Self-induced protein expression vector of escherichia coli T7 system and application of self-induced protein expression vector in trehalose enzyme method production

Abstract

The invention discloses a self-induced protein expression vector of an escherichia coli T7 system and application of the self-induced protein expression vector in trehalose enzyme method production, and belongs to the technical field of molecular biology. The invention discloses a self-induced protein expression vector of an escherichia coli T7 system. The sequence of the self-induced protein expression vector is shown as SEQ ID NO. 1. Compared with a pET expression vector needing an IPTG inducer and cooling induction, the self-induced expression vector pRT7K constructed by the invention has the advantages that the inducer does not need to be added, the self-induced expression vector pRT7K is not limited to a self-induced culture medium, protein self-induced expression can be realized in a cheap LB or M9 basic culture medium, low-temperature induction is not needed, the soluble expression is high, and the vector is economic and safe. The method can further reduce the production cost of large-scale recombinant fermentation protein products such as enzyme preparations and the like, and can be used for high-throughput screening in laboratories.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and more particularly to a self-induced protein expression vector of E. coli T7 system and its application in trehalase method production. BACKGROUND

[0002] As the preferred platform for foreign protein expression, E. coli expression system occupies a core position in industrial enzyme preparation and recombinant protein production, among which the expression system based on T7 promoter is favored. At present, the foreign protein expression based on T7 system generally uses LB or M9 basic medium, which is simple in composition and low in cost, but needs to rely on isopropyl thiogalactoside (IPTG) or lactose for induction regulation. As a chemical inducer, IPTG not only significantly inhibits the growth of host bacteria, but also causes the cost of industrial production to increase sharply due to its high cost. Although the use of lactose instead of IPTG can partially alleviate the above problems, the traditional induction process still needs manual intervention to add the inducer and induce by reducing the temperature, which has inherent defects such as complicated operation, high risk of bacterial contamination and difficulty in subsequent separation and purification. In recent years, the self-induced medium developed by glucose-lactose metabolic switching mechanism realizes the automation of the induction process, however, this system still has technical bottlenecks such as complex medium composition, high cost, the need to match precise fermentation equipment and poor universality, which seriously restricts the popularization and application of this technology in domestic fermentation industry.

[0003] Therefore, it is an urgent problem for those skilled in the art to provide a self-induced protein expression vector of E. coli T7 system and its application in trehalase method production. SUMMARY

[0004] Therefore, the present application provides a self-induced protein expression vector of E. coli T7 system and its application in trehalase method production, and a more convenient and effective protein self-induced expression vector is constructed. With BL21(DE3) as the host bacteria, the lac-related genes in the pET vector are removed, and the original replicon is replaced with a medium-low copy RSFori, which is applied to the self-induced protein expression of various proteins in inexpensive LB or M9 basic medium. This technology provides an economic and universal solution for the industrial application of prokaryotic expression system, provides a new type of vector and strain matching for large-scale and low-cost production of biological agents using prokaryotic fermentation system, simplifies the production process, has very important economic and social benefits, and has significant industrial application value.

[0005] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0006] A self-induced protein expression vector pRT7K of E. coli T7 system, the sequence of which is shown in SEQ ID NO. 1.

[0007] The self-induced protein expression vector pRT7K of the E. coli T7 system is based on the pET vector, lac-related genes are deleted, the background leakage effect of the amplified inducible T7 promoter is reduced, and the original replicon is replaced by a medium-low copy RSF ori to balance the metabolism and expression burden of the bacteria, so that the E. coli can automatically start the expression of the target gene in the cheap LB or M9 basic medium.

[0008] Further, the application discloses an application of the self-induced protein expression vector pRT7K of the E. coli T7 system in protein expression.

[0009] Further, the application discloses an application of the self-induced protein expression vector pRT7K of the E. coli T7 system in protein expression without adding an inducer.

[0010] Further, the application discloses an application of the self-induced protein expression vector pRT7K of the E. coli T7 system in protein expression in the LB or M9 medium.

