Capsid-armed adenoviruses carrying pix region antigens, methods of construction and uses

By introducing exogenous antigen genes into the pIX region of adenovirus, capsid-armed adenoviruses were constructed, overcoming the limitations of adenovirus vectors in antigen carrying and expression, achieving efficient and stable antigen display and immune response, and expanding the application potential of adenovirus vectors.

CN120843601BActive Publication Date: 2026-01-09TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511377276.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2026-01-09
Estimated Expiration
2045-09-25

AI Technical Summary

Technical Problem

There is limited research on the modification of the pIX region of adenovirus in existing technologies, which has resulted in the underutilization of its application potential in carrying and expressing exogenous antigens, thus limiting the application scope of adenovirus vectors.

Method used

A foreign antigen gene was introduced into the pIX region of the minor capsid protein of adenovirus type 5 to form a capsid-armed adenovirus. Homologous recombination technology was used to delete and insert at specific sites on the adenovirus backbone to construct a pIX-modified adenovirus.

Benefits of technology

It achieves high-density and highly reproducible display of exogenous antigens on the viral surface, increases the effective concentration of antigens, and can induce stronger and more durable specific immune responses. It has the dual functions of gene delivery and surface antigen presentation, providing an innovative platform for multifunctional vaccines and gene therapy drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843601B_ABST
    Figure CN120843601B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of bioengineering, and particularly relates to a pIX region antigen-carrying capsid armed adenovirus, a construction method and application. An exogenous antigen gene is introduced into a pIX region of a minor capsid protein of a type 5 adenovirus to form a capsid armed adenovirus; the type 5 adenovirus specifically has an E1 region and an E3 region deletion. The construction method uses pIX as a display platform, can present an exogenous antigen on the virus surface with high density and high repeatability, greatly improves the effective concentration of the antigen, and is expected to induce stronger and more persistent specific immune responses; the modified pIX protein has less influence on the packaging, assembly, structural stability of the virus and the infection ability on target cells; the adenovirus can realize the dual functions of "gene delivery" and "surface antigen presentation", and provides an innovative technical platform for developing multifunctional and high-titer vaccines or gene therapy drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering, in particular, to a pIX region antigen-carrying capsid armed adenovirus, a construction method and application. BACKGROUND

[0002] Gene therapy, as a new treatment method, has attracted much attention in the medical field in recent years. Its basic principle is to introduce exogenous genes into the body to correct or compensate for diseases caused by gene defects, or to endow cells with new functions to combat specific diseases. Adenovirus vectors have become one of the most commonly used vectors in gene therapy research and application due to their high infection efficiency, strong gene carrying capacity, and mature production process. Adenovirus vectors have a wide range of applications, not only in gene therapy, but also in vaccine development and oncolytic virus research, showing great potential in cancer immunotherapy and related fields.

[0003] Currently, the modification of adenovirus vectors mainly focuses on the modification of E1 and E3 gene regions to achieve efficient expression of exogenous genes. For example, by inserting antigen-encoding sequences in the E1 region, adenovirus vectors for vaccination can be constructed; in the development of oncolytic viruses, researchers often insert target genes in the E3 region to enhance the specific killing ability of viruses against tumor cells. However, one of the important components of adenovirus capsid protein, pIX, has relatively less modification research in the existing technology. pIX plays an important role in the structural stability and assembly process of adenovirus, but due to the high technical difficulty of modifying the adenovirus genome, especially the modification of the pIX region, which may result in the virus unable to assemble normally or lose biological activity, the development and utilization of the pIX region has been limited.

[0004] Despite this, pIX has a high expression level in adenovirus, and its potential functions have not been fully explored and utilized. At present, due to the lack of effective technical means to carry and express exogenous antigens in the pIX region, the application potential of adenovirus vectors is restricted to some extent. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a pIX region antigen-carrying capsid armed adenovirus, a construction method and application.

[0006] The technical solution of the present application to solve the above technical problem is as follows:

[0007] The present application provides a pIX region antigen-carrying capsid armed adenovirus construction method, which introduces an exogenous antigen gene into the pIX region of a type 5 adenovirus to form a capsid armed adenovirus; wherein the type 5 adenovirus specifically has a deletion in the E1 and E3 regions.

[0008] Based on the technical scheme, the application can be further improved as follows.

