Nucleic acid quality control sample containing maize chlorotic mottle virus CP gene and maize dwarf mosaic virus CP gene target sequences and preparation method thereof

Abstract

The invention relates to the technical field of gene engineering, and provides a nucleic acid quality control sample containing a corn chlorotic mottle virus CP gene and a corn dwarf mosaic virus CP gene target sequence and a preparation method thereof. The standard substance adopts lentivirus particles as a carrier, and specific nucleic acid fragments of maize chlorotic mottle virus and maize dwarf mosaic virus are integrated into a lentivirus expression system to form a nucleic acid quality control sample with a virus-like structure. The nucleic acid standard substance is presented in the form of virus particles, a protein shell effectively wraps target RNA, a real virus structure is simulated, biological infectivity is avoided, and the whole process from nucleic acid extraction to detection can be monitored. Compared with the prior art, the standard substance overcomes the defect that a traditional RNA quality control substance is easy to degrade, can be stably stored for more than 3 months at normal temperature and can be stably stored for more than 12 months at 4 DEG C, and is suitable for long-distance transportation and clinical application.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and in particular to a nucleic acid quality control sample containing a maize chlorotic dwarf virus CP gene and a maize dwarf mosaic virus CP gene target sequence and a preparation method thereof. BACKGROUND

[0002] Maize chlorotic dwarf virus (MCDV) and maize dwarf mosaic virus (MDMV) are two species-transmitted diseases that can infect crops such as corn and sorghum, and are entry plant quarantine harmful organisms in China. MCDV alone can cause a 10-15% reduction in corn yield, and when it is combined with MDMV and other viruses, it can cause a 90% loss in corn yield. These two viruses have a wide host range and are highly damaging, and once they are introduced into China with imported corn, sorghum and other imported grains, they can pose a huge threat to China's food security and ecological balance. Reverse transcription-polymerase chain reaction (RT-PCR) technology is the "gold standard" for RNA virus detection, and high-quality quality control samples are the key to ensuring accurate and reliable detection results.

[0003] Currently, RNA virus RT-PCR quality control samples mainly include whole virus particles, naked RNA and pseudovirus, etc. Among them, whole virus particles mainly refer to diseased plant materials, which have good stability and can effectively monitor the entire process of viral nucleic acid detection, but have certain biological safety risks, although the risks can be reduced by inactivating the virus, there may still be problems of incomplete inactivation or reduced nucleic acid extraction efficiency; naked RNA is relatively simple to prepare, can be accurately quantified and has no biological safety risks, but its stability is poor and it is easily degraded, and it cannot monitor the entire process of viral nucleic acid detection. SUMMARY

[0004] In order to overcome the shortcomings of the prior art, the present application provides a nucleic acid quality control sample containing a maize chlorotic dwarf virus CP gene and a maize dwarf mosaic virus CP gene target sequence, which has a structure similar to that of a real virus, is long-term stable and easy to transport and store, and a preparation method thereof, in order to overcome the technical defects of existing quality control materials such as easy degradation, harsh storage conditions and difficulty in simulating real samples, thereby improving the accuracy, reliability and standardization level of the detection process of maize chlorotic dwarf virus (MCDV) and maize dwarf mosaic virus (MDMV).

[0005] The technical solution adopted by the present application to solve its technical problems is:

[0006] The first object of the present application provides a nucleic acid quality control sample containing maize chlorotic mottle virus CP gene and maize dwarf mosaic virus CP gene target sequence, which is a pseudovirus standard substance, wherein the RNA wrapped by protein is selected from SEQ ID NO. 1 and SEQ ID NO. 2; and the pseudovirus standard substance is prepared into a freeze-dried form by a pseudovirus particle and a virus protective agent.

[0007] Further, the pseudovirus particle is formed by a lentivirus expression system, and the lentivirus expression vector comprises one or more of pLKO.1, pLenti, pLVX and pCDH.

