Small molecule nucleic acid for targeted inhibition of LncRNA LINC01139 and application of small molecule nucleic acid in preparation of preparation for treating breast cancer

Small molecule nucleic acid drugs that target and inhibit LncRNA LINC01139, including shRNA, siRNA, and ASO, have addressed the problem of poor prognosis in breast cancer patients, significantly reducing breast cancer cell proliferation and tumorigenesis, and providing new treatment options.

CN120905220APending Publication Date: 2025-11-07INNOVATION CENTER OF YANGTZE RIVER DELTA ZHEJIANG UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510935778.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Current technologies lack effective early diagnostic indicators and targeted drug therapies, resulting in generally poor prognoses for breast cancer patients. Some patients experience recurrence, metastasis, or even death, necessitating the search for new targeted intervention strategies.

Method used

Small molecule nucleic acid drugs that target and inhibit LncRNA LINC01139, including shRNA, siRNA, and ASO, are used to significantly reduce the proliferation of breast cancer cells and the size of subcutaneous tumors via carriers such as lipid nanoparticles and viral vectors. The drug composition is used to prepare a breast cancer treatment agent.

Benefits of technology

Significantly inhibiting the expression of LINC01139 reduced the proliferation of breast cancer cells and the size of subcutaneous tumors in mice, providing a novel treatment option for breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_3
    Figure SMS_3
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The invention discloses a small molecule nucleic acid targeting LncRNA LINC01139 and application of the small molecule nucleic acid in preparation of a preparation for treating breast cancer. The small molecule nucleic acid comprises shRNA, siRNA and ASO. According to the LncRNA LINC01139-targeted small molecule nucleic acid and the drug provided by the invention, the proliferation of breast cancer cells and the size and the weight of breast cancer cell mouse subcutaneous tumors can be remarkably reduced by inhibiting the expression of LINC01139 (LINK-A).
Need to check novelty before this filing date? Find Prior Art

Description

(I)TECHNICAL FIELD

[0001] The present application relates to a kind of small molecule nucleic acid for targeting inhibition LncRNA LINC01139 and in preparation treatment breast cancer preparation. (II)BACKGROUND

[0002] Breast cancer has long been an important disease hidden trouble of human health. Although in the past few decades, due to the development of postoperative chemotherapy, radiotherapy, endocrine therapy, targeted therapy and other various adjuvant treatment methods, the overall survival rate of breast cancer patients has been improved, due to the lack of effective early diagnosis index means, targeted drug treatment and prognosis monitoring means, the prognosis of breast cancer patients is generally poor, and a considerable part of patients will relapse, metastasis and even death, therefore, finding potential effective diagnosis and treatment strategy and intervention target point is of great significance and arduous to actively intervene and actively prevent and control major diseases such as breast cancer.

[0003] RNA as one of the main biological macromolecules in cells, plays an important function in the regulation of cell life activities and the occurrence and development of tumors and other major diseases, wherein long-chain non-coding RNAs (Long non-coding RNAs, LncRNAs) as important regulation and effector molecules of cell material and energy metabolism, widely participate in important life activities such as cell signal transduction and gene transcription activation by combining with biological macromolecules such as proteins and phospholipids, and play a regulatory function on basic life processes such as cell growth, proliferation and differentiation. LncRNA LINKA (also known as LINC01139) as a carcinogenic gene, down-regulates the expression of part of antigen presentation related proteins, thereby causing immune escape.

[0004] At present, short hairpin RNA (shRNA), small interfering RNA (siRNA) and antisense oligonucleotide (ASO) are the main forms of RNA targeted drugs developed in clinical. The latest research findings including more than 20,000 unknown long-chain non-coding RNAs with NR number are included in tumor-related diagnosis and treatment research, which will greatly expand the understanding of tumor biology and targeted research of tumor treatment. Nucleic acid drugs targeting RNA are expected to bring revolutionary breakthroughs to clinical treatment of tumors. RNAi technology is widely used in the treatment of malignant tumors and other diseases. Targeting lncRNA by RNAi or antisense oligonucleotide (ASO) and other technologies is expected to realize the development of nucleic acid drugs targeting lncRNA. Therefore, by excavating lncRNAs with important potential application value, evaluating the application potential of lncRNA in tumor clinical diagnosis and treatment has important clinical guiding significance for early warning intervention of tumors. (III)SUMMARY

[0005] The application aims to provide a small molecule nucleic acid for targeting and inhibiting LncRNA LINC01139 and application thereof in preparation of a preparation for treating breast cancer, which can significantly reduce the proliferation of breast cancer cells, reduce the size and weight of subcutaneous tumors of breast cancer cells in mice by inhibiting the expression of LncRNA LINC01139. The small molecule nucleic acid for targeting LncRNA LINC01139 in the application can be used as a therapeutic drug and provide a new method for breast cancer treatment.