[0011] Further, the application discloses an application of the self-induced protein expression vector pRT7K of the E. coli T7 system in the production of trehalase.

[0012] Compared with the prior art, the self-induced protein expression vector of the E. coli T7 system and the application thereof in the production of trehalase are provided, the self-induced expression vector constructed by the application has the advantages of not needing to add an inducer, not needing to induce at low temperature, not needing to depend on expensive self-induced culture medium for self-induced capacity, and highly soluble expression of proteins, the plasmid can be used to efficiently self-induce the expression of green fluorescent protein GFP and malt-oligosaccharide-based trehalose hydrolase MTHase in the cheap LB or M9 medium, the system does not need to add an inducer such as lactose or IPTG to express the target protein, and the system is very useful for protein expression, especially industrial protein and high-throughput protein expression of many samples. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of the provided drawings.

[0014] Figure 1 Plasmid maps of the vector pET-Δlac (A) and the self-induced vector pRT7K (B);

[0015] Figure 2Plasmid map of expression vector pET-GFP(A) and autoinduction expression vector pRT7K-GFP(B);

[0016] Figure 3 Plasmid map of expression vector pET-MTHase(A) and autoinduction expression vector pRT7K-MTHase(B);

[0017] Figure 4 Autoinduction expression of GFP in E. coli for UV observation; wherein, 1: pRT7K-GFP bacterial body; 2: pET-GFP uninduced bacterial body; 3: pET-GFP-IPTG induced bacterial body;

[0018] Figure 5 SDS-PAGE of crude enzyme solution; wherein, 1: solarbio PR1910 marker; 2: pRT7K-MTHase crude enzyme solution supernatant; 3: pRT7K-MTHase crude enzyme solution precipitate; 4: pET-MTHase-IPTG crude enzyme solution supernatant; 5: pET-MTHase-IPTG crude enzyme solution precipitate; 6: pET-MTHase crude enzyme solution supernatant; 7: pET-MTHase crude enzyme solution precipitate;

[0019] Figure 6 Gray scale scanning, comparison of expression amount of pET-MTHase, pET-MTHase-IPTG and pRT7K-MTHase crude enzyme solution supernatant;

[0020] Figure 7 Schematic diagram of principle of MTHase catalyzing maltodextrin to generate trehalose through cascade of MTSase and 4-α-glycosyltransferase. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0022] Materials and reagents: Plasmid construction host Escherichia coli DH5a, chassis expression host Escherichia coli BL21(DE3), plasmids pGFPuv, pRSFduet-1 and pET-28a(+) are all commercial products. M9 medium is purchased from Qingdao Rishui Biotechnology Co., Ltd. Plasmid extraction kit, DNA purification and recovery kit are purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.; SDS-PAGE gel rapid preparation kit is purchased from Shanghai Yezhen Biomedicine Technology Co., Ltd.; the use methods of the above kits refer to the product instructions.

[0023] Primers and gene synthesis, gene sequencing are completed by Genki Biotech Co., Ltd. (Shanghai).

[0024] The preparation of Escherichia coli competence refers to the preparation method of CaCl2.

[0025] In the trehalose generation reaction system, maltodextrin is a self-produced product of Kangtong (Shanghai) Biotechnology Co., Ltd., and the disodium hydrogen phosphate and sodium dihydrogen phosphate used for the preparation of phosphate buffer are purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; MTSase and MTHase expression strains refer to pBAD-MTSase-op strain and pBAD-MTHase-op strain in patent 202411264163.0; 4-alpha-glycosyltransferase strain refers to A470F mutant strain in the literature (Xie Jingwen et al., Semi-rational design to improve the diversification activity of 4-alpha-glycosyltransferase and its application in industrial production, Food and Fermentation Industries, ISSN 0253-990X, CN 11-1802 / TS); saccharifying enzyme and pullulanase are purchased from Shandong Longkete Enzyme Co., Ltd.