[0008] Further, the pseudovirus standard substance further comprises an RNAase-free water solution for reconstituting the pseudovirus freeze-dried substance; and after the freeze-dried substance is reconstituted with the RNAase-free water, the RNA concentration is 1x101~1x10 copies / μL.

[0009] Further, the virus protective agent is composed of 5%-10% (w / v) trehalose and 0.1%-1% (w / v) bovine serum albumin.

[0010] The second object of the present application provides a preparation method of a nucleic acid quality control sample containing maize chlorotic mottle virus CP gene and maize dwarf mosaic virus CP gene target sequence, which is used for preparing the nucleic acid quality control sample as described above, and comprises the following steps:

[0011] S1. obtaining the target sequence of maize chlorotic mottle virus CP gene and maize dwarf mosaic virus CP gene by PCR amplification or gene synthesis, wherein the sequence is selected from SEQ ID NO. 1 and SEQ ID NO. 2;

[0012] S2. cloning the target sequence into a lentivirus expression vector by a homologous recombination method to obtain a recombinant expression plasmid;

[0013] S3. transferring the recombinant expression plasmid, lentivirus packaging plasmid and lentivirus envelope plasmid into E. coli for culture, and extracting the plasmid;

[0014] S4. co-transfecting the obtained recombinant expression plasmid, lentivirus packaging plasmid and envelope plasmid into cells to package the pseudovirus particle;

[0015] S5. collecting the cell supernatant, and purifying the pseudovirus particle by centrifugation and filtration;

[0016] S6. mixing the purified pseudovirus particle with a freeze-drying protective agent, and performing freeze-drying treatment to obtain a pseudovirus freeze-dried substance.

[0017] Further, the lentiviral expression vector in step S2 is selected from one or more of pLKO.1, pLenti, pLVX and pCDH.

[0018] Further, the lentiviral packaging plasmid in step S3 is selected from one or more of pCMV-dR8.91, psPAX2, pMDLg / pRRE, pLP1 and pNL4-3; and the lentiviral envelope plasmid is selected from one or more of pMD2.G, pCMV-VSV-G, pLP VSV-G and pVSV-G.

[0019] Further, the method for extracting the plasmid in step S3 comprises: separating the plasmid by alkaline lysis extraction method, purifying the plasmid after ion exchange column chromatography and TE elution, recovering the lentiviral plasmid and removing endotoxin.

[0020] Further, the E. coli in step S3 is Stbl3 strain.

[0021] Further, the cell in step S4 is HEK293T cell; and the purification of the pseudovirus particle comprises: removing cell debris by centrifuging the cell supernatant at 4000xg for 10 minutes at 4℃, filtering the supernatant by using a 0.45μm filter, then centrifuging at 20000xg for 2 hours at 4℃, discarding the supernatant and resuspending by adding virus storage solution.

[0022] The present application has the following beneficial effects:

[0023] 1. The nucleic acid quality control sample containing the target sequence of the maize chlorotic mottle virus CP gene and the maize dwarf mosaic virus CP gene in the present application is finally in the form of virus-like particles. Compared with the standard substance in the form of pure RNA, the standard substance in the form of virus-like particles has similar biological structure with the virus in the field sample, and can monitor the whole process from nucleic acid extraction to nucleic acid detection;

[0024] 2. The pseudovirus in which the RNA is wrapped by the protein shell in the present application simulates the morphology of the maize chlorotic mottle virus and the maize dwarf mosaic virus, and has no biological infectivity compared with the natural virus, and has good safety;

[0025] 3. The standard substance in the present application has good stability, and can be transported under normal temperature conditions, thereby providing guarantee for the value traceability transmission of the standard substance. BRIEF DESCRIPTION OF DRAWINGS

[0026] The present application will be further described below in combination with the drawings and examples.