[0009] Further, the method comprises the following steps:

[0010] linearizing the first adenovirus backbone plasmid; synthesizing an adenovirus backbone recombinant fragment pIX-del with a pIX gene deletion in vitro;

[0011] co-transforming the linearized first adenovirus backbone plasmid and the pIX-del into a competent cell to obtain a second adenovirus backbone plasmid;

[0012] linearizing the second adenovirus backbone plasmid; preparing a pIX-target gene fusion expression fragment containing a pIX sequence and an antigen gene sequence;

[0013] connecting the linearized second adenovirus backbone plasmid and the fusion expression fragment in vitro to obtain a recombinant plasmid, and then obtaining the capsid-armed adenovirus through packaging and purification.

[0014] Further, the gene sequence of the pIX-del is shown in SEQ ID No. 1.

[0015] Further, the pIX-target gene fusion expression fragment comprises, in sequence from N-terminus to C-terminus, a complete coding region of a pIX gene, a flexible Linker sequence and a target gene sequence.

[0016] Further, the flexible Linker sequence is shown in SEQ ID No. 3.

[0017] Further, the antigen gene sequence is an hpv antigen gene sequence or an ova antigen gene sequence.

[0018] Further, the first adenovirus backbone plasmid is a type 5 adenovirus, wherein the E1 region is deleted at 1-3523 nt, the E3 region is deleted at 28130-30820 nt, and a CMV-MCS-polyA expression frame is inserted into the E1 region.

[0019] Further, the first adenovirus backbone plasmid is a BJ5183-pADeasy plasmid, and the competent cell is a BJ5183 competent cell.

[0020] The application further provides a capsid-armed adenovirus carrying an antigen in a pIX region, which is constructed by the above method.

[0021] The application further provides the use of the capsid-armed adenovirus as described above, which can be used for preparing a vaccine or a gene therapy drug.

[0022] The application has the following advantages:

[0023] (1) The pIX region carrying antigen capsid armed adenovirus construction method of the application can introduce an exogenous antigen gene on a mature type 5 adenovirus vector skeleton, and construct a pIX modified adenovirus;

[0024] (2) The pIX region carrying antigen capsid armed adenovirus construction method of the application adopts a homologous recombination technology based on BJ5183 competent cells, and has clear steps and reliable operation, can accurately and efficiently delete and insert a large fragment at a specific site of an adenovirus skeleton, and significantly improves the construction success rate and efficiency of a complex recombinant adenovirus plasmid.

[0025] (3) The pIX region carrying antigen capsid armed adenovirus of the application uses pIX as a display platform, can present an exogenous antigen on the virus surface at high density and high repeatability, greatly improves the effective concentration of the antigen, and is expected to induce stronger and more persistent specific immune responses;

[0026] (4) The pIX region carrying antigen capsid armed adenovirus of the application has less influence on the packaging, assembly, structural stability of the virus and the infection ability to target cells by modifying the pIX protein;

[0027] (5) The pIX region carrying antigen capsid armed adenovirus of the application can not only express a conventional therapeutic or preventive gene (such as a gene inserted in a traditional E1 deletion region) in a host cell through its genome, but also directly stimulate the immune system through the pIX fusion antigen on the capsid surface, realizes the dual functions of “gene delivery” and “surface antigen presentation”, and provides an innovative technical platform for developing multifunctional and high-titer vaccines or gene therapy drugs. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The preparation flowchart of Example 1 of the application;

[0029] Figure 2 The PAd-pIX-HPV16-E6 construction schematic diagram in Example 1 of the application;

[0030] Figure 3 The PAd-pIX-HPV16-E6 virus genome map in Example 1 of the application;

[0031] Figure 4 The Western Blot analysis electropherogram of PAd-pIX-HPV16-E6 expressed antigen in Example 2 of the application;

[0032] Figure 5 The detection result graph of specific antibodies against HPV E6 in a SD rat model in Example 3 of the application;

[0033] Figure 6 Figure for the detection result of IFN-γ in the SD rat model in the embodiment 4 of the present application;

[0034] Figure 7 Figure for the schematic diagram of the gene structure of PAd-pIX-OVA in the embodiment 5 of the present application;

[0035] Figure 8 Figure for the electron microscope image of the virus particle of PAd-pIX-OVA in the embodiment 5 of the present application. DETAILED DESCRIPTION

[0036] The principles and features of the present application are described below, and the examples are only used to explain the present application, and are not used to limit the scope of the present application.