[0026] The sequence of pRT7K plasmid is shown in SEQ ID NO. 1.

[0027]

[0028] The sequence of the pET-Δlac plasmid is shown in SEQ ID NO. 2.

[0029]

[0030] The RSF ori sequence is shown in SEQ ID NO. 3.

[0031] CTTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGCGGTGTCAGCTCACTCAAAAGCGGTAATACGGTTATCCACAGAATCAGGGGATAAAGCCGGAAAGAACATGTGAGCAAAAAGCAAAGCACCGGAAGAAGCCAACGCCGCAGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGCCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTTGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCATTGGTAACTGATTTAGAGGACTTTGTCTTGAAGTTATGCACCTGTTAAGGCTAAACTGAAAGAACAGATTTTGGTGAGTGCGGTCCTCCAACCCACTTACCTTGGTTCAAAGAGTTGGTAGCTCAGCGAACCTTGAGAAAACCACCGTTGGTAGCGGTGGTTTTTCTTTATTTATGAGATGATGAATCAATCGGTCTATCAAGTCAACGAACAGCTATTCCGTT; SEQ ID NO. 3.

[0032] Construction of Example 1 vector pET-Δlac

[0033] Primers were designed according to the plasmid map gene sequence of pET-28a(+) and pET-28a(+) plasmid as a template. The vector backbone sequence removing lac-related genes was amplified using pET-F and pET-R as primers.

[0034] Upstream primer: pET-F:

[0035] 5'- ATGTAAGTTAGCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAG ATATACCA-3'; SEQ ID NO. 4 (underlined as overlapping region). TAATACGACTCACTATAGG Downstream primer: pET-R:

[0036] 5'- GCGCAACGCAATTAATGTAAGTTAGC-3'; SEQ ID NO. 5 (underlined as overlapping region).

[0037] CCTATAGTGAGTCGTATTA PCR amplification reaction system (50 μl): in 50 μl system, add 1 μl of template, Prime STAR Max DNA Polymerase 25 μl, pET-F 2 μl, pET-R 2 μl, ddH2O 20 μl.

[0038] PCR amplification reaction program: 98 ℃ 1 min; 98 ℃ 15 s, 59 ℃ 15 s, 72 ℃ 2 min, 32 cycles; 5 ℃ ∞.

[0039] The amplified plasmid fragment was digested to remove the template sequence by DMT enzyme incubation at 37 ℃ for 2 h, and then transformed into E. coli DH5α. The correct vector was named pET-Δlac after PCR verification and sequencing verification. The plasmid map of pET-Δlac vector is shown in A.

[0040] Figure 1 Construction of vector pRT7K

[0041] RSF ori replicon was amplified by PCR with pRSFDuet-1 plasmid as template and pRSFDuet-F / R as primers.

[0042] The kana resistance gene fragment was amplified by PCR with pET-Δlac plasmid as template and pET-Δlac-1-F / R as primers.

[0043] The T7 plasmid backbone with lac-related genes and original replicon deleted was amplified by PCR with pET-Δlac plasmid as template and pET-Δlac-2-F / R as primers.

[0044] The specific primer sequences are as follows:

[0045] Upstream primer: pRSFDuet-F: 5'- ATGTAAGTTAGCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAG ATATACCA-3'; SEQ ID NO. 4 (underlined as overlapping region).

[0046] Downstream primer: pRSFDuet-R: 5'- GCGCAACGCAATTAATGTAAGTTAGC-3'; SEQ ID NO. 5 (underlined as overlapping region). AAGGATCTTCCTTCCGCTTC ​CTCGCTCAC-3';SEQ ID NO.6 (underlined area is overlapping region);

[0047] Downstream primer: pRSFDuet-R:

[0048] 5'- TGCTGGCGTTAACGGAATAG CTGTTCGTTGACTTGA-3';SEQ ID NO.7 (underlined area is overlapping region);

[0049] Upstream primer: pET-Δlac-1-F: 5'- CGAATGGGCAGGTGGC ACTTTTCGGG-3';SEQ ID NO.8 (underlined area is overlapping region);