[0027] Figure 1 is a sample uniformity evaluation result graph of the present application;

[0028] Figure 2is a sample stability evaluation result graph of the present application;

[0029] Figure 3 is a sample accuracy evaluation result graph of the present application. DETAILED DESCRIPTION

[0030] As used herein, the term "and / or", includes any and all combinations of one or more of the associated listed items. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises", "comprising", "includes" and / or "including", when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0031] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0032] The exemplary applications described herein can suitably lack any one or more of the optional elements, limitations, and / or features disclosed herein. Thus, the terms "comprise", "comprising", "include", "including", and the like, are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense that may be implied by use of these terms in some instances. Additionally, the use of "including", "comprising", "having" and "with" and variations thereof herein are meant to encompass the items listed thereafter and equivalents thereof as well as additional items. Unless otherwise noted, the terms "including", "comprising", and "having" and variations thereof herein are meant to be interpreted in an inclusive sense and should be construed to also encompass the items listed after such terms in a non-exclusive and / or exhaustive sense.

[0033] The raw materials or reagents used in the examples and comparative examples of the present application are purchased from mainstream manufacturers in the market. If the manufacturer is not specified or the concentration is not specified, it is an analytical pure grade raw material or reagent that can be obtained conventionally, and there is no particular limitation as long as it can play the expected role. The reaction, stirring and other instruments and equipment used in the examples are purchased from major manufacturers in the market, as long as they can play the expected role, and there is no particular limitation. If the specific technology or condition is not specified in the examples, it is carried out according to the technology or condition described in the literature in the art or according to the product instruction.

[0034] The application discloses a nucleic acid quality control sample of a maize chlorotic mottle virus CP gene and a maize dwarf mosaic virus CP gene target sequence and a preparation method thereof.

[0035] S1. The target sequence of the maize chlorotic mottle virus CP gene and the maize dwarf mosaic virus CP gene is obtained by PCR amplification or gene synthesis, and the sequence is selected from SEQ ID NO. 1 and SEQ ID NO. 2.

[0036] S2. The target sequence is cloned into a lentivirus expression vector by a cloning method to obtain a recombinant expression plasmid, and the lentivirus expression vector is selected from one or more of pLKO.1, pLenti, pLVX and pCDH.

[0037] S3. The recombinant expression plasmid, lentivirus packaging plasmid and lentivirus envelope plasmid are transferred into E. coli for culture, and the plasmid is extracted.

[0038] The method for extracting the plasmid comprises the following steps: the plasmid is separated by an alkaline lysis extraction method, purified after ion exchange column chromatography and TE elution, and the lentivirus plasmid is recovered and endotoxin is removed.

[0039] The lentivirus packaging plasmid is selected from one or more of pCMV-dR8.91, psPAX2, pMDLg / pRRE, pLP1 and pNL4-3.

[0040] The lentivirus envelope plasmid is selected from one or more of pMD2.G, pCMV-VSV-G, pLP VSV-G and pVSV-G.

[0041] The E. coli is a Stbl3 strain.

[0042] S4. The obtained recombinant expression plasmid, lentivirus packaging plasmid and envelope plasmid are co-transfected into cells to package pseudo virus particles.

[0043] The cells are HEK293T cells.

[0044] The purification of the pseudo virus particles comprises the following steps: the cell supernatant is centrifuged at 4 DEG C and 4000xg for 10 minutes to remove cell debris, the supernatant is filtered by using a 0.45 mu m filter, then the supernatant is centrifuged at 4 DEG C and 20000xg for 2 hours, the supernatant is discarded, and virus storage solution is added for resuspension.

[0045] S5. The cell supernatant is collected, and the pseudo virus particles are purified by centrifugation and filtration.

[0046] S6. The purified pseudo virus particles are mixed with a freeze-drying protective agent, freeze-dried to obtain pseudo virus freeze-dried products.

