VIGS (Vinyl Insulin Growth Sulfate) silencing vector and silencing system of aquilegia serotina and application of VIGS silencing system

Abstract

The invention belongs to the technical field of biology, and particularly relates to a VIGS silence vector of aquilegia occidentalis, a silence system and application thereof, the silence vector comprises pTRV2 and a specific fragment of an aquilegia occidentalis AoPLL14 gene, and the nucleotide sequence of the specific fragment is shown as SEQ ID NO.1. The invention provides the VIGS silence vector of the aquilegia occidentalis AoPLL14 gene, and the VIGS silence system of the aquilegia occidentalis AoPLL14 gene can be used for silence of aquilegia occidentalis AoPLL14 gene. The AoPLL14 gene can be stably knocked out, and functional verification of the AoPLL14 gene is carried out.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a VIGS silencing vector, silencing system and its application for Columbine acuminata. Background Technology

[0002] Columbine with pointed calyx, Latin name Aquilegia oxysepala *Columbia*, a perennial herbaceous plant belonging to the genus *Columbia* in the family Ranunculaceae, is characterized by its beautiful leaves, unique flower shape, long flowering period, easy germination, and ease of hybridization. In landscaping, it can be potted for ornamental purposes, planted among shrubs and along forest edges, and used in flower beds and borders, making it an excellent variety for landscaping in Northeast China. It has significant ornamental and economic value in rural and urban beautification. However, currently, there is a lack of stable and efficient genetic transformation systems for this species, hindering the study of gene function through gene overexpression or knockout, and restricting its phenotypic improvement and basic biological research.

[0003] VIGS is a gene transcription technique developed based on the plant's defense mechanisms against RNA viruses, used to characterize plant gene function. Its underlying molecular basis is post-transcriptional gene silencing. Compared with traditional gene function analysis methods, VIGS can silence and analyze the function of target genes in the current generation of infected plants, avoiding the problem of establishing a stable genetic transformation system, shortening the research cycle, eliminating the need to obtain stable transformants, and having the potential to silence single or multiple gene family members.

[0004] Columbine acuminata is a distinctive perennial flowering plant of the Changbai Mountains region, characterized by its unique flower shape, early blooming period, and strong cold resistance, allowing it to overwinter outdoors in Northeast China, making it of significant ornamental value. However, its gene function analysis and molecular breeding progress are severely limited by the lack of genetic transformation technologies, especially stable genetic transformation systems. Tissue culture regeneration of Columbine acuminata is difficult, making it impossible to obtain stably inherited transgenic plants. This leads to insufficient gene function analysis, making it impossible to verify endogenous gene function through stable overexpression or knockout. Reliance on heterologous systems or indirect evidence results in low reliability, hindering molecular breeding. Although VIGS technology has been successfully applied to various ornamental plants such as roses, daffodils, and lilies, no effective VIGS system has been reported for the establishment and application of such a valuable and difficult-to-transform ornamental plant as Columbine acuminata. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a VIGS silencing carrier, silencing system, and its application for Columbine acuminata.

[0006] A type of columbine with pointed calyx AoPLL14 VIGS silencing vectors for genes, including pTRV2 and Columbine acuminata. AoPLL14A specific fragment of a gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Preferably, the method for constructing the VIGS silencing vector includes the following steps: The specific fragment was ligated to pTRV2 to construct the silencing vector pTRV2- AoPLL14 .

[0008] Preferably, the specific fragment is obtained by PCR amplification; The primer pair used for PCR amplification includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0009] A type of columbine with pointed calyx AoPLL14 A VIGS gene silencing system, comprising: Agrobacterium tumefaciens culture containing pTRV1 and a silencing vector pTRV2- AoPLL14 A mixture of Agrobacterium bacterial suspension; The Agrobacterium bacterial suspension containing pTRV1 and the silencing vector pTRV2- AoPLL14 The volume ratio of Agrobacterium tumefaciens bacterial suspension is 1:1; The pointed-calyx columbinis AoPLL14 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] The VIGS silencing carrier or the VIGS silencing system was used in the identification of Columbine acuminata. AoPLL14 Applications in gene function; The pointed-calyx columbinis AoPLL14 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0011] Preferred, for identifying Columbine with pointed calyx AoPLL14 The method for gene function analysis includes the following steps: seedlings of *Columba acuminata* are infected using the VIGS silencing system and then cultured, and phenotypic changes are observed; when the plant height is lower than that of untreated seedlings... AoPLL14 When the gene is silenced, it indicates that *Columba lanceolata* is a gene-silenced plant. AoPLL14 Genes perform their functions.