[0050] Downstream primer: pET-Δlac-1-R

[0051] 5'- GAAGCGGAAGGAAGATCCTT TGATCTTTTCTACGGGGT-3';SEQ ID NO.9 (underlined area is overlapping region);

[0052] Upstream primer: pET-Δlac-2-F: 5'- CTATTCCGTTAACGCCAGCA ACGCG-3'; SEQ ID NO.10 (underlined area is overlapping region);

[0053] Downstream primer: pET-Δlac-2-R: 5'- GCCACCTGCCCATTCG CCAATCCGG-3';SEQ ID NO.11 (underlined area is overlapping region).

[0054] The PCR amplification system and procedure are the same as above.

[0055] The amplified RSF ori and kana resistance gene fragments, as well as the T7 plasmid backbone (with lac-related genes and original replicons deleted) were digested with DMT enzyme at 37°C for 2 hours to remove template sequences. Agarose gel electrophoresis was performed, and the recovered DNA fragments were named A1, A2, and A3, respectively. A1, A2, and A3 were ligated using the Minerva Super Fusion Cloning Kit at 50°C for 30 minutes, and then transformed into *E. coli* DH5α. The vector, confirmed by PCR and sequencing, was named pRT7K. The plasmid map of the pRT7K vector is shown below. Figure 1 B.

[0056] Example 3: Construction of expression vectors pET-GFP and pRT7K-GFP

[0057] GFP fragment was amplified by PCR using pGFPuv plasmid as template and GFP-pd-F / R as primers.

[0058] pET-28a(+) plasmid as template and pET-zt1-F / R as primers.

[0059] pRT7K plasmid as template and pRT7K-zt1-F / R as primers.

[0060] GFP fragment was ligated into vector backbone pET-28a(+) and pRT7K, respectively, to construct expression vector pET-GFP and auto-induction expression vector pRT7K-GFP.

[0061] The specific primer sequences are as follows:

[0062] Upstream primer: GFP-pd-F: 5’- ATGGTGAGCAAGGGCGAG G-3’; SEQ ID NO. 12 (underlined as overlapping region);

[0063] Downstream primer: GFP-pd-R: 5’- TTACTTGTACAGCTCGTC CATGCC-3’; SEQ ID NO. 13 (underlined as overlapping region);

[0064] Upstream primer: pET-zt1-F:

[0065] 5’- GACGAGCTGTACAAGTAA GATCCGGCTGCTAACAAAGC-3’; SEQ ID NO. 14 (underlined as overlapping region);

[0066] Downstream primer: pET-zt1-R:

[0067] 5’- CTCGCCCTTGCTCACCAT GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGG-3’; SEQ ID NO. 15 (underlined as overlapping region);

[0068] Upstream primer: pRT7K-zt1-F:

[0069] 5’- GACGAGCTGTACAAGTAA GATCCGGCTGCTAACAAAGC-3’; SEQ ID NO. 16 (underlined as overlapping region);

[0070] Downstream primer: pRT7K-zt1-R:

[0071] 5'-GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGGC-3'; CTCGCCCTTGCTCACCAT GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGGC-3'; SEQ ID NO. 17 (overlapping region underlined).

[0072] PCR amplification system and procedure as above.

[0073] The amplified GFP fragment, pET28a(+) and pRT7K plasmid backbone were digested to remove the template sequence using DMTase at 37°C for 2h, agarose gel electrophoresis was performed and gel recovery was performed, and the recovered DNA fragments were named B1, B2 and B3, respectively. Minerva Super Fusion Cloning Kit seamless cloning kit was used to ligate B1 and B2 and B1 and B3 at 50°C for 30min, and then transformed into E. coli DH5α. The correct vector was named pET-GFP (plasmid map see Figure 2 A) and pRT7K-GFP (plasmid map see Figure 2 B).

