Cell-free cloning reaction system, kit and application of cell-free cloning reaction system
By optimizing the cell-free cloning reaction of the λRed system and DNA ligase system, the design complexity and high cost of Gibson cloning technology in DNA fragment splicing have been solved, realizing efficient and low-cost multi-fragment splicing, which is suitable for molecular cloning, plasmid construction and gene pathway assembly.
Patent Information
- Application Number
- CN202511432107.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-09
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-10-09
AI Technical Summary
Existing Gibson cloning technology suffers from problems in DNA fragment splicing, including design complexity, high cost, high mutation rate, limited splicing scale, difficulty in handling cytotoxic sequences, and strong dependence on reaction conditions, making it difficult to meet the needs of efficient, simple, and low-cost multi-scenario applications.
An optimized λRed system and DNA ligase system were used to prepare a cell-free cloning reaction system using E. coli cell lysate. The system contained Exo, Beta, Gam proteins and T4 DNA ligase, which simplified the operation process, improved splicing efficiency and stability, and was suitable for multi-fragment splicing.
It achieves rapid, low-cost, and efficient DNA splicing with a multi-fragment splicing positivity rate of up to 99%, reducing the overall reaction cost and making it suitable for high-throughput and industrial applications.
Smart Images

Figure CN120905273A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, in particular to a cell-free cloning reaction system, a kit and application thereof. BACKGROUND
[0002] Molecular cloning is an indispensable step in the process of constructing recombinant expression vectors, and efficient and simple DNA fragment splicing and assembly technology directly affects the research efficiency and cost in the field of genetic engineering, synthetic biology and related fields. A current mainstream seamless DNA assembly technology is Gibson Assembly (Gibson cloning), which relies on the overlapping region between DNA fragments, and realizes seamless splicing of multiple DNA fragments through the synergistic effect of T5 exonuclease (Exo), DNA polymerase and DNA ligase in the same reaction system.
[0003] Although Gibson cloning shows strong adaptability and wide application scenarios in multi-fragment DNA splicing, it still has the following significant limitations in actual use: (1) design complexity and operation limitation: Gibson cloning requires that the DNA fragments to be spliced be pre-designed and constructed with 20-42 bp length of homologous overlapping region. With the increase of the number of spliced fragments, the difficulty of fragment design and primer synthesis is significantly improved, which reduces the flexibility and universality of operation; (2) reagent dependence and high cost: this method relies on commercial enzyme mixtures (usually containing T5 Exonuclease, Phusion DNA polymerase and Taq DNA ligase), and the overall reaction cost is high, especially when high-throughput and parallel construction is carried out, the economic burden is significant; (3) mutation rate and error splicing risk: each junction region in Gibson cloning may introduce mutations or mismatches due to inaccurate polymerase amplification or ligase splicing, especially in multi-fragment splicing or high GC content templates, the error rate and empty clone proportion are significantly increased; (4) splicing scale is limited: this technology has obvious efficiency decline when dealing with large fragments (>10 kb) or multi-fragment (>5) assembly, the success rate is nonlinearly attenuated with the number of splicing, which limits the application ability in complex pathway construction; (5) cell toxicity sequence is not easy to handle: Gibson cloning needs to obtain positive clones through cell transformation, if the inserted sequence encodes a cytotoxic protein or causes host burden, it is easy to cause cloning failure or low positive rate, which further increases the experimental period and cost; (6) strong dependence on reaction conditions: Gibson cloning is sensitive to DNA concentration, fragment ratio, overlapping region GC content, structure stability and other parameters, which puts high requirements on experimental design and system stability, and it is difficult to realize "ready-to-use" rapid splicing reaction.
[0004] Therefore, a rapid, low-cost, high-stability, and multi-scene adaptive cell-free cloning system continues to be developed. SUMMARY
[0005] In view of the defects in the prior art, the present application provides a cell-free cloning reaction system, a kit and an application thereof. The present application significantly improves the positive rate and splicing efficiency of DNA splicing by optimizing the components of the cell lysate and the expression system, and exhibits better performance than Gibson cloning in complex situations such as multi-fragment splicing, and is expected to be widely popularized as the next generation of molecular cloning platform in scientific research and industry.