[0006] The technical scheme adopted by the application is:

[0007] In a first aspect, the application provides a small molecule nucleic acid for targeting and inhibiting LncRNA LINC01139, which comprises shRNA (short hairpin RNA), siRNA (small interfering RNA) and ASO (antisense oligonucleotide).

[0008] The nucleotide sequence of the shRNA has 90% or more identity with the nucleotide sequence shown in one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

[0009] The nucleotide sequence of the siRNA has 90% or more identity with the nucleotide sequence shown in one of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8.

[0010] The nucleotide sequence of the ASO has 90% or more identity with the nucleotide sequence shown in one of SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13 and SEQ ID NO. 14.

[0011] Further, the nucleotide sequence of the shRNA is preferably shown in one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

[0012] Further, the nucleotide sequence of the siRNA is preferably shown in one of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8.

[0013] Further, the nucleotide sequence of the ASO is preferably shown in one of SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13 and SEQ ID NO. 14.

[0014] Further, the 5' and 3' ends of the ASO nucleotide sequence are modified with a locked nucleic acid (LNA) modification in the 3 bases.

[0015] In a second aspect, the present application provides a drug, wherein the drug takes the small molecule nucleic acid as an active ingredient.

[0016] Further, the drug further comprises a pharmaceutically acceptable carrier, which is one or more of a lipid nanoparticle, a viral vector, an exosome, an extracellular vesicle, a polymer nanoparticle, an inorganic nanocarrier or a virus-like nanocarrier.

[0017] In a third aspect, the present application provides a use of the small molecule nucleic acid or the drug in the preparation of a breast cancer cell proliferation inhibitor.

[0018] Further, the breast cancer cells comprise a breast cancer cell line MDA-MB-231.

[0019] In a fourth aspect, the present application provides a use of the small molecule nucleic acid or the drug in the preparation of a breast cancer treatment.

[0020] Compared with the prior art, the present application has the following beneficial effects:

[0021] The small molecule nucleic acid and the drug targeting LncRNALINC01139 provided by the present application can significantly reduce the proliferation of breast cancer cells and the size and weight of breast cancer cell subcutaneous tumors in mice by inhibiting the expression of LINC01139 (LINK-A). (V) DESCRIPTION OF DRAWINGS

[0022] Figure 1 Figure 3 is a column chart showing the relative expression changes of LINC01139 (LINK-A) after breast cancer cell line MDA-MB-231 is treated with small molecule nucleic acid drugs shRNA, siRNA and ASO targeting LncRNA LINC01139, wherein A represents small molecule nucleic acid drug shRNA, B represents small molecule nucleic acid drug siRNA, and C represents small molecule nucleic acid drug ASO.

[0023] Figure 2 Figure 4 is a chart showing the effect of small molecule nucleic acid drugs shRNA, siRNA and ASO targeting LncRNA LINC01139 on the proliferation of breast cancer cell line MDA-MB-231, wherein A represents small molecule nucleic acid drug shRNA, B represents small molecule nucleic acid drug siRNA, and C represents small molecule nucleic acid drug ASO. (V) SPECIFIC EMBODIMENTS

[0024] The present application will be further described below in conjunction with specific embodiments, but the scope of protection of the present application is not limited to this:

[0025] The experimental cells used in the following examples are breast cancer cell line MDA-MB-231. The amplification enzyme and reverse transcriptase used are purchased from Nanjing Novoprotein Biological Technology Co., Ltd. The reagents used are all analytical grade reagents.