[0074] Example 4 Construction of expression vectors pET-MTHase and pRT7K-MTHase

[0075] PCR amplification of MTHase fragment using pBAD-MTHase-op plasmid as template and MTHase-pd-F / R as primers.

[0076] PCR amplification of vector backbone pET28a(+) using pET28a(+) plasmid as template and pET-zt2-F / R as primers.

[0077] PCR amplification of vector backbone pRT7K using pRT7K plasmid as template and pRT7K-zt2-F / R as primers.

[0078] Construction of expression vector pET-MTHase and autoinduction expression vector pRT7K-MTHase by ligating MTHase fragment into vector backbone pET28a(+) and pRT7K, respectively.

[0079] The specific primer sequences are as follows:

[0080] Upstream primer: MTHase-pd-F: 5'-GTC-3'; SEQ ID NO. 18 (overlapping region underlined). ATGAACCGACGATTCCCG

[0081] ​Downstream primer: MTHase-pd-R: 5'- ATGCGCGGCTTCTTAAAGTTAAACAAAATTATTTCT AGAGG-3'; SEQ ID NO. 21 (underlined is overlapping region); TCACTCGAGGCGCACGAT CG-3'; SEQ ID NO. 19 (underlined is overlapping region);

[0082] Upstream primer: pET-zt2-F: 5'- GATCCGGCTGCTAACAAAGCC-3'; SEQ ID NO. 20 (underlined is overlapping region);

[0083] 5'- GATCCGGCTGCTAACAAAGCC-3'; SEQ ID NO. 20 (underlined is overlapping region); ATCGTGCGCCTCGAGTGA GATCCGGCTGCTAACAAAGCC-3'; SEQ ID NO. 20 (underlined is overlapping region);

[0084] Downstream primer: pET-zt2-R: 5'- GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGG-3'; SEQ ID NO. 21 (underlined is overlapping region);

[0085] 5'- GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGG-3'; SEQ ID NO. 21 (underlined is overlapping region); CGGGAATCGTCGGTTCAT GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGG-3'; SEQ ID NO. 21 (underlined is overlapping region);

[0086] Upstream primer: pRT7K-zt2-F: 5'- TAAGATCCGGCTGCTAACAAAGC-3'; SEQ ID NO. 22 (underlined is overlapping region);

[0087] 5'- TAAGATCCGGCTGCTAACAAAGC-3'; SEQ ID NO. 22 (underlined is overlapping region); ATCGTGCGCCTCGAGTGA TAAGATCCGGCTGCTAACAAAGC-3'; SEQ ID NO. 22 (underlined is overlapping region);

[0088] Downstream primer: pRT7K-zt2-R: 5'- GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGGC-3'; SEQ ID NO. 23 (underlined is overlapping region);

[0089] 5'- GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGGC-3'; SEQ ID NO. 23 (underlined is overlapping region); CGGGAATCGTCGGTTCAT GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT AGAGGC-3'; SEQ ID NO. 23 (underlined is overlapping region).

[0090] PCR amplification system and procedure are the same as above.

[0091] The amplified MTHase fragment and pET-28a(+) plasmid backbone and pRT7K plasmid backbone were digested respectively to remove template sequences using DMTase at 37°C for 2h, agarose gel electrophoresis was performed and gel recovery was performed, the recovered DNA fragments were named as C1, C2 and C3 respectively. C1 and C2 and C1 and C3 were connected respectively at 50°C for 30min using Minerva Super Fusion Cloning Kit seamless cloning kit, and then transformed into E. coli DH5α. The correct vector was named as pET-MTHase (plasmid map see Figure 1) and pRT7K-MTHase (plasmid map see Figure 2) respectively after PCR and sequencing verification. Figure 3A) and pRT7K-MTHase (see plasmid map of Figure 3 B).