[0037] The construction method of the pIX region carrying antigen capsid armed adenovirus of the present application introduces an exogenous antigen gene into the pIX region of the minor capsid protein of the type 5 adenovirus to form a capsid armed adenovirus; wherein the type 5 adenovirus specifically has E1 and E3 regions deleted.

[0038] The construction method of the pIX region carrying antigen capsid armed adenovirus of the present application can, on the basis of a mature type 5 adenovirus vector skeleton, knock out the coding gene of the minor capsid protein pIX located between the E1 and E2 regions by homologous recombination technology to construct a new universal backbone plasmid that can be used for subsequent insertion of a “pIX-target gene” fusion expression cassette, and then introduce an exogenous antigen gene through the plasmid to efficiently construct a pIX modified adenovirus.

[0039] Specifically, pIX is a minor capsid protein of adenovirus, but there are as many as 240 copies on the surface of each mature virus particle. The present application uses pIX as a display platform to present exogenous antigens on the virus surface with high density and high repeatability, greatly improving the effective concentration of the antigen and inducing stronger and more persistent specific immune responses.

[0040] In addition, compared with the modification of the major capsid proteins of adenovirus (such as Hexon and Fiber), the modification of pIX protein has less impact on the packaging, assembly, structural stability of the virus and the infection ability of the target cells.

[0041] Preferably, the method of the present application comprises the following steps:

[0042] linearizing the first adenovirus backbone plasmid; synthesizing an adenovirus backbone recombinant fragment pIX-del with pIX gene deletion in vitro; and the first adenovirus backbone plasmid is a BJ5183-pADeasy plasmid.

[0043] Preferably, the BJ5183-pADeasy plasmid uses the product pAdEasy-1, which has a deletion of 1-3523 nt in the E1 region and a deletion of 28130-30820 nt in the E3 region, and has a CMV-MCS-polyA expression frame inserted in the E1 region.

[0044] The linearized first adenovirus backbone plasmid and pIX-del are co-transformed into competent cells to obtain a second adenovirus backbone plasmid; preferably, the gene sequence of pIX-del is shown in SEQ ID No. 1; the competent cells are BJ5183 competent cells.

[0045] The homologous recombination technology based on BJ5183 competent cells is adopted, the steps are clear, the operation is reliable, and the deletion and insertion of a large fragment at a specific site of the adenovirus backbone can be accurately and efficiently performed, thereby significantly improving the success rate and efficiency of construction of a complex recombinant adenovirus plasmid.

[0046] The second adenovirus backbone plasmid is linearized; and a pIX-target gene fusion expression fragment containing a pIX sequence and an antigen gene sequence is prepared.

[0047] Preferably, the pIX-target gene fusion expression fragment comprises, in sequence from the N terminus to the C terminus, a complete coding region of a pIX gene, a flexible Linker sequence and a target gene sequence; the exogenous gene is fused to the C terminus of the pIX protein, the region is exposed to the surface of the capsid and has good flexibility, so that the biological activity and preparation titer of the recombinant virus are ensured.

[0048] Preferably, the flexible Linker sequence is shown in SEQ ID No. 3; the flexible Linker does not affect the expression of the fusion protein, and meanwhile, antibody immunity and specific cellular immunity can be generated in vivo.

[0049] Preferably, the antigen gene sequence is an hpv antigen gene sequence or an OVA antigen gene sequence.

[0050] The linearized second adenovirus backbone plasmid and the fusion expression fragment are connected in vitro to obtain a recombinant plasmid, and the capsid armed adenovirus is obtained through packaging and purification.

[0051] The capsid armed adenovirus of the application is obtained by the method described above. The adenovirus can induce stronger and more persistent specific immune responses; meanwhile, the adenovirus can not only express a conventional therapeutic or prophylactic gene (such as a gene inserted in the traditional E1 deletion region) in a host cell through its genome, but also directly stimulate the immune system through the pIX fusion antigen on the surface of the capsid, thereby realizing the dual functions of "gene delivery" and "surface antigen presentation", and providing an innovative technical platform for developing multifunctional and high-titer vaccines or gene therapy drugs.