[0006] The present application provides a cell-free cloning reaction system, comprising a cell lysate, an inserted DNA fragment and a linear vector. The cell lysate is obtained by lysing Escherichia coli after induction expression, and the Escherichia coli expresses a lambda Red system and a ligase system. The lambda Red system comprises Exo protein, Beta protein and Gam protein. The nucleotide sequence encoding the Exo protein is shown in SEQ ID NO. 1, the nucleotide sequence encoding the Beta protein is shown in SEQ ID NO. 2, and the nucleotide sequence encoding the Gam protein is shown in SEQ ID NO. 3. The ligase system comprises DNA ligase. Expression of the lambda Red system is controlled by an RBS sequence, and the nucleotide sequence of the RBS sequence is shown in SEQ ID NO. 4.
[0007] In some embodiments, the Escherichia coli is selected from any one of DH10B, DH5a, BW25113, BL21(DE3), JM1165 or a genetically engineered strain thereof; preferably DH10B. The lysate prepared by expression of Escherichia coli DH10B has the best cell-free splicing effect, can reduce non-specific recombination and endonuclease degradation of foreign DNA, thereby improving the stability of the inserted fragment and the vector; the metabolic and protein folding environment of DH10B is more suitable for the activity of Exo, Beta, Gam and DNA ligase, and exhibits unique high-efficiency splicing effect in the system.
[0008] In some embodiments, the DNA ligase is selected from any one of T4 DNA ligase, T3 DNA ligase and T7 DNA ligase; preferably T4 DNA ligase, which has strong catalytic activity and substrate adaptability, can efficiently catalyze the ligation of cohesive ends and blunt ends of DNA, and still maintains high activity under the condition of low ATP or complex fragment splicing, thus the selection of T4 DNA ligase can provide more stable and efficient ligation reaction, thereby significantly improving the overall splicing effect.
[0009] In some embodiments, the number of inserted DNA fragments is ≥1, preferably 1-6, when the number of inserted DNA fragments is 1-6, the splicing efficiency and positive rate of the system can be maintained at a high level, which is more in line with the controllability and application requirements of experiments.
[0010] In some embodiments, the ligase system is expressed by a plasmid containing a p15A replication origin; the p15A replication origin is a medium copy number plasmid replication element, which can ensure sufficient expression of the ligase in the host cell, and can also avoid the burden on the host metabolism caused by too high copy number or protein misfolding; in addition, medium copy number is conducive to the stability of protein concentration in the lysate, thereby improving the controllability and repeatability of cell-free splicing reaction.
[0011] In some embodiments, the inserted DNA fragment comprises a homologous arm fragment, and the length of the homologous arm fragment is 15-45 bp; too short homologous arm may lead to decreased recombination efficiency, increasing the risk of error splicing or non-splicing; while too long homologous arm will increase the cost of DNA synthesis, the difficulty of fragment preparation and the complexity of the reaction system; preferably the length of 15-45 bp homologous arm can ensure the splicing efficiency and specificity, while taking into account the simplicity and economy of experimental operation.
[0012] In some embodiments, the reaction condition of the cell-free cloning reaction system is incubation at 25-37°C for 10-60 min. The temperature range can ensure the activity of Exo, Beta, Gam protein and DNA ligase in the system, and can also maintain the stability of the reaction system; the incubation time takes into account the reaction sufficiency and operation efficiency, which can complete the efficient splicing of the inserted fragment and the linear vector in a short time, while avoiding DNA fragment degradation or side reactions caused by long time incubation.
[0013] In some embodiments, the preparation method of the cell lysate comprises the following steps: (1) placing the RBS sequence upstream of the start codon of the Exo protein, Beta protein and Gam protein coding sequence to obtain a λRed expression plasmid; (2) inoculate the host strain of the lambda Red expression plasmid and the ligase expression plasmid into LB liquid medium containing antibiotics for pre-culture; (3) dilute and inoculate the bacterial liquid after culture in (2) into LB liquid medium for culture until OD 600 is 0.5-1, to obtain bacterial liquid 1; (4) add IPTG to the bacterial liquid 1, and harvest the bacterial body after 8-12 hours of continuous induction; (5) use Tris-HCl buffer containing triton X-100 to lyse the bacterial body obtained in (4), to obtain the cell lysate.