[0092] Example 5 Self-induction expression of green fluorescent protein GFP in inexpensive LB basal medium

[0093] (1) Construction of engineering bacteria

[0094] The expression vector pET-GFP and the self-induction expression vector pRT7K-GFP were transformed into E. coli BL21 (DE3) by chemical heat shock transformation method, respectively, and were coated on LB solid plates (10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride, 15 g / L agar) containing 50 μg / mL kanamycin. Inverted overnight culture in 37°C incubator. Single clone colonies were selected for PCR and sequencing identification.

[0095] (2) Detection of fluorescence intensity of pRT7K-GFP by ultraviolet gel imager

[0096] The BL21 (DE3) containing expression vector pRT7K-GFP or pET-GFP was transferred into 100 mL fresh LB medium (10 g / L peptone, 5 g / L yeast powder, 10 g / L sodium chloride) containing 50 μg / mL kanamycin at 1:100 (v / v), respectively, and were labeled as ①, ② and ③. The ① sample was the self-induction pRT7K-GFP strain, the ② sample was the pET-GFP strain, and the ③ sample was the pET-GFP-IPTG strain with the addition of IPTG at a final concentration of 0.5 mM. The culture was incubated at 37°C and 220 rpm, and 0.5 mM IPTG was added to ③ when OD 600 was about 0.8, and the temperature was reduced to 28°C for induction culture, and ① and ② were incubated at 37°C. Every 2 h, 1 mL of the above two groups of sample bacterial solution was centrifuged and resuspended and washed twice with 0.9% NaCl. The expression of green fluorescent protein GFP was observed under ultraviolet gel imager and photographed. The real-time expression of GFP in E. coli observed by ultraviolet was shown in Figure 4 .

[0097] The results show that the pRT7K-GFP self-inducing expression vector can realize constant temperature self-inducing protein expression in a cheap LB basic medium without additional addition of any inducer and low temperature conditions, and the fluorescence intensity of the pRT7K-GFP expression vector group reaches the highest when the culture is for 24 hours, while the original pET-GFP plasmid vector has no any fluorescence signal without addition of IPTG inducer. Meanwhile, in the cheap LB medium, the self-inducing plasmid pRT7K-GFP in the application shows the fluorescence intensity comparable to that of the pET-GFP control group induced by IPTG at a low temperature, indicating that the self-inducing plasmid does not lose the expression amount at the same time of simplifying the Escherichia coli expression process.

[0098] Example 6 Self-inducing expression of maltodextrin chitotriosidase (MTHase) in a cheap M9 basic medium

[0099] (1) Construction of engineering bacteria

[0100] The expression vectors pET-MTHase and pRT7K-MTHase are respectively transformed into Escherichia coli BL21 (DE3) by using a chemical heat shock transformation method, and are coated on LB solid plates containing 50 μg / mL kanamycin and cultured in an incubator at 37°C overnight. Single clone colonies are selected for PCR and sequencing identification.

[0101] (2) Protein expression

[0102] The single clone pRT7K-MTHase correctly identified by sequencing is inoculated into 5 mL of LB liquid medium containing 50 μg / mL of kanamycin resistance, and is cultured overnight at 37°C in a constant temperature shaker at 220 rpm. 500 μL of the overnight culture is transferred to 50 mL of M9 liquid medium containing 50 μg / mL of kanamycin resistance, and is self-induced for expression for more than 16 hours at 37°C in a shaker at 220 rpm.

[0103] After the culture is completed, the bacterial liquid (OD 600 of about 4) is poured into a 50 mL centrifuge tube, and is centrifuged at 4°C and 8000 rpm for 10 min. After the supernatant is discarded, 30 mL of physiological saline is added to resuspend the bacterial body, and after the volume is adjusted, the bacterial body is centrifuged at 4°C and 8000 rpm for 10 min. After the supernatant is discarded, the centrifugation is continued for 2 min, and the liquid is completely removed using a pipette gun, and is stored in a refrigerator at -80°C for standby. After the bacterial body is freeze-dried using a freeze vacuum freeze dryer, the freeze-dried bacterial powder is obtained. After 8 mL of Tris-HCl (100 mM, pH 8.0) buffer is added to the bacterial body, the bacterial body is ultrasonically broken, and the cell fragments are removed by centrifugation to obtain the supernatant of the crude enzyme liquid; the same volume of Tris-HCl (100 mM, pH 8.0) buffer is used to resuspend the centrifugal precipitate to obtain the precipitate of the crude enzyme liquid.