[0047] The specific pseudovirus packaging steps are as follows:

[0048] 1. Add the prepared DNA solution and the corresponding volume of transfection reagent into a sterilized centrifuge tube, mix well, and then adjust the total volume to 1 mL with serum-free medium, and incubate at room temperature for 15 min. Then slowly drop the mixture into the culture dish containing 293T cells, mix gently, and incubate at 37°C under 5% CO2 condition;

[0049] 2. After 6 hrs of culture, discard the culture medium containing the transfection mixture, wash once with 10 mL of sterile PBS, gently shake the culture dish to ensure that the PBS fully washes the residual transfection mixture and is then discarded. Slowly add fresh medium containing 10% serum according to the size of the culture dish (for example, 10 mL for a 10 cm culture dish), and incubate at 37°C under 5% CO2 condition for 48-72 h;

[0050] 3. Collect the supernatant of 293T cells 48 h after transfection according to the cell state, centrifuge at 4000 x g at 4°C for 10 min to remove cell debris. Then filter the supernatant using a 0.45 μm filter into a 40 mL ultracentrifuge tube;

[0051] 4. Centrifuge the filtered solution containing pseudovirus particles at 20000 x g at 4°C for 2 hrs, discard the supernatant, and add an appropriate amount of virus preservation solution, sterile PBS solution, or cell culture solution according to the subsequent application, and resuspend gently;

[0052] 5. After determining the concentration of pseudovirus particles, adjust the resuspended pseudovirus particle solution to the desired concentration, add an appropriate amount of freeze-drying protective agent (trehalose 5%-10% (w / v) and bovine serum albumin 0.1%-1% (w / v)), and then freeze-dry to obtain the pseudovirus freeze-dried product.

[0053] Example 1

[0054] Vector construction:

[0055] 1. Obtain the nucleotide fragments shown in SEQ ID NO. 1 and SEQ ID NO. 2 by PCR amplification;

[0056] 2. Use the GenBuilderTM high-efficiency seamless cloning kit to directionally clone the synthesized gene fragments into the lentiviral expression vector pLKO.1, and confirm the correctness of the loaded gene sequence by sequencing;

[0057] 3. Transform the lentivirus packaging plasmid pCMV-dR8.91 and lentivirus envelope plasmid pMD2.G into E. coli stbl3, incubate in LB medium at 37°C for 16 hours, isolate the plasmid by alkaline lysis extraction method, recover the lentivirus plasmid and remove endotoxin after ion exchange column chromatography, TE elution and plasmid purification;

[0058] 4. Perform endotoxin detection on the recovered plasmid to ensure that the endotoxin content is less than 3 EU / mg.

[0059] Virus packaging:

[0060] 1. Before transfection, trypsinize the logarithmic growth phase 293T cells, adjust the cell density to 5×10^6 cells / 15mL with culture medium containing 10% serum, reseed into a 10cm culture dish, and incubate at 37°C and 5% CO2. When the cell density reaches 70%, transfect.

[0061] 2. Add the prepared DNA solution and the corresponding volume of transfection reagent to a sterilized centrifuge tube, mix well, adjust the total volume to 1mL, and incubate at room temperature for 15min. Then slowly drop the mixture into the culture dish containing 293T cells, mix gently, and incubate at 37°C and 5% CO2.

[0062] 3. After 6h of culture, discard the culture medium containing the transfection mixture, wash once with 10mL of sterile PBS, gently shake the culture dish to wash the residual transfection mixture with PBS and discard. Slowly add 20mL of fresh culture medium containing 10% serum, and incubate at 37°C and 5% CO2 for 48h.

[0063] Virus particle purification:

[0064] 1. Collect the 293T cell supernatant 48h after transfection according to the cell state, centrifuge at 4000xg for 10min at 4°C to remove cell debris. Then filter the supernatant to a 40mL ultracentrifuge tube using a 0.45μm filter;

[0065] 2. Centrifuge the filtered solution containing virus particles at 20000xg for 2h at 4°C, discard the supernatant, and resuspend by gently blowing with sterile PBS solution;

[0066] 3. Determine the concentration of virus particles and make necessary concentration adjustments.

[0067] Virus lyophilization preparation:

[0068] 1. Mix the resuspended lentivirus particle solution thoroughly with an appropriate amount of lyoprotectant consisting of trehalose (5% w / v) and bovine serum albumin (0.1% w / v). Divide the mixed solution into 1 mL aliquots into sterile 5 mL ampoules, loosely cap with a rubber stopper, and then place the ampoules into a pre-frozen tray for loading into a vacuum freeze-dryer.