[0014] In some embodiments, in step (4), the concentration of IPTG is 0.5-1 mM.
[0015] The application further provides a cell-free cloning reaction kit comprising the cell lysate.
[0016] The application further provides application of the cell-free cloning reaction system in molecular cloning, plasmid construction, library construction or gene path assembly.
[0017] In summary, compared with the prior art, the application achieves the following technical effects: 1. The application provides a rapid, inexpensive and efficient cell-free cloning reaction system based on the lambda Red system and the ligase system, which simplifies the experimental process, avoids human error and compatibility problems between enzymes by codon optimization of key proteins of the lambda Red system, fine regulation of the RBS sequence, and collaborative design with the ligase system, and constructs an engineered cell lysate containing Exo, Beta, Gam proteins and DNA ligase after expression. The prepared lysate can be mixed with glycerol for cryopreservation, and only 1 μL needs to be thawed for direct use, which is convenient for laboratory daily use and high-throughput automated splicing platform construction.
[0018] 2. The optimized lambda Red system and the high-efficiency DNA ligase system can complete the efficient splicing of multiple fragment DNAs within 37°C and 15 minutes, and still maintain a high positive rate in multiple fragment assembly systems, wherein in a splicing cloning of up to 6 fragments, the positive rate can be as high as 99%, which shows better effect than Gibson cloning, effectively reduces the workload of subsequent verification and screening, and improves the overall experimental efficiency and reliability.
[0019] 3. The cell lysate used in the application is obtained by ordinary E. coli fermentation culture and low-cost lysis, which avoids the use of expensive commercial enzyme mixtures, and the overall reaction cost is reduced by nearly 100 times compared with Gibson reaction, which is more suitable for large-scale construction or high-throughput screening platform.
[0020] 4、The present application solves the problem of inconsistent enzyme expression in different batches of cell lysate by expressing ligase on a plasmid containing a p15A replication origin, effectively improving system stability and batch consistency, and being suitable for industrial and commercial preparation. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. Other related drawings can also be obtained by those of ordinary skill in the art without creative labor on the basis of these drawings.
[0022] Figure 1 Preparation process of Extract of Embodiment 1 of the present application; Figure 2 Specific operation process of seamless connection assembly experiment of Embodiment 2 of the present application; Figure 3 Statistical diagram of the number of positive clones and the cloning rate of the two-fragment 20bp Overhang assembly transformation detection of the effect of T4 DNA Ligase of Embodiment 2 of the present application; Figure 4 Schematic diagram of two-fragment 30bp Overhang assembly of Embodiment 3 of the present application; Figure 5 Transformation colony PCR detection results of the two-fragment 30bp Overhang assembly reaction detection of the effect of T4 DNA Ligase of Embodiment 3 of the present application; Figure 6 Statistical diagram of the number of positive clones and the cloning rate of the 30bp Overhang assembly transformation detection of the effect of T4 DNA Ligase of Embodiment 3 of the present application; Figure 7 Statistical diagram of the number of positive clones and the cloning rate of the 42bp Overhang assembly transformation detection of the effect of T4 DNA Ligase of Embodiment 4 of the present application; Figure 8 Statistical diagram of the number of positive clones and the cloning rate of the multi-fragment assembly transformation detection of the effect of T4 DNA Ligase of Embodiment 5 of the present application; Figure 9 Statistical diagram of the number of positive clones and the cloning rate of the different length Overhang assembly transformation detection of the effect of T3 and T7 DNA Ligase of Embodiment 6 of the present application; Figure 10 Plasmid map of Embodiment 1 of the present application containing λRed recombination elements; Figure 11 Plasmid map of pET-T4 ligase carrying plasmid for example 1 of the present application Figure 12 Full-length alignment results of Sanger sequencing of the transformation positive clone assembled by 30bp Overhang for detecting the effect of T4 DNA ligase for example 3 of the present application. DETAILED DESCRIPTION
[0023] In order to make the person skilled in the art better understand the present application, the technical solutions in the embodiments of the present application are described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by the person skilled in the art without creative labor should belong to the scope of protection of the present application.