[0104] The preparation method of the crude enzyme solution of the control group pET-MTHase is the same as above, one group without adding IPTG inducer (pET-MTHase), and the other group adding IPTG with a final concentration of 0.5 mM after culturing to OD of about 0.8 and inducing at 28°C (pET-MTHase-IPTG).

[0105] The crude enzyme solution of MTHase expressed by self-induction in M9 medium is subjected to SDS-PAGE, and the loading amount and protein marker are both 5 μl, and the results are shown in Figure 5 The protein band of the crude enzyme solution of the self-induction plasmid pRT7K-MTHase is thick and dark in color with the naked eye, and the expression amount is equivalent to that of the pET-MTHase-IPTG control group induced by adding IPTG and reducing temperature, while the pET-MTHase control group without adding inducer has basically no target band, which represents that the pRT7K self-induction expression vector in the application can realize high expression of MTHase by self-induction protein solubility in M9 basic medium. The imageJ software is used to test the gray scale of the protein band in the supernatant of the crude enzyme solution, and the gray scale of the target protein of the pET-MTHase without adding inducer is used as the unit control group, and the target protein expression amount of the pRT7K-MTHase is shown in Figure 6 , which is about 11.71 times of the pET-MTHase without induction, and is equivalent to the expression amount of the pET-MTHase-IPTG.

[0106] Example 7 Application of self-induction maltose oligosaccharide-based trehalose hydrolase (MTHase) in trehalose synthesis

[0107] (1) Preparation of MTSase and 4-α-glycosyltransferase crude enzyme solution

[0108] In the process of producing trehalose from maltodextrin, the roles of maltose oligosaccharide-based trehalose synthase MTSase, maltose oligosaccharide-based trehalose hydrolase MTHase, and 4-α-glycosyltransferase are shown in Figure 7 .

[0109] The MTSase and 4-α-glycosyltransferase expression strains are respectively inoculated into 5 mL of LB liquid medium containing 50 μg / ml of kanamycin resistance (10 g / L of proteose peptone, 5 g / L of yeast powder, and 10 g / L of sodium chloride), and cultured at 37°C in a constant temperature shaker at 220 rpm for 8 h, then transferred to 200 mL of LB liquid medium containing 50 μg / ml of kanamycin resistance, and cultured to OD600=0.8, then 2% of arabinose inducer is added, and placed in a constant temperature shaker at 28°C and 220 rpm for 16 h. After the culture is finished, the bacterial liquid is poured into a 200 mL centrifuge tube, centrifuged at room temperature at 4000 rpm for 20 min. After the supernatant is discarded, pure water is added to constant volume to OD 600= 25, the bacteria were resuspended by oscillation, and then were ultrasonically broken for 20 min to obtain MTSase and 4-α-glycosyltransferase crude enzyme solutions.

[0110] (2) Trehalose conversion experiment of self-induced pRT7K-MTHase

[0111] In the process of trehalose production from maltodextrin, the role of MTHase is to hydrolyze the 1,4 glycosidic bond between trehalose and maltodextrin in maltodextrin-trehalose to release trehalose product, which is a key rate-limiting step in trehalose synthesis. Figure 7

[0112] The trehalose production reaction system is as follows:

[0113] In a 20 ml reaction system, 300 g / L maltodextrin, 100 μl of commercial pullulanase (enzyme activity 4000 U / ml), 480 μl of MTSase crude enzyme solution, 200-400 μl of self-induced MTHase crude enzyme solution (pET-MTHase and pET-MTHase-IPTG crude enzyme solution as control group), 600 μl of 4-α-glycosyltransferase crude enzyme solution, and 500 μl of disodium hydrogen phosphate / sodium dihydrogen phosphate buffer (stock solution 1M, pH 6.0) were added, and ddH2O was added to 20 ml.

