific name: Annona squamosa (Linn.) is a deciduous small tree belonging to the Annonaceae family and the Annonaceae genus. Custard apples are rich in Vitamin C, which has a blood sugar-lowering effect and is an excellent antioxidant fruit, effectively delaying skin aging and whitening the skin. Custard apples are also high in fiber, effectively promoting intestinal peristalsis and eliminating accumulated waste. Normal growth of custard apples requires a warm climate and adequate rainfall; they are intolerant of frost and cold weather. The optimal growth temperature for common custard apples averages a maximum of 25-32℃ and a minimum of 15-25℃, with an optimal average temperature of 25-30℃ for fruit ripening. Low temperatures, especially below 13℃, can cause physiological diseases in the fruit, often resulting in rust spot and delayed ripening. Therefore, temperature is crucial for the growth of custard apple plants. Developing temperature-related genes and studying their regulatory functions is of great significance for the breeding of new custard apple varieties. Summary of the Invention
[0003] This invention provides a low-temperature responsive transcription factor and its application in regulating starch degradation in custard apple fruit, providing candidate genes for custard apple variety breeding.
[0004] The technical solution of this invention is implemented as follows:
[0005] The first aspect of the present invention is to provide a low-temperature responsive transcription factor AaHATL, which is a protein encoded by a gene with a nucleotide sequence as shown in SEQ ID NO:1.
[0006] A second aspect of the present invention is to provide a transcription factor gene encoding the low-temperature response transcription factor AaHATL as described in the first aspect of the present invention, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0007] A third aspect of the present invention is to provide a recombinant vector containing the coding region gene of the transcription factor AaHATL as described in the first aspect of the present invention.
[0008] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is the pET30a plasmid; however, it should be understood that other plasmids or viruses can also be used.
[0009] Preferably, the original vector of the recombinant vector is pET30a plasmid, and the transcription factor AaHATL gene coding region is located between the NcoI and SpeI restriction enzyme sites of the pCAMBIA1304 expression vector.
[0010] The fourth aspect of the present application provides a host bacterium containing the transcription factor AaHATL gene coding region of the second aspect.
[0011] The fifth aspect of the present application provides an expression cassette containing the transcription factor AaHATL gene coding region of the second aspect of the present application.
[0012] The sixth aspect of the present application provides the use of the transcription factor AaHATL of the first aspect of the present application, or the transcription factor gene of the second aspect of the present application, or the recombinant vector of the third aspect of the present application, or the host bacterium of the fourth aspect of the present application, or the expression cassette of the fifth aspect of the present application in improving the growth activity of yeast in SD / -Leu medium containing 300 ng / mL AbA inhibitory concentration.
[0013] The seventh aspect of the present application provides the use of the transcription factor AaHATL of the first aspect of the present application, or the transcription factor gene of the second aspect of the present application, or the recombinant vector of the third aspect of the present application, or the host bacterium of the fourth aspect of the present application, or the expression cassette of the fifth aspect of the present application in improving the starch content of plant fruits.
[0014] The transcription factor gene is overexpressed to improve the starch content of tomato and / or annona squamosa fruits.
[0015] The eighth aspect of the present application provides the use of the transcription factor AaHATL of the first aspect of the present application, or the transcription factor gene of the second aspect of the present application, or the recombinant vector of the third aspect of the present application, or the host bacterium of the fourth aspect of the present application, or the expression cassette of the fifth aspect of the present application in inhibiting the expression of annona squamosa AaBAM3 gene, the nucleotide sequence of which is shown in SEQ ID NO: 2.
[0016] The ninth aspect of the present application provides the use of the transcription factor AaHATL of the first aspect of the present application, or the transcription factor gene of the second aspect of the present application, or the recombinant vector of the third aspect of the present application, or the host bacterium of the fourth aspect of the present application, or the expression cassette of the fifth aspect of the present application in improving the soluble sugar content of tomato fruits and / or not reducing the soluble solid content of tomato fruits.
[0017] The tenth aspect of the present application provides the use of the transcription factor AaHATL according to the first aspect of the present application, or the transcription factor gene according to the second aspect of the present application, or the recombinant vector according to the third aspect of the present application, or the host cell according to the fourth aspect of the present application, or the expression cassette according to the fifth aspect of the present application in delaying the post-harvest softening of the sugar apple and / or prolonging the shelf life of the sugar apple.
[0018] The eleventh aspect of the present application provides a primer pair, which is F: CCATTCTTCTATGGGCTTCC and R: TGGCTTGAACTATGGTGGA.
[0019] The beneficial effects of the present application are as follows:
[0020] The present application provides the transcription factor AaHATL which is cloned from the sugar apple for the first time. Researches show that the transcription factor gene is located in the nucleus, and is induced by low temperature in both transcription and protein levels. The transcription factor gene directly binds to the promoter region of the beta-amylase gene AaBAM3, inhibits the expression of the AaBAM3 gene, and inhibits starch degradation, so as to increase the starch content. Overexpression of the gene in the tomato can inhibit the expression of the beta-amylase gene, and significantly increase the starch content in the fruit, which is beneficial to increase the soluble solid content in the mature tomato fruit and improve the quality of the tomato. Transient expression of the gene in the sugar apple can significantly increase the starch content in the fruit, delay the post-harvest softening of the sugar apple, and prolong the shelf life of the sugar apple. The gene can be applied to delay the fruit ripening and improve the quality, is beneficial to the storage and transportation of the sugar apple, and is also beneficial to prolong the shelf life of the sugar apple, which provides a guarantee for improving the economic benefits in the production and sales process of the sugar apple. The present application provides a new candidate gene for the improvement of the tomato and the sugar apple and the research on delaying the shelf life and the shelf life of the starch storage type fruit. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative labor.
[0022] Figure 1 AaHATL gene expression analysis during storage at different temperatures.
[0023] Figure 2 AaHATL protein expression analysis during storage at different temperatures.
[0024] Figure 3Subcellular localization of AaHATL protein in tobacco leaf cells.