[0052] The capsid armed adenovirus of the application can be used for preparing a vaccine or a gene therapy drug, and provides a new technical path and tool for cancer immunotherapy and gene therapy, and has important research value and application prospect.

[0053] The application will be illustrated below by specific examples.

[0054] Example 1 Construction of capsid protein pIX armed adenovirus

[0055] The construction strategy of this example is based on the AdEasy™ adenovirus vector system, and the BJ5183-pADeasy plasmid used is a genetically engineered adenovirus type 5 (Ad5) genome from the Gynecologic Oncology Laboratory of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology.

[0056] The structural characteristics of the BJ5183-pADeasy plasmid are:

[0057] E1 region deletion: most of the sequences in the E1 region essential for virus replication (such as nucleotides 343-3523 of the Ad5 genome) are deleted, making the virus replication-deficient in conventional cells and only able to proliferate in packaging cell lines (such as HEK293 cells) that complementally express E1 protein, ensuring its safety.

[0058] E3 region partial deletion: to accommodate larger foreign genes and reduce host immune response, there is partial sequence deletion in the E3 region.

[0059] Shuttle expression framework: an expression framework for expressing foreign genes is inserted at the site of E1 deletion. The framework usually contains a strong promoter, such as the enhancer and promoter of cytomegalovirus (CMV), downstream of which one or more unique restriction endonuclease sites (such as the BstBI enzyme site in this example) are provided, and ends with a polyadenylation signal (polyA).

[0060] As shown in Figure 1 and Figure 2 , the specific preparation steps are as follows:

[0061] (1) Linearize the BJ5183-pADeasy plasmid: use the restriction endonuclease BstBI to cut the BJ5183-pADeasy plasmid to achieve its linearization.

[0062] The enzyme digestion reaction system is: BJ5183-pADeasy plasmid (50 μg), BstBI restriction endonuclease, 10 x Buffer, and supplemented system volume deionized water, the total volume is 50 μL. The enzyme digestion reaction condition is: 37°C, reaction 1 hour. After enzyme digestion, whether the enzyme digestion is complete is detected by agarose gel electrophoresis, and the linearized plasmid product is recovered using a gel recovery kit, and then its concentration and OD value are detected.

[0063] (2) Preparation of pIX gene deletion adenovirus skeleton recombinant fragment: a DNA fragment for homologous recombination is obtained by in vitro gene synthesis, which is named "pIX-del".

[0064] The design features of pIX-del are: the sequences at both ends are respectively the sequences upstream of the BstBI enzyme digestion site on the BJ5183-pADeasy plasmid and downstream of pIX, which constitute homologous arms, but the fragment itself does not contain the coding region of the pIX gene.

[0065] Through this design, when the fragment is co-transformed with the linearized BJ5183-pADeasy plasmid into a homologous recombination competent cell (BJ5183), the original pIX gene region of the BJ5183-pADeasy plasmid can be replaced by a homologous exchange reaction, so as to realize the precise deletion of the pIX gene.

[0066] After optimization design, the sequence of pIX-del is shown as SEQ ID No. 1, which is synthesized by a professional company. The following primers are used for PCR amplification of pIX-del to obtain sufficient DNA for subsequent experiments.

[0067] pIX-del-F (SEQ ID No. 4): TGAAGCCAATATGATAATGAGG

[0068] pIX-del-R (SEQ ID No. 5): CAGGGACATGCTTAACGAAG

[0069] The above PCR product is detected by 1% agarose gel electrophoresis, and it is confirmed that the band is single and the size is correct. Then, the target fragment is recovered and purified using a PCR product recovery kit, and after detecting its concentration and OD260 / 280 ratio, it is stored at -20°C for standby use.

[0070] (3) Construction of pIX gene deletion adenovirus skeleton plasmid pIX-basic by homologous recombination:

[0071] The linearized BJ5183-pADeasy plasmid recovered in step (1) and the "pIX-del" recovered in step (2) are co-transformed into BJ5183 competent cells, and a backbone plasmid of adenovirus with further deletion of the pIX gene on the basis of the original deletion of E1 and E3 is obtained by using the homologous recombination system in the cells, and is named as pADeasy-basic.