[0069] 2. Pre-freeze: Hold the product at -80°C for 24 h;

[0070] 3. Primary drying: Raise the temperature to -20°C (vacuum level of 30 Pa) over 1 h and hold for 48 h;

[0071] 4. Secondary drying: Raise the temperature from -20°C to 30°C (vacuum level of 10 Pa) over 10 h and hold for 24 h;

[0072] 5. At the end of the freeze-drying, backfill the container with dry nitrogen and fully seat the rubber stopper into the ampoule, followed by sealing with an aluminum cap.

[0073] Example 2

[0074] Vector construction:

[0075] 1. Obtain the nucleotide fragments shown in SEQ ID NO. 1 and SEQ ID NO. 2 by PCR amplification;

[0076] 2. Use the GenBuilder™ high-efficiency seamless cloning kit to directionally clone the synthesized gene fragments into the lentivirus expression vector pLenti, and confirm the correctness of the loaded gene sequence by sequencing.

[0077] 3. Transform the lentivirus packaging plasmid pCMV-dR8.91 and the lentivirus envelope plasmid pCMV-VSV-G into E. coli stbl3, culture in LB medium at 37°C for 14 hours, isolate the plasmid by alkaline lysis extraction, purify the lentivirus plasmid after ion exchange column chromatography, TE elution, and plasmid purification, and remove endotoxin.

[0078] 4. Perform endotoxin detection on the recovered plasmid to ensure that the endotoxin content is less than 2 EU / mg.

[0079] Virus packaging:

[0080] 1. Before transfection, trypsinize the logarithmically growing 293T cells, adjust the cell density to 5 x 10^6 cells / 15 mL with culture medium containing 10% serum, reseed into a 10 cm culture dish, and culture at 37°C and 5% CO2. Transfect when the cell density reaches 75%.

[0081] 2. Add the prepared DNA solution and corresponding volume of transfection reagent into the sterilized centrifuge tube, mix well, adjust the total volume to 1 mL, and incubate at room temperature for 15 min. Then slowly drop the mixture into the culture dish containing 293T cells, mix gently, and incubate at 37°C and 5% CO2.

[0082] 3. After 6 h of culture, discard the culture medium containing the transfection mixture, wash once with 10 mL of sterile PBS, gently shake the culture dish to wash the residual transfection mixture with PBS and discard. Slowly add 20 mL of fresh culture medium containing 10% serum, and incubate at 37°C and 5% CO2 for 60 h.

[0083] Purification of virus particles:

[0084] The purification steps are the same as in Example 1.

[0085] Freeze-drying preparation of virus:

[0086] The freeze-drying protectant consists of trehalose (8%, w / v) and bovine serum albumin (0.5%, w / v), and the remaining freeze-drying steps are the same as in Example 1.

[0087] Example 3

[0088] Construction of vector:

[0089] 1. Obtain the nucleotide fragments shown in SEQ ID NO. 1 and SEQ ID NO. 2 by PCR amplification;

[0090] 2. Use the GenBuilderTM high-efficiency seamless cloning kit to directionally clone the synthesized gene fragments into the lentiviral expression vector pCDH, and confirm the correctness of the loaded gene sequence by sequencing.

[0091] 3. Transform the lentivirus packaging plasmid pMDLg / pRRE and the lentivirus envelope plasmid pLP VSV-G into Escherichia coli stbl3, culture in LB medium at 37°C for 15 hours, isolate the plasmid by alkaline lysis extraction method, purify the lentivirus plasmid after ion exchange column chromatography, TE elution, and plasmid purification, and remove endotoxin.

[0092] 4. Perform endotoxin detection on the recovered plasmid to ensure that the endotoxin content is less than 1 EU / mg.

[0093] Virus packaging:

[0094] 1. Before transfection, trypsinize the logarithmically growing 293T cells, adjust the cell density to 5 x 10^6 cells / 15 mL with culture medium containing 10% serum, reseed into a 10 cm culture dish, and incubate at 37°C and 5% CO2. When the cell density reaches 80%, perform transfection.