[0025] Figure 4 Validation experiments were conducted to verify the single-hybrid interaction between AaHATL and AaBAM3 yeast.
[0026] Figure 5 This study investigated the luciferase complementation of the AaHATL and AaBAM3 promoter interactions.
[0027] Figure 6 The results show the gene expression level (Figures A and B), starch content (Figure C), and soluble solids content (Figure D) of the heterologous overexpression AaHAT22 transgenic line in tomatoes.
[0028] Figure 7 The results show the starch content of custard apple fruit after transient overexpression of the AaHATL gene. Detailed Implementation
[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0030] Example 1
[0031] Acquisition of the AaHATL gene
[0032] (1) AaHATL cloning primers:
[0033] Collect AP custard apples ( Annona atemoya (Horse) The fruit is about 80% ripe, at which point the custard apple peel is yellowish-green, and the scale grooves between the eyes have spread out. Immediately after harvesting, the fruit is transported back to the laboratory. Fruits of similar size and color, free from mechanical damage and pests, are selected and placed in a 15℃ artificial climate chamber for 4 days. The pulp is then harvested, and total RNA is extracted according to the method described in the Huayueyang RNA Extraction Kit. Reverse transcription is performed using the TaKaRa PrimeScript™ RT reagent Kit, and then reverse transcription is performed according to the manufacturer's instructions to convert the RNA into first-strand cDNA. Cloning primers are designed to amplify the gene sequence via PCR.
[0034]
[0035] (2) PCR system
[0036] Prepare two 50 μL systems and perform the amplification reaction according to the following procedure:
[0037]
[0038] (3) PCR program
[0039]
[0040] (4) Running and sequencing
[0041] The electrophoresis fragments were cut out under the ultraviolet lamp, and the PCR amplification products were recovered by a PCR recovery kit. After the product was purified, it was connected with a pMD-19T vector. Positive bacterial liquid was sent to Guangzhou Aikibi Biological Company for sequencing. The CDS sequence of AaHATL is shown as SEQ ID NO: 1.
[0042] Example 2
[0043] Verification of AaHATL gene function
[0044] (1) Expression analysis of AaHATL gene during fruit storage
[0045] After the fruit of A. aculeata was placed at 28℃ and 15℃ for 0d, 2d, 4d, 6d and 8d, the expression pattern of AaHATL gene at the transcriptional level and the protein level was analyzed.
[0046] The results are shown in Figure 1 and Figure 2 : Expression analysis of transcription factor in fruits treated at normal temperature (28℃) and low temperature (15℃) for 0d-6d. It was found that AaHATL gene was induced to express at low temperature for 2d and 4d, and the expression at low temperature for 2d and 4d was higher than that at normal temperature. At the same time, the expression of AaHATL protein at normal temperature (28℃) and low temperature (15℃) for 0d-8d was analyzed. Similarly, the expression level of AaHATL protein at 15℃ was higher than that at 28℃ for the same period. It is shown that AaHATL is induced to express at the transcriptional and protein levels at low temperature.
[0047] Method steps:
[0048] 1) RT-qPCR analysis
[0049] The pulp RNA was extracted by Huaiyueyang RNA extraction kit. The reverse transcription reagent kit of TaKaRa PrimeScript™ RT reagent Kit with gDNA Eraser (for quantitative PCR) was used to reverse transcribe the first strand cDNA according to the instruction manual.
[0050] SYBR Green I dye method, according to the previous work cloning of housekeeping gene AaActin Aa designed a pair of internal reference quantitative primer qActin-F: GACACCATCCCCAGAATCC, qActin-R: CCC CAGAAGAACACCCTGT, PCR product amplification length of 189 bp. Quantitative RT-PCR reaction system is 2 x DyNAmo color Flash SYBR Green master mix 10 μL, template cDNA 0.5 μL, upstream and downstream primers 0.6 μL (qAaHATLF2: CCATCTTGTGAGAGGATTG; qAaHATLR2: GGTTGAAGAACTGGTGAG), dd H2O to 20 μL. PCR reaction program is 95 ℃ 5 min; 95 ℃ 10 s, 59 ℃ 20 s, 72 ℃ 25 s (real time fluorescence collection), 40 cycles; 95 ℃ 5 s, 65 ℃ 1 min, 97 ℃ continue, 40 ℃ 30 s Melt (dissolution curve). Gene expression using 2- △△Ct method calculation.
[0051] 2) Western blot analysis
[0052] Protein purification and antibody preparation: RT-PCR method to amplify the complete coding frame of AaHATL gene, the PCR product was recovered, double enzyme digestion of the target fragment and pET30a plasmid, ligation, construction of recombinant expression vector, then transform the E. coli BL21 (DE3) competent cells, induced protein expression after the recombinant protein purification, then the purified protein to a professional antibody production company, to the rabbit to obtain a primary antibody, select the secondary antibody goat anti-rabbit-HRP.
[0053] Protein extraction and Western Blot analysis: weighed 1 g of the pulp material, add a certain volume of extraction buffer (0.1 mol / L Tris-HCl, 25 mmol / L EDTA, pH 7.5), homogenate, 12,000 r / min centrifugation 10 min, the protein in the supernatant was first quantified, then take the appropriate volume of protein sample with equal volume of 2 x SDS loading buffer mixed, 100 ℃ treatment 5 min, then SDS-PAGE electrophoresis. After electrophoresis, the protein was transferred to nitrocellulose membrane (NC), and the Western blot was performed according to the conventional method.
[0054] (2) AaHATL protein subcellular localization analysis
[0055] The subcellular localization of AaHATL protein was studied by using tobacco transient expression system. The results are shown in the following table. Figure 3 As shown in the table, the red fluorescent protein (mKATE) was generally dispersed in the cell without fusing other proteins. The mKATE fluorescent signal fused with AaHATL protein at the N-terminal was located in the nucleus, indicating that AaHATL was located in the nucleus.