[0026] Example 1, screening of small molecule nucleic acids

[0027] According to the LINC01139 gene sequence (Gene ID: 339535), a small molecule nucleic acid targeting and inhibiting the expression of LncRNA LINC01139 (LINK-A, NCBI Reference Sequence: NR_015407.1, nucleotide sequence as shown in SEQ ID NO. 15) is designed. Specifically, BLOCK-iT RNAi Designer is used to design shRNA, online tool Dharmacon's siDESIGN Center is used to design siRNA, and Antisense Oligonucleotide Finder is used to screen ASO. TM RNAi Designer design shRNA, utilize online tool Dharmacon's siDESIGN Center design siRNA, use Antisense Oligonucleotide Finder screen ASO.

[0028] Table 1, the nucleotide sequence of shRNA is (5'→3'):

[0029]

[0030]

[0031] Table 2, the nucleotide sequence of siRNA is (5'→3'):

[0032]

[0033] Table 3, the nucleotide sequence of ASO is (5'→3'):

[0034]

[0035] SEQ ID NO. 15

[0036]

[0037]

[0038] Example 2, identification of small molecule nucleic acid shRNA, siRNA, ASO inhibiting LncRNA LINC01139 level

[0039] Quantitative Polymerase Chain Reaction (qPCR) is a widely used molecular biology technique that can be used to measure the expression level of specific LncRNA LINC01139 in different cells or after different treatments.

[0040] 1. Breast cancer cell line MDA-MB-231 subculture

[0041] Take the breast cancer cell line MDA-MB-231 out of liquid nitrogen and heat it in a 37°C water bath until it melts. Quickly add the melted cells to a 15 mL centrifuge tube containing 1 mL of DMEM medium containing 10% FBS (fetal bovine serum) in a clean bench, gently blow and mix, centrifuge at 500 rpm for 5 min at room temperature, and discard the supernatant. Add 5 mL of DMEM medium containing 10% FBS to resuspend the precipitate, and then add the cell suspension to a 5 cm diameter culture dish, making sure it covers the bottom of the dish. Place the culture dish in a 37°C, 5% CO2(v / v) cell incubator. Observe the cell morphology and density under a microscope every 12 h, and when the cell density is 85%-95%, proceed to subculture. Take the culture dish out of the cell incubator and discard the medium. Slowly add 1 mL of 1×PBS to the adherent cells, then shake the dish left and right to cover the bottom of the dish, and discard it. Add 1 mL of trypsin and place it in a 37°C, 5% CO2 cell incubator when it covers the bottom of the dish. Observe the cell morphology under a microscope every 30 s, and when the cell edge slowly detaches from the bottom of the dish, add 1 mL of DMEM medium containing 10% FBS to terminate digestion. After gently blowing, transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 500 rpm for 5 min, and discard the supernatant. Add 10 mL of DMEM medium containing 10% FBS to resuspend the precipitate, and then add the cell suspension to a new 10 cm diameter culture dish, shake the dish left and right to cover the bottom of the dish, and then place it in a 37°C, 5% CO2(v / v) cell incubator for subculture. Subculture twice, then add small molecule nucleic acid shRNA, siRNA, ASO for transfection treatment. One day before transfection, trypsinize the cells and plate them to a density of 65%-70% at the time of transfection.

[0042] 2. Small molecule nucleic acid shRNA, siRNA, ASO transfection

[0043] shRNA: Take a 10 cm diameter culture dish as an example, dilute 5 μg shRNA with 500 μL DMEM, and mix well with a pipette to make a mixture A. Dilute 5 μL Hieff Lipofectamine 3000, pipette fully mix and make mixture B, room temperature. Within 5 minutes, pipette mixture A into mixture B, fully mix and make DNA-liposome complex. Replace the medium in the 10 cm dish with 1 mL of new DMEM medium containing 10% FBS, add 500 μL of DNA-liposome complex, gently shake the dish left and right, and place the dish in a cell incubator at 37°C, 5% CO2(v / v) for culture. Replace the medium with DMEM containing 10% FBS after 8-12 hours, continue to culture until the cell density is about 90%, and collect the cells for subsequent experiments.