[0072] The specific operation steps are as follows:

[0073] The BJ5183 competent cells stored at -80°C are thawed on ice. After the bacterial block is melted, 100 ng of the linearized BJ5183-pADeasy plasmid recovered in step 1 and 500 ng of the "pIX-del" recovered in step 2 are added, and a pipette is used to mix them gently, and they are placed in an ice bath for 10 min.

[0074] The centrifuge tube is placed in a 42°C water bath for heat shock treatment for 90 s, and then quickly transferred to ice for cooling for 10 min.

[0075] 900 μL of LB medium without antibiotics is added to the centrifuge tube, and it is placed in a shaking incubator at 37°C and 200 rpm for recovery culture for 60 min.

[0076] The bacterial solution is centrifuged at 4000 rpm for 5 min, most of the supernatant is discarded, about 100 μL of the remaining medium is used to resuspend the bacterial cells, and they are uniformly coated on an LB solid medium plate containing kanamycin (final concentration of 50 μg / mL).

[0077] The plate is inverted in a 37°C constant temperature incubator and cultured overnight for 12-16 hours.

[0078] The next day, a well-grown single colony is picked from the plate, and colony PCR and Sanger sequencing are performed for verification. The sequencing focuses on the pIX gene region, and it is confirmed that the pIX gene has been successfully knocked out and the sequence of other regions of the backbone plasmid is correct, and the correct recombinant strain is screened.

[0079] The strain identified by sequencing is inoculated in LB liquid medium containing kanamycin for amplification culture, and then a plasmid miniprep kit is used to extract the target plasmid, i.e., pADeasy-basic. The plasmid is an adenovirus universal backbone plasmid with deletion of E1, E3 (part) and pIX genes.

[0080] (4) Linearization of pADeasy-basic plasmid: In order to insert the subsequent "pIX-target gene" fusion fragment, the circular pADeasy-basic plasmid needs to be linearized. The pADeasy-basic plasmid extracted and verified correctly in step (3) is digested with restriction endonuclease BstBI. The BstBI digestion site is located downstream of the pre-set CMV promoter in the E1 deletion region, and is designed for the insertion of exogenous target genes. The specific digestion reaction conditions, agarose gel electrophoresis detection and product recovery method are the same as those described in step (1).

[0081] (5) Preparation of pIX-target gene fusion expression fragment: In this embodiment, the exogenous gene is human papilloma virus type 16 E6 gene (HPV16-E6) as an example. A fusion gene fragment containing the complete coding region of pIX gene, flexible linker sequence and HPV16-E6 gene in sequence is obtained by in vitro gene synthesis.

[0082] The ends of the fragment are designed with sequences matching the ends of the pADeasy-basic plasmid linearized by BstBI in step (4) for subsequent efficient ligation. The fragment is named pIX-HPV16-E6 fragment. The specific sequence of pIX-HPV16-E6 is shown in SEQ ID No. 2, and the fragment is synthesized by a professional company. The sequence of the linker used is shown in SEQ ID No. 3.

[0083] The primers used are:

[0084] pIX-HPV16-E6F (SEQ ID No. 6):

[0085] CTCGAGCCTAAGCTTCGAAATAAGATATCCGATCCACCGG

[0086] pIX-HPV16-E6R (SEQ ID No. 7):

[0087] TTTTTTATTTATGTTttaGCGTGTGCGGCTGCTGCGGC

[0088] The synthesized pIX-HPV16-E6 fragment is subjected to PCR amplification and detected by agarose gel electrophoresis to ensure that the product band is single and the size is correct. The pIX-HPV16-E6 fragment is recovered using a PCR product recovery kit, and the concentration and OD value are detected.

[0089] (6) Construction of recombinant adenovirus plasmid PAd-pIX-HPV16-E6 carrying pIX-target gene fusion sequence:

[0090] The linearized pADeasy-basic backbone plasmid recovered from step (4) is ligated with the pIX-HPV16-E6 fragment recovered from step (5) in vitro. The pIX-HPV16-E6 fragment is inserted precisely into the BstBI enzyme site of the pADeasy-basic backbone plasmid in this example, preferably using a high-fidelity seamless ligation kit (such as HiFi Assembly Mix). The ligation product is transformed into FasT1 competent cells for amplification. The transformed FasT1 strain is expanded and high-purity final recombinant adenovirus plasmid is obtained using a plasmid maxi extraction kit, named PAd-pIX-HPV16-E6. The plasmid is sequenced to confirm that the sequence is correct.