[0056] Method steps:
[0057] Construction and identification of expression vector: according to the CDS region of AaHATL, primers were designed (D5035_0S1(+): AACACGGGGGACTTTGCAACatgggcttccaagacttgtcctgc; D5035_0S1(-): CCTGAAGCGGCCGCTGTACAgcactttgtgggtgaacgattgaagg), PCR amplification, 1% agarose gel electrophoresis, gel recovery (the recovered product is marked as: rDNAH1), and after detection, recombination with the vector.
[0058] Vector digestion and ligation: pBWA(V)HS-CCDB-LK-mKATE vector (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) was digested with BsaI / Eco31I, the vector digestion product was purified with PCR purification kit, rDNAH1 was connected to pBWA(V)HS-CCDB-LK-mKATE vector with EasyClone Mix, the obtained ligation product was transformed into DH5α competent cells, and after PCR amplification, enzyme digestion screening and sequencing verification, the correct positive clones were screened and the plasmid was extracted, obtaining the fusion expression vector pBWA(V)HS-AaHATL-LK-mKATE of mKATE and target gene.
[0059] Transient transformation of tobacco leaves and laser confocal microscopic observation: the constructed vector plasmid was transformed into Agrobacterium EHA105 by electroporation method, and cultured at 30 ℃ for 2 d; the Agrobacterium was suspended in 10 mL YEB liquid medium, the suspension was resuspended with bacteria, and the OD600 was adjusted to about 0.6; the lower epidermis of tobacco was injected, and cultured in weak light for 2 d; the tobacco leaves injected with labeled Agrobacterium were made into slides, and observed and photographed with Nikon C2-ER laser confocal microscope.
[0060] The construction process of [pBWA(V)HS-AaHATL-LK-mKATE] subcellular localization vector is as follows:
[0061] 1) The following target gene amplification primers were synthesized
[0062] D5035_0S1 primer
[0063] D5035_0S1(+): AACACGGGGGACTTTGCAACatgggcttccaagacttgtcctgc
[0064] D5035_0S1(-): CCTGAAGCGGCCGCTGTACAgcactttgtgggtgaacgattgaagg
[0065] 2) PCR system and procedure
[0066] Make a 50 uL system and follow the procedure below to perform the amplification reaction:
[0067]
[0068] PCR procedure
[0069]
[0070] Use 1% agarose gel electrophoresis, 5v / cm voltage, 20 minutes, cut the electrophoresis fragments of AaHATL under the ultraviolet lamp, put them in a system for sol-gel recovery, see the reagent kit instruction book of the specific manufacturer, dissolve the recovered DNA with a total volume of 40 uL of water (the recovered product is marked as: rDNAH1), and after detection, recombine with the vector.
[0071] 3) Vector enzyme digestion
[0072] Enzyme digestion linking system and reaction conditions
[0073]
[0074] Purify the vector enzyme digestion product with a PCR purification kit (purified product marked pBWA(V)HS-CCDB-LK-mKATE(D)) for the next step of in vitro or in vivo recombination reaction.
[0075] 4) Recombination reaction
[0076]
[0077] Transform the competent cells with the ligation product.
[0078] 5) Transformation
[0079] Transform 5-10 uL of ligation product into E. coli competent cells, culture the Kan-resistant plates at 37°C for 12 hours, and perform plaque PCR identification.
[0080] 6) Plaque PCR identification
[0081] Ten plaque samples were picked and inoculated into 1.5 mL EP tubes and identified by PCR, using primers: pBWA(V)HS-CCDB-LK-mKATE identification primer Pbw2+: GCAACGCTCTGTCATCGTTACAAT (10236bp); D5035(405C): caaggtcttgagctcatgcaa (3503bp).
[0082] PCR system
[0083] Ten 25 uL PCR reactions were performed:
[0084] PCR system
[0085]
[0086] PCR program
[0087]
[0088] The target band was a fragment of about 6753bp. One to three positive bands were taken to 100 uL for sequencing, and the remaining 400 uL of bacterial solution was inoculated into 5-10 ml Kan-resistant LB, and the test tube was shaken. After the sequencing results were obtained, the correct sequencing was taken out to extract the plasmid.
[0089] (3) AaHATL and AaBAM3 yeast one-hybrid interaction verification
[0090] AaBAM3 gene (nucleotide sequence as shown in SEQ ID NO: 2) promoter containing a cold response cis-acting element segment pAaBAM3-B (nucleotide sequence as shown in SEQ ID NO: 3) was synthesized by gene synthesis method, and the length was 146bp. The pAbAi vector and pAaBAM3-B were connected by homologous recombination enzyme ClonExpress II One Step Cloning Kit to construct the bait vector pAbAi-BAM3-B. The pGADT7-AaHATL plasmid was derived from the positive clone after single-hybrid screening. Further, the plasmid containing pGADT7-AaHATL and the plasmid pAbAi-BAM3-B were co-transformed into yeast, and were plated on SD / -Leu / AbA300ng / ml plates for selection culture. If it grows on the plate, it indicates that the transcription factor recognizes and binds to the target gene promoter sequence.
[0091] Result analysis: Using yeast one-hybrid technology, the transformation products of each combination were coated on SD / -Leu auxotrophic medium (SD medium lacking leucine component) and SD / -Leu auxotrophic medium containing 300 ng / mL of Aureobasidin A (also known as short-stemmed mycotoxin A, AbA) after yeast transformation. After 3 days of culture at 30°C, the growth of yeast was observed. Randomly pick single colonies from each plate, dilute to different multiples, and take 5 μL to the yeast auxotrophic medium (SD / -Leu) and SD / -Leu medium containing 300 ng / mL AbA inhibition concentration, and the results are shown in Figure 4 As shown in the table. Except for the negative control, the positive control and the transcription factor combined with AaBAM3 promoter can grow normally on the SD / -Leu medium containing 300 ng / mL AbA inhibition concentration, indicating that the transcription factor AaHATL interacts with the promoter of AaBAM3 (the nucleotide sequence is shown as SEQ ID NO: 3).