[0012] Preferably, the infection method includes: using a vacuum to penetrate the silencing system into wounded Columbine seedlings by immersion.

[0013] Preferably, the method for culturing Columbine acuminate after infection includes culturing at 25°C for 16 hours in light and 8 hours in the dark.

[0014] Preferably, the Agrobacterium includes Agrobacterium GV3101.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a columbine with pointed calyx. AoPLL14 The VIGS gene silencing vector can stably knock out genes. AoPLL14 Genes, proceed AoPLL14 Functional verification of genes.

[0016] This invention establishes a VIGS system in Columbine acuminata, achieving targeted silencing of endogenous genes in this species without relying on a stable genetic transformation system, thus solving the transformation problem. From inoculation to obtaining silenced lines takes only about 3 weeks, and positive lines can be screened from current-generation plants 21 days after inoculation. This is more efficient and faster than traditional stable transformation.

[0017] This invention combines the puncture method with the vacuum permeation method, resulting in higher positive rates and silencing efficiency. By employing optimized methods for preparing engineered bacteria, adjusting bacterial concentration and infection solution ratios, it reduces the complexity of technical operations, eliminating the need for complex tissue culture equipment and requiring only standard culture conditions. Specifically, the improved infection solution formulation enhances both the positive rate and silencing efficiency.

[0018] Inserting target gene-specific fragments of other phenotypes of Columbine acuminata into the multiple cloning site of the pTRV2 vector can be used for functional verification of other phenotypes, such as for the functional verification of genes related to flower color, flower shape, or resistance. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the pTRV1 and pTRV2 vectors.

[0020] Figure 2 Select an illustration for the silent segment.

[0021] Figure 3 for AoPLL14 Electrophoresis image of silenced fragment amplification.

[0022] Figure 4 For pTRV2 and AoPLL14 A schematic diagram of the construction of a silent fragment carrier.

[0023] Figure 5 For pTRV2 and AoPLL14 PCR of silent fragment recombinant colonies.

[0024] Figure 6 pTRV1, pTRV2, pTRV2- AoPLL14 Preparation of bacterial suspensions: A is the first pTRV1 bacterial suspension, B is the second pTRV1 bacterial suspension (the two suspensions are combined before use), C is the pTRV2 bacterial suspension, and D is the first pTRV2-... AoPLL14 Bacterial solution, E is the second pTRV2- AoPLL14 bacterial suspension, pTRV2- AoPLL14 When using the bacterial solution, combine the two portions.

[0025] Figure 7 For inoculum preparation, A is a culture of Agrobacterium tumefaciens pTRV1 and pTRV2- AoPLL14 Equal volumes of Agrobacterium tumefaciens bacterial solutions were mixed, and equal volumes of Agrobacterium tumefaciens bacterial solutions of pTRV1 and pTRV2 were mixed.

[0026] Figure 8 For silent materials.

[0027] Figure 9 Preprocessing for silent materials.

[0028] Figure 10 This is a diagram illustrating puncture wounds in silent materials, where A represents a puncture wound at the root-stem junction and B represents a puncture wound at the root.

[0029] Figure 11 This is a diagram of vacuum permeation operation, where A represents the silent material being placed in the vacuum chamber, and B represents the silent material being removed from the vacuum chamber.

[0030] Figure 12 For the quality detection of cDNA in the silencing material, column 1 is the marker; columns 2-4 are the cDNA of CK plants from three parallel experiments; columns 5-7 are the cDNA of pTRV2 plants from three parallel experiments; columns 8-10 are the cDNA of pTRV2-AoPLL14-1 plants from three parallel experiments; columns 11-13 are the cDNA of pTRV2-AoPLL14-2 plants from three parallel experiments; columns 14-16 are the cDNA of pTRV2-AoPLL14-3 plants from three parallel experiments; and columns 17-19 are the cDNA of pTRV2-AoPLL14-4 plants from three parallel experiments.

[0031] Figure 13 For the silent efficiency test, lowercase letters represent significant differences.

[0032] Figure 14 This is a comparison of plant phenotypes, where A represents WT plants and B represents... AoPLL14 Silent plant. Detailed Implementation

[0033] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0034] The VIGS system operation procedure for Columbine acuminata mainly includes four parts: vector construction, Agrobacterium transformation, plant inoculation, and silencing efficiency detection.

[0035] The Agrobacterium GV3101 used in this invention was purchased from Shanghai Weidi Biotechnology, CAT#: AC1001.