[0095] 2. Add the prepared DNA solution and corresponding volume of transfection reagent into the sterilized centrifuge tube, mix well, adjust the total volume to 1 mL, and incubate at room temperature for 15 min. Then slowly drop the mixture into the culture dish containing 293T cells, mix gently, and incubate at 37℃ and 5% CO2.

[0096] 3. After 6 h of culture, discard the culture medium containing the transfection mixture, wash once with 10 mL of sterile PBS, gently shake the culture dish to wash the residual transfection mixture with PBS and discard. Slowly add 20 mL of fresh culture medium containing 10% serum, and incubate at 37℃ and 5% CO2 for 72 h.

[0097] Purification of virus particles:

[0098] The purification steps are the same as in Example 1.

[0099] Freeze-drying preparation of virus:

[0100] The freeze-drying protectant consists of trehalose (10%, w / v) and bovine serum albumin (1%, w / v), and the remaining freeze-drying steps are the same as in Example 1.

[0101] Example 4

[0102] In the vector construction, use pLVX as the lentiviral expression vector, pLP1 as the lentiviral packaging plasmid, pVSV-G as the lentiviral envelope plasmid, control the endotoxin content to be below 4 EU / mg, and the remaining steps are the same as in Example 1.

[0103] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of virus are the same as in Example 1.

[0104] Example 5

[0105] In the vector construction, use pLKO.1 as the lentiviral expression vector, pNL4-3 as the lentiviral packaging plasmid, pLP VSV-G as the lentiviral envelope plasmid, control the endotoxin content to be below 2.5 EU / mg, and the remaining steps are the same as in Example 2.

[0106] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of virus are the same as in Example 2.

[0107] Example 6

[0108] In the vector construction, use pLenti as the lentiviral expression vector, psPAX2 as the lentiviral packaging plasmid, pCMV-VSV-G as the lentiviral envelope plasmid, control the endotoxin content to be below 0.8 EU / mg, and the remaining steps are the same as in Example 3.

[0109] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of viruses were the same as in Example 1.

[0110] Example 7

[0111] In the vector construction, pCDH was used as a lentiviral expression vector, pMDLg / pRRE was used as a lentiviral packaging plasmid, pMD2.G was used as a lentiviral envelope plasmid, the endotoxin content was controlled to be less than 1.5 EU / mg, and the remaining steps were the same as in Example 1.

[0112] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of viruses were the same as in Example 1.

[0113] Example 8

[0114] In the vector construction, two expression vectors, pLKO.1 and pLVX, were constructed respectively, psPAX2 and pCMV-dR8.91 were used as lentiviral packaging plasmids respectively, pMD2.G and pCMV-VSV-G were used as lentiviral envelope plasmids respectively, and the endotoxin content was controlled to be less than 2 EU / mg, and the remaining steps were the same as in Example 2.

[0115] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of viruses were the same as in Example 2.

[0116] Example 9

[0117] In the vector construction, pLVX was used as a lentiviral expression vector, psPAX2 and pNL4-3 were used as lentiviral packaging plasmids, pCMV-VSV-G was used as a lentiviral envelope plasmid, the endotoxin content was controlled to be less than 0.5 EU / mg, and the remaining steps were the same as in Example 3.

[0118] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of viruses were the same as in Example 3.

[0119] Example 10

[0120] In the vector construction, pLVX was used as a lentiviral expression vector, pLP1 was used as a lentiviral packaging plasmid, pVSV-G was used as a lentiviral envelope plasmid, the endotoxin content was less than 0.1 EU / mg, and the remaining steps were the same as in Example 1.

[0121] The steps of virus packaging, purification of virus particles, and freeze-drying preparation of viruses were the same as in Example 1.