[0092] Method steps:
[0093] Construction of bait vector (pAbAi-pBAM3-B)
[0094] 1) Vector construction process
[0095] 2) Linearize 2 μg of pBait-AbAi recombinant plasmid using BstBI or BbsI restriction endonuclease, according to the following enzyme digestion system:
[0096]
[0097] 3) Integrate 1 μg of linearized pBait-AbAi plasmid into Y1HGold strain, coat SD / -Ura plate, and culture for 3-5 days;
[0098] 4) Select 4-5 single colonies on the SD / -Ura plate, and use Matchmaker® Insert Check PCR Mix 1 for identification. Determine the size of the insertion band by electrophoresis to determine whether the vector is correctly integrated into the yeast genome. The correct clone can be preserved.
[0099] Construction of prey vector (pGADT7-AaHATL)
[0100] The plasmid is derived from pGADT7-AaHATL, and the positive clone after single-hybrid screening library.
[0101] 1) Pick the positive clone and inoculate into 2 ml liquid medium SD / -Leu, incubate at 30°C on a shaker for 2 days, extract the yeast plasmid using yeast plasmid mini extraction kit;
[0102] 2) Take 1-5 ml of the yeast culture, centrifuge at 12000 rpm for 1 min, try to aspirate the supernatant as much as possible;
[0103] 3) Add 300 μl of sorbitol buffer to the bacteria, add 50 U of lywallzyme, mix well, and treat at 30°C on a shaker at 200 rpm for 1 h; centrifuge at 4000 rpm for 10 min, discard the supernatant, and collect the precipitate; add 250 μl of solution YP1;
[0104] 4) Add 250 μl of solution YP2 to the tube, gently invert 6-8 times to mix the bacteria well, and let stand at room temperature for 5-10 min; note: mix gently, do not shake vigorously to avoid contaminating the genomic DNA; at this time, the bacterial solution should become clear and viscous;
[0105] 5) Add 350 μl of solution YP3 to the tube, immediately invert 6-8 times to mix well, and at this time a white flocculent precipitate will appear; centrifuge at 12000 rpm for 20 min; note: the YP3 should be mixed immediately after addition to avoid local precipitation; if there is still a small amount of white precipitate in the supernatant, centrifuge again and take the supernatant;
[0106] 6) Carefully add the supernatant to the adsorption column CP2, centrifuge at 12000 rpm for 1 min, discard the waste, and place the adsorption column in the collection tube;
[0107] 7) Add 500 μl of buffer PD to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste;
[0108] 8) Add 600 μl of rinse solution PW to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste, and place the adsorption column in the collection tube;
[0109] 9) Repeat step 8)
[0110] 10) Place the adsorption column in the collection tube and centrifuge at 12000 rpm for 2 min, the purpose is to remove the residual rinse solution in the adsorption column; note: the residual ethanol in the rinse solution will affect the subsequent enzyme reaction experiment, it is recommended to open the adsorption column and let it stand at room temperature for a few minutes;
[0111] 11) Place the adsorption column CP2 in a clean centrifuge tube, add 50-100 μl of elution buffer EB to the center of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 2 min to collect the plasmid solution into the centrifuge tube; Note: Too little elution buffer will affect the recovery efficiency; a pH value of elution buffer below 7.0 will reduce the elution efficiency;
[0112] 12) Obtain plasmids for amplification.
[0113] One-to-one interaction verification between plasmid (pGADT7-AaHATL) and plasmid (pAbAi-pBAM3-B):
[0114] 1) Streak the Y1HGold (pAbAi-BAM3-B) yeast strain on SD / -Ura solid medium and incubate upside down in a 30°C incubator for 2-3 days;
[0115] 2) Pick single clones with a diameter of 2-3 mm and place them in 3 ml of YPDA culture medium, and culture them at 30°C and 250 rpm for 8 h.
[0116] 3) Pipette 2-5 μl into 50 ml of YPDA (250 ml Erlenmeyer flask), and incubate at 30°C with shaking at 230-250 rpm for 16-20 h until OD600 = 0.15-0.3;
[0117] 4) Centrifuge at 700 g for 5 min at room temperature, remove the supernatant, and resuspend the bacterial cells in 100 ml of fresh culture medium; incubate at 30°C with shaking at 230-250 rpm for 3-5 h until OD600 = 0.4-0.5;
[0118] 5) Centrifuge at 700 g for 5 min at room temperature to collect the cells, discard the supernatant and resuspend the yeast in 60 ml of sterile deionized water;
[0119] 6) Centrifuge at 700 g for 5 min at room temperature to collect the cells, discard the supernatant and resuspend the yeast in 3 ml of 1.1 x TE / LiAc solution; at the same time, pre-denature the carrier DNA twice;
[0120] 7) Centrifuge at high speed for 15 s, remove the supernatant, add 600 μl of 1.1 x TE / LiAC solution and mix well by pipetting, then set aside.
[0121] 8) Take 50 μl of yeast resuspension from step 7, add 10 μl of pre-denatured carrier DNA and 200 ng of Prey plasmid pGADT7-AaHATL to the bacterial culture, and mix gently.
[0122] 9) Add 300 μl 1 x PEG / LiAc, mix well;
[0123] 10) 30°C water bath for 30 min, mix well every 10 min;
[0124] 11) Add 20 μl DMSO per tube, mix gently;
[0125] 12) 42°C water bath heat shock for 15 min, mix well every 5 min;
[0126] 13) High speed centrifuge for 15 s, discard supernatant; resuspend the bacteria with 1 ml YPD Plus, and incubate at 30°C on a shaker at 250 rpm for 1 h;
[0127] 14) High speed centrifuge for 15 s, discard supernatant;
[0128] 15) 100 μl 0.9 % NaCl;
[0129] 16) Incubate at 30°C. Resuspend the bacteria and spread on SD / -Leu / 300 ng / mL AbA plates for 3 - 5 days. Positive clones are expected to grow.