[0036] Related studies have shown that PDS As a reporter gene, it can affect the normal growth and development of columbine plants; ANS As a reporter gene, it affects the flower color of columbine plants, and this invention selects a specific gene. AoPLL14 The VIGS system was established, optimized, and validated to discover the use of specific genes. AoPLL14 The constructed VIGS system will not affect the normal growth and development of Columbine plants, nor will it affect the flower color of Columbine plants.

[0037] This invention obtained specific genes through transcriptome data analysis of Columbine under salt stress. AoPLL14 , AoPLL14 The nucleotide sequence is as follows:

[0038] The materials used in this invention were sourced as follows: 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme purchased from Vazyme, Nanjing, China; DNA Clean-up Kit purchased from CWBIO, Beijing, China; pCloneEZ-TOPO vector purchased from Clone Smarter, USA; and Hieff Clone® Plus One Step Cloning Kit purchased from Yeasen, Shanghai, China.

[0039] Example (1) Carrier selection Vector Selection: To assess the adaptability of *Columba salina*, the tobacco flaking virus vector systems pTRV1 and pTRV2 were selected. The tobacco flaking virus is abbreviated as TRV. The VIGS system constructed based on TRV virus has advantages such as a wide host range, high silencing efficiency, long duration, mild viral symptoms, and infectivity in meristematic tissues. Figure 1 .

[0040] (2) Cloning of silent segments Obtained from the Columbine transcriptome database AoPLL14 The sequence of the gene was used, and the 345bp non-conserved region at the 3' end was selected as the silencing fragment. Figure 2 Specific primers for silencing fragments were designed using Oligo 7.0 software: F: GCACCAGAAAGCGAATGGAAGAA, denoted as SEQ ID NO.2; R: AACTGGACCTATAATATGTGACACT, denoted as SEQ ID NO.3. Using *Columbia acuminata* cDNA as a template, PCR amplification was performed using 2×Phanta Max Master Mix (Dye Plus) high-fidelity enzyme to obtain the PCR products, as shown below. Figure 3 After agarose gel electrophoresis, the PCR products were purified and recovered according to the DNA Clean-up Kit. The recovered products were ligated into the pCloneEZ-TOPO vector and then transformed into *E. coli* DH5α competent cells. After colony PCR detection, positive bacterial cultures were selected for sequencing. Plasmids were extracted from bacterial cultures with correct sequencing results. AoPLL14 The silent segments served as templates for subsequent experiments.

[0041] Vector construction: The pTRV2 plasmid was linearized by single digestion with SmaI restriction endonuclease, as shown below. Figure 4Using the Hieff Clone® Plus One Step Cloning Kit, the cloning process was completed. AoPLL14 The silent fragment sequence was inserted into the pTRV2 vector, and the recombinant vector was named pTRV2- AoPLL14 ,like Figure 5 .

[0042] (3) Agrobacterium transformation Preparation of engineered bacteria: pTRV1, pTRV2, and pTRV2- were prepared using a freeze-thaw method. AoPLL14 The vector was transformed into Agrobacterium competent cells GV3101. Successful transformation was verified by colony PCR. The verified bacterial cultures were inoculated into 2 mL of LB broth containing 50 mg / L Kana and 50 mg / L Rif, and cultured at 28°C with shaking at 200 rpm for 24 h. Then, they were inoculated into 200 mL of LB broth containing 50 mg / L Kana, 50 mg / L Rif, 10 mM MES, and 200 μM AS, and cultured at 28°C with shaking at 200 rpm until the OD600 of the bacterial culture was approximately 2.0–2.1. Figure 6 .

[0043] Induction treatment was performed on bacterial suspensions with an OD600 of approximately 2.0–2.1: Centrifugation was carried out at 4°C and 4000g for 15 min. The supernatant was discarded, and the bacterial blocks were gently resuspended in the infection solution to adjust the OD value to 2.0. The suspensions were then allowed to stand at room temperature for 3–4 hours, gently shaken once every hour, to obtain Agrobacterium-pTRV1, Agrobacterium-pTRV2, and Agrobacterium-pTRV2 suspensions, respectively. AoPLL14 Agrobacterium bacterial suspension. The staining solution consists of MES, MgCl2·6H2O and As. The concentration of MES in the staining solution is 10 mM, the concentration of MgCl2·6H2O is 10 mM, and the concentration of As is 200 μM. MES is the abbreviation for 2-morpholine ethanesulfonic acid, and As is the abbreviation for acetylsuccinone.

[0044] Preparation of inoculum: Mix equal volumes of Agrobacterium tumefaciens suspension containing pTRV1 and Agrobacterium tumefaciens suspension containing pTRV2, and set aside. The Agrobacterium tumefaciens suspension containing pTRV1 and pTRV2... AoPLL14 Mix equal volumes of Agrobacterium tumefaciens bacterial suspension and set aside. Figure 7 .