[0091] (7) Packaging, purification, and obtaining capsid-armed adenovirus PAd-pIX-HPV16-E6:

[0092] First, the high-purity PAd-pIX-HPV16-E6 plasmid obtained in step (6) is linearized using the restriction endonuclease PacI to expose the terminal inverted repeat sequence (ITR) of the adenovirus genome. The PacI enzyme digestion reaction conditions are: 37°C, reaction for 1-2 hours. The digested product is purified and stored for later use.

[0093] HEK293A cells are pre-seeded in cell culture plates, and when the cell density reaches 80%-90%, the above linearized PAd-pIX-HPV16-E6 plasmid is transfected into the cells using a liposome transfection reagent (Lipo3000).

[0094] After transfection, the cells are cultured and observed daily for cell state and the appearance of cytopathic effect (CPE). Typically, 7-10 days after transfection, obvious CPE can be observed.

[0095] When the CPE reaches more than 80%, the cell culture supernatant and cell pellet are collected, and the virus particles are released by repeated freeze-thawing. PCR is used to identify the presence of the virus using specific sequences of the viral genome as targets.

[0096] The virus solution obtained initially is used to infect larger-scale HEK293A cells (for example, using a cell factory) for large-scale amplification of the virus.

[0097] The amplified virus culture is collected, and the virus is purified by cesium chloride (CsCl) density gradient ultracentrifugation. After collecting the virus band, CsCl is removed by dialysis.

[0098] The purified virus was subjected to titer determination, followed by aliquoting and long-term storage at -80°C to obtain the capsid-armed adenovirus PAd-pIX-HPV16-E6, the genomic map of which is shown in Figure 3 .

[0099] In addition, to verify the universality of the technical scheme of the present application, the same method as steps 1-7 above was used, and only the target gene in step 5 was replaced with an ovalbumin gene (OVA) to successfully construct and obtain the capsid-armed adenovirus PAd-pIX-OVA carrying the pIX-OVA fusion protein.

[0100] The amino acid sequence of OVA is as follows:

[0101] .

[0102] The nucleic acid sequence of Gallus gallus ovalbumin (SERPINB14) (OVAL), mRNA -Nucleotide-NCBI CDS region is as follows:

[0103] Example 2 Expression identification of capsid-armed adenovirus PAd-pIX-HPV16-E6 in in vitro cells

[0104] To verify whether the capsid-armed adenovirus PAd-pIX-HPV16-E6 constructed in Example 1 can successfully express the target gene it carries in cells, in vitro expression identification was performed in this example.

[0105] HEK-293A cells cultured to the logarithmic growth phase in a 6-well plate were inoculated with the capsid-armed adenovirus PAd-pIX-HPV16-E6 at a multiplicity of infection (MOI) of 5, and uninfected cells were set as a control group, and the culture was continued for 72 hours. Thereafter, the cells were collected and total protein was extracted using RIPA lysis buffer, and after quantification by the BCA method, an equal amount of protein was subjected to Western Blot analysis. An antibody specifically recognizing human papillomavirus type 16 E6 protein was used as a primary antibody for detection.

[0106] As shown in Figure 4 , the results showed that in the cell lysate infected with PAd-pIX-HPV16-E6 virus, a specific band consistent with the expected molecular weight of the pIX-E6 fusion protein could be detected, while the control group did not have this band, indicating that the capsid-armed adenovirus constructed in the present application can successfully express the target gene it carries in vitro.

[0107] Example 3 Detection of humoral immune response induced by capsid-armed adenovirus PAd-pIX-HPV16-E6 in rats in vivo

[0108] To evaluate the immunogenicity of the capsid-armed adenovirus PAd-pIX-HPV16-E6 constructed in Example 1 in vivo, this example detects its ability to induce specific humoral immune response.

[0109] Select 6-8 weeks old female SD rats, the experimental group is immunized by intramuscular injection of 5 x 10 8 PFU of PAd-pIX-HPV16-E6 virus, and the control group is injected with the same volume of PBS. On day 14 after immunization, the rat serum is collected by the method of orbit blood collection. The level of E6-specific antibody in the serum is detected by indirect ELISA method using an enzyme-labeled plate coated with HPV16 E6 recombinant protein in advance.