[0130] (4) Dual luciferase assay (LUC assay)
[0131] The transcription factor gene AaHATL was constructed into the expression vector pGreenII-62-SK to obtain the [pGreenII-62-SK-AaHATL] vector, and the AaHATL gene was inserted into the pGreenII-62-SK vector to obtain the [pGreenII-62-SK-AaHATL] vector. AaBAM3The promoter (pAaBAM3-J3) was constructed into the pGreenII080-LUC vector to obtain the [pGreenII0800-LUC-pAaBAM3-J3 (723bp)] vector. The vector pGreenII0800 contains 35S::REN and the LUC fluorescence tag driven by the target promoter. The nucleotide sequence of pAaBAM3-J3 is shown in SEQ ID NO: 4. The two constructed vectors were co-transformed into the Agrobacterium GV3101 strain. The tobacco plants with good growth were selected, injected from the lower epidermis of the tobacco leaves with a 1 mL syringe without a needle, and labeled. The injected tobacco plants were cultured in weak light for 2 days, injected with 1 mM luciferin, and placed in darkness for 7 min for detection. The injected tobacco leaves were collected, frozen in liquid nitrogen, and ground. An appropriate amount (100 μL) of 1x Cell Lysis Buffer was added, and the mixture was left to stand or shaken for 5 min at room temperature. The cells were blown and the cell lysate was taken into a 1.5 mL centrifuge tube. The mixture was centrifuged at 12000 g at room temperature for 2 min, and the supernatant was used for subsequent detection to determine the LUC fluorescence and REN fluorescence signals of the tobacco leaves.
[0132] Result analysis: from Figure 5 It can be seen that AaHATL can negatively regulate the activity of AaBAM3 promoter and inhibit the expression of AaBAM3.
[0133] The construction process of the [pGreenII0800-LUC-pAaBAM3-J3 (723bp)] vector is as follows:
[0134] 1. The following 1 pair of primers was synthesized
[0135] 1: BAM3-J3 primer
[0136] BAM3-J3(+): ggccccccctcgaggtcgacggtatcgatagatagccattaaccaatctaggtag
[0137] BAM3-J3(-): tatgtttttggcgtcttccatggtcccccgttttcctgagcaatgaagtaaaaat
[0138] 2. PCR system
[0139] A 50 μL system was prepared and the amplification reaction was performed according to the following procedure:
[0140] PCR system
[0141]
[0142] PCR procedure
[0143]
[0144] The electrophoresis fragment of BAM3-J3 (723bp) was cut out under the ultraviolet light and dissolved in a system for gel recovery. The recovery procedure was described in the reagent kit instruction. The total volume of water was 40 μL. The recovered DNA was dissolved in water (the recovered product was marked as rDNA G1). After the detection, the recovered product was recombined with the vector.
[0145] 3. Vector enzyme digestion
[0146] Enzyme digestion linking system:
[0147]
[0148] Reaction condition: temperature 37℃, time 1 h
[0149] The vector enzyme digestion product was purified by the PCR purification reagent kit (the purified product was marked as pGreenII 0800-LUC-ccdb(D) for the next step of in vitro or in vivo recombination reaction.
[0150] Recombination reaction system
[0151]
[0152] Recombination reaction procedure: temperature 37℃, time 30 h
[0153] The linking product was transformed into the competent cells.
[0154] Transformation
[0155] 5-10 μL of the linking product was transformed into the competent E. coli. The transformed kanamycin resistant plate was cultured at 37℃ for 12 hours. The plaque PCR identification was performed.
[0156] 6. Plaque PCR identification
[0157] Ten plaques were picked and inoculated in 1.5 ml EP tubes and identified by PCR. The primers were pGreenII 0800-LUC-ccdb identification primers P1 (F: gttgtaaaacgacggccagt), P2 (R: caattgttccaggaaccagg).
[0158] PCR system
[0159] Ten 25 μL system PCR reactions were performed:
[0160] PCR system
[0161]
[0162] PCR program
[0163]
[0164] The target band is a fragment of about 823bp. Take 1-3 positive bands corresponding to the bacterial liquid, take 100 μL for sequencing, and the remaining 400 μL of bacterial liquid is inoculated into 5-10 ml of kanamycin-resistant LB, and the tube is shaken. After the sequencing result is obtained, the correct sequencing result is taken out to extract the plasmid.
[0165] The construction process of the [pGreenII-62-SK-AaHATL] vector is as follows:
[0166] 1. Synthesize the following 1 pair of primers
[0167] 1: HATL primer
[0168] HATL(+): cagtTTTCGCAGCATCTAACGAGCTCTTCGcaccgtagagtgacatgcggataa
[0169] HATL(-): cagtTTTCGCAGCATCTAACGAGCTCTTCGagcgggcttgaactatggtggatc
[0170] 2. PCR system
[0171] Make a 50 μL system and perform amplification reaction according to the following program:
[0172] PCR system
[0173]
[0174] Use 1% agarose gel electrophoresis, 5v / cm voltage, 20 minutes, cut out the electrophoresis fragment of AaHATL (965bp) under the ultraviolet lamp, and place it in a system for gel recovery. The recovery program is shown in the reagent kit instruction manual. Dissolve the recovered DNA (the recovered product is marked as: rDNAH1) with a total volume of 30 μL of water. After detection, connect it with the vector.
[0175] 3. Vector enzyme digestion
[0176] Enzyme digestion and reaction conditions:
[0177]
[0178] 4. rDNAH1 enzyme digestion
[0179] Enzymatic digestion and ligation system and reaction conditions:
[0180]
[0181] The vector digestion and the recovered fragment digestion were combined and purified by PCR purification kit (the purified product was marked as P-rDNAH1) for the next step of ligation reaction.
[0182] 5. Ligation reaction
[0183] DNA ligation system and reaction conditions:
[0184]
[0185] The ligation product was transformed into competent cells.
[0186] 6. Transformation
[0187] 5-10 μL of the ligation product was transformed into E. coli competent cells (see the standard method of E. coli competent cell transformation), and the transformed kanamycin-resistant flat plate was incubated at 37°C for 12 hours, and then plaque PCR identification was performed.