[0045] (4) Plant inoculation and culture Inoculation subjects: Select 8-10 week old Columbine seedlings with 6-8 leaves, removing older leaves and retaining new leaves. Figure 8 Remove any soil clumps from the roots, soak the roots in water, and rinse them thoroughly with running water, being careful not to damage the roots. Figure 9 .

[0046] Inoculation method: Create tiny wounds on the leaves, root-stem junction, and roots of *Columba pentaphyllum* seedlings using a 1mL sterile syringe, such as... Figure 10 Immerse the treated seedlings in the inoculation solution and place the solution in a vacuum chamber. Start the vacuum pump and maintain the vacuum for 1 minute after the pressure has stabilized. Prolonged vacuum time will increase plant mortality; generally, it should not exceed 2 minutes. Note that bubbles will escape from the solution after the vacuum pump is turned on; be careful not to allow the bubbles to become too large and create a boiling state. Figure 11 Turn off the vacuum pump, quickly open the vacuum chamber, remove the seedlings, and absorb the bacterial solution. Plant the infected seedlings in nutrient soil.

[0047] Culture conditions: After inoculation, Columbine seedlings were managed at 25℃ with 16 hours of light and 8 hours of darkness.

[0048] Silent Efficiency Detection Three to four weeks later, new leaves emerged, and samples were taken to extract RNA from the leaf tissue, which was then reverse transcribed into cDNA. Figure 12 Measured by qRT-PCR AoPLL14 The expression level of [the substance] was measured, with pTRV2 conversion used as a control group, to assess the silencing efficiency. Figure 13 .

[0049] Phenotypic observations such as Figure 14 As shown, after 4 weeks of growth, the height of the positive lines was lower than that of the WT lines. Based on this, we can infer and analyze... AoPLL14 This may have affected cell structure, which in turn affected plant height. Additionally, the leaves of the positive strains were smaller compared to the WT plants.

[0050] This invention constructs a VIGS system suitable for Columbine acuminata, establishing a reliable transient transformation system through screening suitable viral vectors and optimizing inoculation methods. This system aims to induce post-transcriptional silencing of target genes in contemporary plants, rapidly identifying gene function by observing related phenotypic and physiological changes, thereby avoiding dependence on stable genetic transformation. Simultaneously, it provides crucial technical support for screening key genes regulating important traits, laying the foundation for subsequent precision molecular breeding and new variety creation.

[0051] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0052] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0053] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A type of columbine with pointed calyx AoPLL14 The VIGS gene silencing vector is characterized by, The VIGS silencing vectors include pTRV2 and Columbine acuminata. AoPLL14 A specific fragment of a gene, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The VIGS silencing carrier according to claim 1, characterized in that, The method for constructing the VIGS silencing vector includes the following steps: The specific fragment was ligated to pTRV2 to construct the silencing vector pTRV2- AoPLL14 .

3. The VIGS silencing carrier according to claim 2, characterized in that, The specific fragment was obtained by PCR amplification; The primer pair used for PCR amplification includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A type of columbine with pointed calyx AoPLL14 The VIGS gene silencing system is characterized by, The VIGS silencing system comprises: Agrobacterium bacterial suspension containing pTRV1 and silencing vector pTRV2- AoPLL14 A mixture of Agrobacterium bacterial suspension; The Agrobacterium bacterial suspension containing pTRV1 and the silencing vector pTRV2- AoPLL14 The volume ratio of Agrobacterium tumefaciens bacterial suspension is 1:1; The columbinis with pointed calyx AoPLL14 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. The VIGS silencing carrier of claim 1 or the VIGS silencing system of claim 4 in the identification of Columbine lanceolata. AoPLL14 Applications in gene function; The columbinis with pointed calyx AoPLL14 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The application according to claim 5, characterized in that, Identification of Columbine with pointed calyx AoPLL14 The method for gene function analysis includes the following steps: seedlings of *Columba acuminata* are infected using the VIGS silencing system and then cultured, and phenotypic changes are observed; when the plant height is lower than that of untreated seedlings... AoPLL14 When the gene is silenced, it indicates that *Columba lanceolata* is a gene-silenced plant. AoPLL14 Genes perform their functions.

7. The application according to claim 6, characterized in that, The infection method includes: using a vacuum to penetrate the silencing system into wounded Columbine seedlings by immersion.

8. The application according to claim 6, characterized in that, The method for culturing Columbine acuminate after infection includes 25°C, 16h light / 8h dark culture.

9. The application according to claim 6, characterized in that, The Agrobacterium species mentioned include Agrobacterium GV3101.

Images