[0122] Performance evaluation

[0123] 1. Uniformity evaluation

[0124] Take 10 portions of the pseudovirus samples of Examples 1-10, 100 μL of sampling amount, and extract the samples according to the requirements of the magnetic bead method plant RNA extraction kit (Magen R6641) using the Thermo KingFisher DUO full-automatic nucleic acid extractor, and amplify according to the primers and reaction parameters specified in GB / T31810-2015 and SN / T 2670-2010.

[0125] The sample uniformity detection results are shown in Figure 1 , where Marker is on the left side of MDMV and on the right side of MCMV; M is Marker C DNA Marker; 1-10 are RNAs extracted from 100 μL of the pseudovirus samples, and the amplification results of the 10 samples are basically consistent, indicating that the sample subpackaging uniformity is good.

[0126] 2. Stability evaluation

[0127] Take 3 samples at 4℃ (no sampling after 30 days) and -20℃ at 14 days, 30 days, 3 months, 6 months and 1 year, respectively, extract and amplify according to the above method to verify the stability of the samples. The stability detection results are shown in Figure 2 , where Marker is on the left side of MDMV and on the right side of MCMV; M is Marker C DNA Marker, and M1 is DL2000 DNA Marker; B is a blank control; a is a sample stored for 14 days, b is a sample stored for 30 days, c is a sample stored for 3 months, d is a sample stored for 6 months, and e is a sample stored for 1 year; 1-3 are samples stored at -20℃, and 4-6 are samples stored at 4℃.

[0128] Within 1 month, the amplification bands of the samples stored at 4℃ will gradually weaken over time, but can still meet the detection requirements. Within 1 year, the samples stored at -20℃ will slightly weaken over time, but can still meet the detection requirements well.

[0129] 3. Evaluation of detection accuracy

[0130] Compare and detect the samples with actual positive samples. The accuracy results are shown in Figure 3 , where a is MDMV, and b is MCMV; M is DL2000 DNA Marker; P1 is the sample of the present research; P2 is the corresponding positive sample; and B is a blank control.

[0131] SEQ ID NO. 1:

[0132] CTACCCGAGGTAGAAAGCAGCGCGGACGTAGCGTGGAAGCAAAATCCAGAGCTATTCGAGCCAACCCGCCTGTCCCTCGACCCAACCCGCAGCGAAACCGTCCCCCACCTGCGGGAACAACCTGCTCCATGTCTGAAATTCTGCTTGCAGTGTCAGCAACAACTGCTGACCAAATTCTCGAGATTCCAGTGTGCGCAGGGATTGACTTCCCAGCTGGAACGCCACCCCGATACATTGGGGCGGCCAAGTGGCTGGCAGCACAATCACAGATGTGGAACACAATTGTGTTCAACTCTGTGCGCATCACTTGGGAAACATTCACAGCAGACACCACTAGCGGATACATCTCAATGGCATTCCTCTCTGATTACATGCTATCAATACCCACTGGGGTGGAGGATGTTGCCAGGATCGGTGCCCTCAGCTACAA.

[0133] SEQ ID NO. 2:

[0134] TGCATCTCCAACTTTCAGACAAATTATGCACCACTTTAGTGATGCAGCTGAAGCGTATATTGAATATAGAAATTCAACAGAAAAATATATGCCAAGATATGCACTTCAGCGGAACTTAACCGACTTTAGCCTTGCACGTTATGCATTTGATTTCTATGAGATATCATCTCGAACTCCAGTGCGCGCAAAGGAAGCCCACATGCAGATGAAAGCAGCAGCAGTCCGTGGTTCAAACACACGGATGTTCGGTCTTGATGGGAATGTCGGAGAAGCCCACGAAAATACAGAACGCCACACAGCTGGCGATGTCAGTCCGAATATGCACTCCCTTCTGGGGGTCCAGCAAGGCCACTGATACGGGGTTTAACTTTTACGCAGTAATTTAGTAATATATAATTAAGCTATTGTGGTGAGGTTTTACCTCGTTAGTTTTATTTATATATTATGCTACGTACCTGCTATGTCTGCAAGTGAGTGAGG.