[0188] 7. Plaque PCR identification
[0189] Ten plaques were picked and inoculated into 1.5 ml EP tubes and subjected to PCR identification, and the primers were pGreenII-62-SK-ccdb identification primers 62sk-F (tctccactgacgtaagggat) and 62sk-R (caacacatgagcgaaaccc).
[0190] PCR system
[0191] PCR reaction was performed in 10 25 μL systems:
[0192]
[0193] The target band was a fragment of about 1065 bp. 1-3 positive bands were taken, 100 μL of bacterial solution was taken for sequencing, and the remaining 400 μL of bacterial solution was inoculated into kanamycin-containing LB, and the test tube was shaken. After the sequencing result was obtained, one tube was taken for plasmid extraction corresponding to the correct sequencing.
[0194] Tobacco transient transformation method steps:
[0195] 1. Tobacco culture: sow tobacco seeds, 12 h light culture, and culture for one month for experiment;
[0196] 2. Agrobacterium culture: the constructed vector plasmid was transformed into Agrobacterium (GV3101) by electroporation, and cultured at 30°C for 2 days;
[0197] 3. Agrobacterium suspension: Agrobacterium was scraped from the solid culture dish with a loop and inoculated into 10 mL YEB liquid medium, incubated at 170 rpm / min for 1 h;
[0198] 4. Collect bacteria: centrifuged at 4000 rpm / min for 4 min, and the supernatant was removed;
[0199] 5. Resuspension: resuspend the bacteria with 10 mM MgCl2 (containing 120 uM AS) suspension, adjust OD600 to about 0.6;
[0200] 6. Injection: select tobacco plants with good growth conditions, inject from the lower epidermis of tobacco leaves with a 1 mL syringe without a needle, and label well;
[0201] 7. Culture: the injected tobacco plants were cultured in weak light for 2 days, injected with 1 mM luciferin, and placed in the dark for 7 min for detection;
[0202] 8. Fluorescence value detection
[0203] (1) Cell lysis: collect tobacco leaves, freeze in liquid nitrogen and grind, add an appropriate amount (100 μL) of 1 × Cell Lysis Buffer, stand at room temperature or shake for 5 min, blow and suck the cell lysate into a 1.5 mL centrifuge tube, centrifuge at 12000 g at room temperature for 2 min, and take the supernatant for subsequent detection.
[0204] (2) Firefly luciferase reaction detection: add 100 μL of Luciferase Substrate equilibrated to room temperature to the detection tube or enzyme-labeled plate, carefully suck 20 μL of cell lysate supernatant into the detection tube or enzyme-labeled plate well, mix quickly, and immediately detect the Firefly luciferase reporter gene activity in the fluorescence detector (Luminometer) or enzyme-labeled instrument.
[0205] (3) Renilla luciferase reaction detection: add 100 μL of freshly prepared Renilla substrate working solution to the above reaction solution, mix quickly, and immediately detect the Renilla luciferase reporter gene activity in the fluorescence detector or enzyme-labeled instrument, with 3 repeats for each detection.
[0206] (5) Tomato transgenic
[0207] 1) Construction of AaHATL overexpression vector:
[0208] According to AaHATLThe CDS region of the AaHATL gene was amplified by PCR using primers with homologous recombination sequences (40547_0(+): aacacgggggactttgcaacatgggcttccaagacttgtcctgc; 40547_0(-): gatctaccatgcactttgtgggtgaacgattgaagg), and the PCR product was recovered by 1% agarose gel electrophoresis. After the DNA was confirmed to be correct, the DNA was recombined with a vector.
[0209] Vector digestion and ligation: the pBWA(V)HS vector (pBWA(V)HS-ccdB) was digested with BsaI / Eco31I, and the vector was purified by a PCR purification kit. The rDNAHG2 was ligated to the pBWA(V)HS vector using 2*EasyClone Mix. The ligation product was transformed into DH5α competent cells. After PCR amplification, enzyme digestion screening, and sequencing verification, the positive clones were screened and the plasmid was extracted to obtain the fusion expression vector pBWA(V)HS-AaHATL of AaHATL and the target gene.
[0210] 2) Agrobacterium-mediated genetic transformation: Sterilized seeds were uniformly sown on MS solid medium and placed in a light incubator for germination. The pre-cultured cotyledons were soaked in the Agrobacterium suspension in MS liquid medium for 2 d. The cotyledons were then transferred to the differentiation solid medium. The culture was incubated at 25°C (16 h) light and 20°C (8 h dark). The medium was replaced every three weeks until callus formation. After callus formation, the callus was transferred to the growth solid medium to induce bud formation. After the growth point was differentiated, the callus around the growth point was removed and transferred to the MS solid medium for rooting screening.
[0211] 3) Transgenic tomato positive seedling screening: The genome was extracted by SDS method, and the extracted genome was identified by PCR. The positive plants were screened by antibiotic marker.
[0212] (I) The construction process of the [pBWA(V)HS-AaHATL overexpression-GUS fusion] vector is as follows:
[0213] 1. The following primers were synthesized
[0214] 40547_0(+): aacacgggggactttgcaacatgggcttccaagacttgtcctgc
[0215] 40547_0(-): gatctaccatgcactttgtgggtgaacgattgaagg
[0216] 2. PCR system
[0217] Two 50 μL systems were prepared and amplification reactions were performed according to the following procedure:
[0218]
[0219]
[0220] The electrophoresis fragments of AaHATL (810 bp) and GUS (2053 bp) were cut out under ultraviolet light using 1% agarose gel electrophoresis at 5 v / cm for 20 minutes, and were placed in a system for gel recovery. The recovery procedure is described in the reagent kit instruction manual of the specific manufacturer. The recovered DNA (labeled as rDNAHG2) was dissolved in a total volume of 40 μL of water. After detection, the recovered DNA was recombined with the vector.