[0044] siRNA: Take a 10 cm dish as an example, dilute 5 μg siRNA with 500 μL DMEM, and mix fully with a pipette to make mixture A. Dilute 5 μL Hieff Lipofectamine 3000, pipette fully mix and make mixture B, room temperature. Within 5 minutes, pipette mixture A into mixture B, fully mix and make DNA-liposome complex. Replace the medium in the 10 cm dish with 1 mL of new DMEM medium containing 10% FBS, add 500 μL of DNA-liposome complex, gently shake the dish left and right, and place the dish in a cell incubator at 37°C, 5% CO2(v / v) for culture. Replace the medium with DMEM containing 10% FBS after 8-12 hours, continue to culture until the cell density is about 90%, and collect the cells for subsequent experiments.

[0045] ASO: Take a 10 cm dish as an example, dilute 5 μg ASO with 500 μL DMEM, and mix fully with a pipette to make mixture A. Dilute 5 μL Hieff Lipofectamine 2000, pipette to mix well. Incubate at room temperature for 5 minutes. Add 100 μL of Lipofectamine 2000 into 100 μL of Opti-MEM medium, mix well, and incubate at room temperature for 5 minutes. Add the mixture of Lipofectamine 2000 and Opti-MEM medium into the mixture of DNA and DMEM medium, mix well, and incubate at room temperature for 15-20 minutes. Replace the medium in the 10 cm culture dish with 1 mL of new DMEM medium containing 10% FBS, add 500 μL of the DNA-liposome complex, gently shake the culture dish, and incubate at 37 °C in a cell incubator with 5% CO2(v / v). Replace the medium with DMEM medium containing 10% FBS after 8-12 hours, continue to incubate until the cell density is about 90%, and collect the cells for subsequent experiments.

[0046] Control: replace shRNA, siRNA, and ASO with 0.9% normal saline, and perform the same operations. The collected cells are used as controls.

[0047] 3. Detection of relative expression of LncRNA LINC01139

[0048] (1) Extraction of total RNA from cells

[0049] The cells collected after different treatments in step 2 are used to extract total RNA from cells using TRIzol reagent. The specific steps are as follows: add 1 mL of TRIZOL to the cell sample, centrifuge at 500 rpm and 4 °C for 5 minutes, and discard the supernatant. After mixing well, rotate for 30 minutes at 4 °C. Then add 200 μL of chloroform to each tube, vortex for 15 seconds, centrifuge at 12000 rpm and 4 °C for 10 minutes. Use a pipette to take the upper colorless aqueous phase and place it in a new centrifuge tube. Add an equal volume of isopropanol, mix well by inverting the tube 10 times, and precipitate at -20 °C for 10 minutes. Centrifuge at 12000 rpm and 4 °C for 10 minutes. Discard the supernatant and add 500 μL of pre-cooled 75% ethanol solution. Gently tap the tube wall with your fingers to loosen the white RNA precipitate at the bottom. Centrifuge at 12000 rpm and 4 °C for 5 minutes, and discard the supernatant. Repeat once. Perform a brief centrifugation without disturbing the bottom precipitate, and use a pipette to remove as much of the supernatant as possible. Open the centrifuge tube cap and dry at room temperature for 10 minutes. Add 10-100 μL of RNase-free ddH2O according to the amount of cells, and dissolve on ice for 10 minutes. Measure the RNA concentration using a NanoDrop multifunctional spectrophotometer, and control the concentration to be 500-1000 ng / μL.

[0050] (2) Reverse transcription to cDNA

[0051] According to the instructions, use Novozyme reverse transcriptase to reverse transcribe the extracted total RNA into cDNA.

[0052] (3) RT-qPCR detection

[0053] The reaction was carried out by using the reaction system in Table 4, with GAPDH as the internal reference gene, and the BIO-RAD CFXConnect real-time fluorescence quantitative PCR system under the program in Table 5.

[0054] The LINK-A-F / R and GAPDH-F / R primer sequences are as follows:

[0055] LINK-A-F: TTCCCCCATTTTTCCTTTTC, SEQ ID NO. 16;

[0056] LINK-A-R: CTCTGGTTGGGTGACTGGTT, SEQ ID NO. 17;

[0057] GAPDH-F: GAA GGT GAA GGT CGG AGT, SEQ ID NO. 18;

[0058] GAPDH-R: GAA GAT GGT GAT GGG ATT TC, SEQ ID NO. 19.