[0135] The above embodiments are the preferred implementation of the present application, in addition to this, the present application can be implemented in other ways, any obvious replacement without departing from the concept of the present application is within the protection scope of the present application.

Claims

1. A nucleic acid quality control sample containing the CP gene of maize chlorotic mottle virus and the target sequence of the CP gene of maize dwarf mosaic virus, characterized in that: The quality control sample is a pseudovirus standard substance, which includes RNA wrapped in protein, and the RNA is selected from SEQ ID NO.1 and SEQ ID NO.2; The pseudovirus standard material is made into a freeze-dried form from pseudovirus particles and a virus protectant.

2. The nucleic acid quality control sample according to claim 1, characterized in that, The pseudovirus particles are formed by packaging a lentivirus expression system, wherein the lentivirus expression vector includes one or more of pLKO.1, pLenti, pLVX, and pCDH.

3. The nucleic acid quality control sample according to claim 1, characterized in that, The pseudovirus standard material also includes an RNase-free aqueous solution for reconstitution of the pseudovirus lyophilized material; After the lyophilized material was reconstituted with RNase-free water, its RNA concentration was 1×10¹ to 1×10 copies / μL.

4. The nucleic acid quality control sample according to claim 1, characterized in that, The viral protectant consists of 5%-10% (w / v) trehalose and 0.1%-1% (w / v) bovine serum albumin.

5. A method for preparing a nucleic acid quality control sample containing the CP gene of maize chlorotic mottle virus and the target sequence of the CP gene of maize dwarf mosaic virus, used to prepare the nucleic acid quality control sample according to any one of claims 1-4, characterized in that, Includes the following steps: S1. The target sequences of the maize chlorotic mottle virus CP gene and the maize dwarf mosaic virus CP gene were obtained by PCR amplification or gene synthesis, wherein the sequences were selected from SEQ ID NO.1 and SEQ ID NO.2; S2. Using homologous recombination, the target sequence is cloned into a lentiviral expression vector to obtain a recombinant expression plasmid; S3. The recombinant expression plasmid, lentiviral packaging plasmid and lentiviral envelope plasmid are transformed into E. coli for culture, and the plasmids are extracted. S4. The obtained recombinant expression plasmid, lentiviral packaging plasmid and envelope plasmid were co-transfected into cells to package pseudovirus particles; S5. Collect the cell supernatant and purify the pseudovirus particles by centrifugation and filtration; S6. The purified pseudovirus particles are mixed with a lyophilization protectant and then lyophilized to obtain the pseudovirus lyophilized product.

6. The method for preparing nucleic acid quality control samples according to claim 5, characterized in that, The lentiviral expression vector mentioned in step S2 is selected from one or more of pLKO.1, pLenti, pLVX and pCDH.

7. The method for preparing nucleic acid quality control samples according to claim 5, characterized in that, The lentivirus packaging plasmid mentioned in step S3 is selected from one or more of pCMV-dR8.91, psPAX2, pMDLg / pRRE, pLP1, and pNL4-3; The lentiviral envelope plasmid is selected from one or more of pMD2.G, pCMV-VSV-G, pLP VSV-G, and pVSV-G.

8. The method for preparing nucleic acid quality control samples according to claim 5, characterized in that, The method for extracting the plasmid in step S3 includes: separating the plasmid using an alkaline lysis extraction method, purifying the plasmid by ion exchange column chromatography and TE elution, recovering the lentiviral plasmid, and removing the endotoxin.

9. The method for preparing nucleic acid quality control samples according to claim 5, characterized in that, The Escherichia coli mentioned in step S3 is the Stbl3 strain.

10. The method for preparing nucleic acid quality control samples according to claim 5, characterized in that, The cells mentioned in step S4 are HEK293T cells; The purification of the pseudovirus particles includes: centrifuging the cell supernatant at 4000×g for 10 minutes at 4°C to remove cell debris, filtering the supernatant using a 0.45μm filter, centrifuging at 20000×g for 2 hours at 4°C, discarding the supernatant, and resuspending it in virus preservation solution.

Images