[0110] As Figure 5 shown, the results show that significantly higher levels of E6-specific antibodies can be detected in the serum of rats immunized with PAd-pIX-HPV16-E6 compared with the PBS control group, proving that the armed adenovirus of the present application can effectively induce specific humoral immune response against the target antigen in vivo.

[0111] Example 4 Detection of cell immune response induced by capsid-armed adenovirus PAd-pIX-HPV16-E6 in rats in vivo

[0112] To further verify the type of immune response induced by the adenovirus of Example 1, this example detects its ability to activate specific cellular immunity.

[0113] The same animal grouping and immunization method as in Example 3 is used, and the rats are sacrificed on day 14 after immunization, and the spleen is taken under sterile conditions to prepare a single spleen cell suspension. The rat IFN-γ ELISpot kit is used, and the HPV16 E6-specific polypeptide library is used as a stimulant to detect the number of T cells that can secrete interferon-γ (IFN-γ) in the spleen cells.

[0114] As Figure 6 shown, the results show that significantly higher levels of E6-specific antibodies can be detected in the serum of rats immunized with PAd-pIX-HPV16-E6 compared with the PBS control group, proving that the armed adenovirus of the present application can effectively induce specific humoral immune response against the target antigen in vivo.

[0115] Example 5 Successful verification of the construction of PAd-pIX-OVA adenovirus

[0116] As Figure 7 and Figure 8As shown, for the capsid-armed adenovirus PAd-pIX-OVA prepared in Example 1, after packaging, purification and titer determination, virus particles with infectivity were obtained.

[0117] The results further demonstrate that the technical platform of fusing an exogenous gene with pIX protein to display on the surface of adenovirus capsid is stable, reliable and universal, which can be used to carry a variety of different exogenous antigens to develop corresponding genetic engineering vaccines or immunotherapy drugs.

[0118] Although the embodiments of the present application have been shown and described above, it should be understood by those skilled in the art that the above embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application.

Claims

1. A method for constructing a pIX region antigen-carrying capsid-armed adenovirus, characterized by, The method comprises the following steps: The first adenovirus skeleton plasmid pADeasy is linearized by using restriction enzyme BstBI; the adenovirus skeleton recombination fragment pIX-del with pIX gene deletion is synthesized in vitro; The linearized first adenovirus skeleton plasmid and pIX-del are co-transformed into competent cells to obtain the second adenovirus skeleton plasmid pADeasy-basic; The second adenovirus skeleton plasmid pADeasy-basic is linearized by using restriction enzyme BstBI; the pIX-target gene fusion expression fragment containing pIX sequence and exogenous antigen gene sequence is prepared, and the two ends of the fragment are designed to have sequences matching the ends of the pADeasy-basic plasmid linearized by BstBI; The linearized second adenovirus skeleton plasmid pADeasy-basic and the pIX-target gene fusion expression fragment are connected in vitro to obtain a recombination plasmid, and the capsid armed adenovirus is obtained through packaging and purification. The gene sequence of the pIX-del is shown in SEQ ID No.

1. The pIX-target gene fusion expression fragment comprises, in sequence from N-terminal to C-terminal, a complete coding region of pIX gene, a flexible Linker sequence and a target gene sequence; the flexible Linker sequence is shown in SEQ ID No.

3. The first adenovirus skeleton plasmid is a type 5 adenovirus, which has a deletion of 1-3523 nt in the E1 region, a deletion of 28130-30820 nt in the E3 region, and an inserted CMV-MCS-polyA expression frame in the E1 region.

2. The method for constructing a pIX region antigen-carrying capsid armed adenovirus according to claim 1, characterized in that, The competent cells are BJ5183 competent cells.

3. The method for constructing a pIX region antigen-carrying capsid armed adenovirus according to claim 1, characterized in that, 4. The method according to claim 1, wherein the exogenous antigen gene sequence is an HPV antigen gene sequence or an OVA antigen gene sequence. The method is constructed by using any one of claims 1-3.

5. An antigen-carrying pIX region capsid-armed adenovirus, characterized in that, ​

Citation Information

Patent Citations

  • Recombinant adenovirus vector for expressing African swine fever virus p34 gene, recombinant adenovirus, method and application

    CN111549066A