[0059] Table 4 RT-qPCR reaction system (10 μL):

[0060] cDNA 1 μL F primer (10 uM) 0.4 μL R primer (10 uM) 0.4 μL 2 x SYBR qPCR Master Mix 5 μL ddH2O 3.2 μL

[0061] Table 5 RT-qPCR reaction conditions

[0062]

[0063] The relative expression amount of LncRNA LINC01139 was calculated by using the ΔΔCt method. First, the Ct difference (ΔCt) of the target gene (LINC01139) and the internal reference gene (GAPDH) was calculated, and then the difference (ΔΔCt) between the experimental group and the control group was compared. The data can be converted into relative expression amount by the formula 2^(-ΔΔCt). The results show that the small molecule nucleic acid drugs shRNA, siRNA, ASO targeting LncRNA LINC01139 can significantly inhibit the expression level of LncRNA LINC01139 in breast cancer cell line MDA-MB-231. Figure 1

[0064] Example 3, breast cancer cell in vitro colony formation ability detection

[0065] The in vitro colony formation ability detection (Colony Formation Assay) of breast cancer cells is a commonly used experimental method for evaluating the proliferation and clonogenicity of cells.​

[0066] The cells were treated by steps 1 and 2 of Example 2, when the cells were in logarithmic growth phase, the cells were trypsinized, washed with PBS, suspended and counted; the cell suspension was evenly inoculated into a 96-well plate and the cell suspension concentration was adjusted to 2000 cells / well with PBS. The 96-well plate was placed in a cell incubator at 37°C, 5% CO2 for 3-4 days; the 96-well plate was taken out, the cells were gently washed with PBS for two to three times; an appropriate amount of formaldehyde was added, and fixed at room temperature for 15 minutes; the fixing solution was poured out, an appropriate amount of crystal violet staining solution was added, and stained at room temperature for 15-30 minutes; the stained cells were washed to remove excess staining solution; a BIO-RAD ChemiDoc MP imager was used to take pictures and count the number of colonies in each well. Colony formation capacity = colony number / number of inoculated cells x 100%. The results show that the small-molecule nucleic acid drugs targeting LncRNA LINC01139, shRNA, siRNA and ASO can significantly inhibit the colony formation of breast cancer cell line MDA-MB-231 (Figs. 11A-C). Figure 2

[0067] The above examples are used to understand the method and main idea of the present application. It should be noted that those skilled in the art can make some improvements to the present application without departing from the principles of the present application, and these improvements are also within the protection scope of the claims of the present application.​

Claims

1. A small-molecule nucleic acid that targets and inhibits LncRNA LINC01139, characterized in that, The small molecule nucleic acid comprises shRNA, siRNA, ASO; The nucleotide sequence of the shRNA has 90% or more identity to one of the nucleotide sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO.

4. The nucleotide sequence of the siRNA has 90% or more identity to one of the nucleotide sequences shown in SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO.

8. The nucleotide sequence of the ASO has 90% or more identity to one of the nucleotide sequences shown in SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, and SEQ ID NO.

14.

2. The small nucleic acid molecule of claim 1, wherein The nucleotide sequence of the shRNA is shown in one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO.

4.

3. The small nucleic acid molecule of claim 1, wherein The nucleotide sequence of the siRNA is shown in one of SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO.

8.

4. The small nucleic acid molecule of claim 1, wherein The nucleotide sequence of the ASO is shown in one of SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, and SEQ ID NO.

14.

5. The small nucleic acid molecule of claim 1, wherein The 5' and 3' ends of the nucleotide sequence of the ASO are modified with a locked nucleic acid.

6. A medicament, characterized by comprising: The drug comprises the small molecule nucleic acid of any one of claims 1-5 as an active ingredient.

7. The medicament according to claim 6, wherein The drug further comprises a pharmaceutically acceptable carrier, which is one or more of a lipid nanoparticle, a viral vector, an exosome, an extracellular vesicle, a polymeric nanoparticle, an inorganic nanocarrier, or a virus-like nanocarrier.

8. Use of the small molecule nucleic acid of claim 1 or the drug of claim 6 in the preparation of a breast cancer cell proliferation inhibitor.

9. Use according to claim 8, wherein the compound is ###0002### The breast cancer cell comprises a breast cancer cell line MDA-MB-231.

10. Use of the small molecule nucleic acid of claim 1 or the drug of claim 6 in the preparation of a breast cancer treatment.