[0114] The trehalose production reaction conditions and subsequent treatment are as follows:

[0115] The reaction system was placed at 57°C with a rotation speed of 120 rpm for 12 h. After the reaction was completed, the pH was adjusted to about 4.3, 500 μl of commercial saccharifying enzyme (enzyme activity 130000 U / ml) was added, and the reaction was continued at 60°C for 1 h to completely hydrolyze the remaining maltodextrin in the reaction system into glucose for subsequent product detection. After the reaction was completed, the reaction was boiled for 10 min to inactivate the enzyme, the supernatant was obtained by centrifugation, and 50 μl of the reaction solution was taken and diluted 30 times in 1450 μl of ultrapure water for liquid chromatography detection.

[0116] Liquid chromatography detection and conversion rate calculation are as follows:

[0117] The sample was filtered through a 0.22 μm water filter membrane for standby use. The liquid chromatography system was first flushed with ultrapure water as the mobile phase at a flow rate of 0.5 mL / min for 0.5-1 h, a Sugar-Pak Column (10 μm, 6.5 mm x 300 mm) chromatographic column was installed, and after the baseline and pressure were stable, the sample filtered through a 0.22 μm water filter membrane was injected 10 μL. The sugar components in the sample were qualitatively determined according to the retention time of the standard, and the trehalose conversion rate was calculated according to the peak area ratio of the sample. The conversion rate results are shown in Table 1.

[0118] ​Table 1. Results of trehalose reaction catalyzed by self-induced MTHase involved multi-enzyme catalytic system

[0119]

[0120] The crude enzyme solution of the self-induced pRT7K-MTHase expressed at constant temperature in M9 basic medium can achieve a conversion rate of more than 80% with a 200 μL enzyme amount, while the conversion rate of the crude enzyme solution of pET-MTHase without adding an inducer is only about 8% under the same conditions. In comparison, the pRT7K-MTHase in the present application shows the superiority of protein expression amount and enzyme activity. The trehalose conversion experiment shows that the enzyme protein obtained by self-induced expression has correct catalytic activity, proving that the self-induced system can be used for expressing heterologous proteins in E. coli and good results can be achieved. Compared with the pET plasmid, the pRT7K vector in the present application can realize self-induced expression at constant temperature in M9 basic medium, and the target protein shows correct enzyme activity, and the catalytic level is comparable to that of the pET plasmid induced by adding IPTG inducer at low temperature.

[0121] The self-induced pRT7K protein expression vector is successfully constructed, and the self-induced expression of various recombinant proteins in inexpensive LB or M9 basic medium is realized by taking E. coli BL21 (DE3) as a host. The preliminary research shows that the pRT7K expression vector has the advantages of IPTG-free induction, high protein expression amount, no need for low-temperature induction, no dependence on expensive self-induced medium, and self-induced realization by using inexpensive LB or M9 basic medium, which provides a potential idea for the industrialized demand of large-scale fermentation production of recombinant proteins, and has a broad application prospect.

[0122] The above description of disclosed embodiments enables one skilled in the art to make or use the application. Numerous modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be applied to other embodiments without departing from the spirit or scope of the application. Therefore, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A self-induction protein expression vector pRT7K of an E. coli T7 system, characterized in that, The sequence is shown as SEQ ID NO.

1.

2. Use of the self-inducing protein expression vector pRT7K of the E. coli T7 system of claim 1 in protein expression.

3. Use of the self-inducing protein expression vector pRT7K of the E. coli T7 system of claim 1 in protein expression without adding inducer.

4. Use of the self-inducing protein expression vector pRT7K of the E. coli T7 system of claim 1 in protein expression in LB or M9 medium.

5. Use of the self-inducing protein expression vector pRT7K of the E. coli T7 system of claim 1 in trehalase method production.

Images