[0221] 3. Vector enzyme digestion
[0222] Enzyme digestion and reaction conditions
[0223]
[0224] The vector enzyme digestion product was purified using a PCR purification reagent kit (purified product labeled as pBWA(V)HS-ccdB(D)) and was used in the next in vitro or in vivo recombination reaction.
[0225] 4. Recombination reaction
[0226]
[0227] The ligation product was transformed into competent cells.
[0228] 5. Transformation
[0229] 5-10 μL of the ligation product was transformed into E. coli competent cells, and a kanamycin-resistant plate was prepared. The plate was incubated at 37°C for 12 hours, and plaque PCR identification was performed.
[0230] 6. Plaque PCR identification
[0231] Ten plaques were selected and inoculated into 1.5 mL EP tubes and subjected to PCR identification. The primers used were pBWA(V)HS-ccdB identification primers:
[0232] HS)35 seq: tTCATTTGGAGAGAACACGGGggac (2861 bp)
[0233] M40547 (573C): gtgagggtggctgcagga (3553 bp).
[0234] PCR system
[0235] PCR reaction was performed in 10 25 μL systems:
[0236]
[0237] The target band was a fragment of about 712 bp. 1-3 positive bands were taken, 100 μL of which was sent for sequencing, and the remaining 400 μL of bacterial liquid was inoculated into 5-10 mL (kanamycin) resistant LB, and a tube was taken for plasmid extraction after the sequencing results were obtained.
[0238] The operation steps of Agrobacterium transformation are as follows:
[0239] 1. Preparation of Agrobacterium
[0240] 1.1 Plasmid transformation
[0241] 1 μL of plasmid was added to 50 μL of GV3101 Agrobacterium competent cells, mixed thoroughly, and then transferred to an electric conversion cup. After electric conversion, 1 mL of LB liquid medium was added, mixed thoroughly, and then transferred to a 1.5 mL centrifuge tube. The activated Agrobacterium liquid was taken 50 μL and inoculated into LB solid medium, and cultured at 30°C in the dark for 48 h.
[0242] 1.2 Agrobacterium detection
[0243] 1.2.1 Synthesis of corresponding detection primers;
[0244] 1.2.2 Prepare the PCR amplification system as shown in the table below, mix thoroughly after preparation, use the PCR instrument for amplification, and set the amplification program according to the primer information;
[0245]
[0246] 1.2.3 Gel electrophoresis detection, prepare 1% agarose gel (weigh 1.5 g of agarose powder and dissolve in 150 mL of 1xTAE buffer, microwave for about 3 minutes until the liquid is transparent. Add EB to the gel preparation plate, pour the dissolved agarose liquid into the gel preparation plate, mix well, insert the comb, and stand for 40 minutes until the gel turns milky white), sample, and complete the electrophoresis process.
[0247] 1.2.4 View the PCR amplification results, the electrophoresis bands of the positive control and the sample are clear, the size is correct, and there is no band in the negative control. Under the condition that the sample can enter the next step.
[0248] 2. Genetic transformation of tomato
[0249] 2. Seed sterilization
[0250] Sterilized with sterile water for 2 min, 75% alcohol for 40 s, 84 disinfectant for 7 min, sterilized water for 3 times, and sterilized water for 1 h.
[0251] 2.2 Seeding
[0252] The sterilized tomato seeds were seeded on the germination medium, and then dark culture for 3-4 d, and then placed in the light tissue culture box for growth for 4-5 d after the seeds germinated.
[0253] 2.3 Preparation and pre-culture of explants
[0254] The germinated tomato seedlings were cut with a scalpel to remove the cotyledon petiole and cotyledon tip, leaving the middle part to be cut into 2-3 sections and inoculated on the pre-culture medium at 23±2 ℃ for 2-3 d.
[0255] 2.4 Agrobacterium infection and co-culture
[0256] The Agrobacterium was picked up in the infection solution to prepare an Agrobacterium resuspension solution with OD600=0.1; the dried explants were inoculated on the co-culture medium and dark cultured at 23±2 ℃ for 2 d.
[0257] 2.5 Screening and differentiation rooting
[0258] The recovered callus was inoculated on the screening medium and cultured at 23 ℃ with 16 h / 8 h light / dark for 15-30 days; the screened callus was inoculated on the differentiation medium and cultured at 23 ℃ with 16 h / 8 h light / dark for 30-40 d. When the differentiated seedlings grew to about 2-3 cm, they were cut from the callus and inoculated on the rooting medium and cultured at 23 ℃ with 16 h / 8 h light / dark for 10-15 d.
[0259] 2.6 Detection
[0260] Tomato genomic DNA was extracted by CTAB method for PCR detection.
[0261] (6) Instantaneous transformation of pouteria caimito fruit
[0262] Select mature 'AP' custard apples that are 120 days after flowering, free from pests, diseases, and mechanical damage, and pick them for later use. Transform Agrobacterium tumefaciens (GV3101-pSoup-p19 strain) with the empty vector and pGreenII-62-SK-AaHATL plasmid. Spread the transformed material on LB agar plates (containing 50 mg / L kanamycin and 34 mg / L rifampin) and incubate at 28°C for 2 days. Select single colonies for PCR identification. Pick positive clones and incubate them in 3 mL of LB medium (containing 50 mg / L kanamycin and 34 mg / L rifampin) overnight at 28°C and 200 rpm. Take 1 mL of the bacterial culture and transfer it to 20 mL of the same medium. Shake the culture at 28°C and 200 rpm for 6-8 hours until OD600 ≈ 0.8. Resuspend the culture in an equal volume of infection solution (10 mM MES (2-morpholinoethanesulfonic acid), 10 mM MgCl2, 150 μM AS (acetylsyl syringone)) and incubate in the dark at 28°C for 1-3 hours.
[0263] Inject 0.2 mL of pGreenII-62-SK-AaHATL into each custard apple fruit using a 1 mL syringe. Five injection sites are made on each fruit, one for the empty control and five for pGreenII-62-SK-AaHATL, with each site containing 0.2 mL. Inject 5-10 fruits, place them in a 28℃ incubator for 5 days, and then cut the pulp for starch content determination.
[0264] (7) Expression analysis of AaHATL and SIBAM genes in fruits of transgenic tomato lines
[0265] The expression levels of AaHATL and SIBAM in transgenic fruit lines were analyzed using the RT-qPCR method described in "(1) Expression Analysis of AaHATL Gene during Fruit Storage". Internal references SITUA-F: ATGAGATTTGCCATCAGGG, SITUA-R: ATTGCATGACAAGGACCG. Primers for SIBAM1-1260, SIBAM3-3650, and SIBAM3-5160 are shown in Table 1.
[0266] Table 1 Primer sequences
[0267]
[0268] Three overexpressing transgenic tomato lines (OE#1, OE#2, and OE#3) and one wild-type line (WT) were selected as controls. Fruits were sampled 35 days after flowering (the color-breaking stage, when the fruit begins to turn red), with 10 fruits taken from each line. Starch content and soluble solids content (soluble sugar content) were determined. Starch content was determined using the anthrone colorimetric method (using a kit from Suzhou Gres Biotech Co., Ltd., catalog number: G0507W). Soluble solids content was directly determined using a handheld refractometer (portable saccharimeter).
[0269] The results are as follows Figure 6 As shown in Figure A, the AaHAL gene could not be amplified in wild-type tomatoes. The three transgenic lines showed varying degrees of high expression of AaHAL, indicating that overexpression of the AaHAL gene in tomatoes was effective. One SIBAM1 gene and two SIBAM3 genes were identified in the tomato genome. Analysis of their expression in the fruits of the three transgenic lines revealed that the expression of all three β-amylase genes (BAM) was inhibited to varying degrees in the fruits of the transgenic lines compared to the wild type. Figure 6 (B in the text). This indicates that overexpression of the AaHAL gene can suppress the expression of the BAM gene.
[0270] Results of starch content determination in tomato fruit ( Figure 6 The results (C) show that the starch content of all three transgenic lines was significantly higher than that of the wild type, while the soluble solids content not only did not decrease, but actually increased to some extent. Figure 6 (D in the text). This indicates that by inhibiting BAM expression, the transgenic tomato line effectively increased the starch content in tomato fruit without reducing the soluble solids content (soluble sugar content).
[0271] (8) Determination of starch content in instantaneously converted custard apple fruit
[0272] like Figure 7 As shown, transient overexpression of the AaHATL gene in custard apple fruit significantly increased the starch content of the fruit.
[0273] Starch content gradually accumulates during fruit growth and development, and is degraded into soluble sugars during ripening, increasing the fruit's sweetness. The fruit ripening process is divided into three stages: cell division, starch accumulation, and fruit ripening. Starch accumulation begins after cell division, and degradation begins during ripening, until the fruit is fully ripe, at which point almost all of the starch has been converted into soluble sugars. Before ripening, the large amount of starch in the fruit is crucial for maintaining the firmness of the flesh. Starch provides support to cells, maintaining overall turgor pressure, and post-harvest softening is related to starch degradation. Therefore, early starch accumulation in the fruit is more conducive to increasing sugar content, while regulating starch degradation in the later stages helps maintain fruit firmness, which is beneficial for post-harvest transportation and storage.
[0274] Tomato fruit ripening is generally divided into four periods, green mature period, broken color period (color changing period), mature period and complete mature period. In the green mature period, the starch in the tomato fruit begins to degrade, and until the tomato fruit is completely mature, all the starch is converted into soluble sugar. In the present application, overexpression of AaHATL gene can increase the starch content in the incompletely matured fruit of tomato, and at this time the soluble solid content (soluble sugar content) in the fruit is not reduced, but is improved to different degrees. Therefore, overexpression of AaHATL gene can improve the accumulation of starch in tomato fruit without affecting the soluble solid content (soluble sugar content) of the fruit, and can provide more starch for conversion into soluble sugar in the subsequent tomato ripening process, thereby improving the sugar content of mature tomato fruit and improving the taste and quality of tomato. For mature sugar apples, the increase of starch content in postharvest fruit can delay the postharvest softening of sugar apples, which is beneficial to prolong the shelf life and shelf life of sugar apples, and is more beneficial to the postharvest transportation and storage of fruits.
[0275] The above description is merely preferred embodiments of the present application but not to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A low-temperature responsive transcription factor AaHATL, characterized in that, It is a protein encoded by a gene with a nucleotide sequence as shown in SEQ ID NO:
1.
2. A transcription factor gene encoding the low-temperature response transcription factor as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:
1.
3. A recombinant vector containing the coding region of the transcription factor AaHATL gene as described in claim 1.
4. A host bacterium containing the coding region of the transcription factor AaHATL gene as described in claim 1.
5. An expression cassette containing the coding region of the transcription factor AaHATL gene as described in claim 1.
6. The use of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector as described in claim 3, or the host bacterium as described in claim 4, or the expression cassette as described in claim 5, in improving the growth activity of yeast on SD / -Leu medium containing 300 ng / mL AbA inhibitory concentration.
7. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector as described in claim 3, or the host bacterium as described in claim 4, or the expression cassette as described in claim 5 in increasing the starch content of fruits.
8. The application as described in claim 7, characterized in that, Overexpression of transcription factor genes increases starch content in tomato and / or custard apple fruits.
9. The application of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector as described in claim 3, or the host bacterium as described in claim 4, or the expression cassette as described in claim 5 in increasing the soluble sugar content of tomato fruit and / or not decreasing the soluble solids content of tomato fruit.
10. The use of the transcription factor AaHATL as described in claim 1, or the transcription factor gene as described in claim 2, or the recombinant vector as described in claim 3, or the host bacterium as described in claim 4, or the expression cassette as described in claim 5 in delaying the ripening and softening of custard apples and / or extending the shelf life of custard apples.
Citation Information
Patent Citations
Transcription factor for regulating physical and chemical properties of plant seed starch
CN103160541A
Application of transcription factor CeMyb108 in regulation and control of taro starch synthesis
CN118184753A