[0024] Although the cell lysate of RecA deletion type Escherichia coli such as DH10B, DH5α, BW25113, BL21(DE3), JM1165 has certain in vitro homologous recombination activity in nature, which can be used to clone PCR fragments with short homologous arms into vectors as an alternative to Gibson assembly, but the method has low assembly efficiency under the condition of short homologous arms (such as 15-20 bp), which is mainly limited by low colony formation rate, and it is difficult to meet the demand of efficient and rapid molecular cloning. The present application significantly improves the assembly efficiency and stability of the lysate in multi-fragment seamless assembly by introducing and expressing the optimized λRed system and DNA ligase system from different sources. The λRed system contains three core protein components: Exo protein, Beta protein and Gam protein, which are indispensable. Among them, Gam protein prevents endogenous RecBCD and SbcCD nuclease from digesting linear DNA introduced into Escherichia coli; Exo protein: has 5' to 3' exonuclease activity, specifically degrades the 5' end of double-stranded DNA, can gradually degrade the 5' end of exogenous linear double-stranded DNA, and produce partial double-stranded structure with 3' single-stranded overhang, or directly form complete single-stranded DNA when the DNA fragment is short. These processed DNAs are necessary intermediates for subsequent Beta protein recognition and annealing; Beta protein protects the single-stranded DNA produced by Exo and promotes its annealing with the complementary single-stranded DNA target in the cell. Only the expression of Beta is needed to recombine the ssDNA oligonucleotide substrate. The codon optimization and ribosome binding site (RBS) regulatory sequence of each component are optimized, wherein the optimized RBS sequence is: TTTTTATAAGCGTCGACTGTTTCCTGTGTGAAA (SEQ ID NO. 4).
[0025] The cell lysis solution system constructed by the application can complete seamless splicing within 15 minutes, maintain a positive rate of >99% in a cloning task of up to 6 fragments, and reduce the overall cost by nearly 100 times compared with the Gibson reaction, and is a new cell-free cloning platform with high efficiency, low cost and rapid response characteristics.
[0026] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used are commercially available unless otherwise specified.
[0027] Example 1 Construction and induced expression of λRed system The construction and induced expression of the optimized λRed system include Figure 1 as shown, including the following steps: First, the plasmid containing the three λRed recombination elements Exo, Beta and Gam (as shown in Figure 10 ) and the plasmid carrying pET-T4 ligase (T4 DNA ligase, nucleotide sequence as shown in SEQ ID NO. 5) (plasmid map as shown in Figure 11 ) are co-transformed into the target DH10B E. coli strain to obtain the transformed bacteria. The transformed bacteria are inoculated on a double-antibiotic plate containing Carbenicillin (100 μg / mL) and Chloramphenicol (50 μg / mL), and incubated at 37°C overnight to select single colonies. The positive single colony is inoculated into 5 mL of LB liquid medium, and incubated at 37°C, 220 rpm overnight. The next day, the bacterial solution is diluted 1:100 into 50 mL of fresh LB medium, and incubated at 37°C, 220 rpm. When the OD 600 of the bacterial solution reaches 0.5-1.0, 1 mM of IPTG is added, and the induction is continued at 25°C, 220 rpm overnight to promote the expression of λRed protein and T4 DNA ligase.
[0028] The induced bacterial solution is centrifuged at 4°C, 5000 rcf for 15 minutes to remove the supernatant, and the cell pellet is collected. The pellet can be used immediately or stored at -80°C for later use. For the bacterial solution required for the reaction, 1.2 mL of lysis solution is used to incubate the cell pellet at room temperature for 10 minutes to lyse the cells completely. The lysis solution is Tris-HCl buffer (50 mM, pH 8.0) containing 5% v / v Triton X-100. Then 300 μL of 100% glycerol is added in equal volume, and the final concentration of glycerol in the lysis solution is 50% v / v. The cell lysis solution can be divided into 50 μL / tube and stored at -20°C for at least 6 months, and only 1 μL is needed each time for DNA assembly.
[0029] Example 2 20 bp homologous arm seamless DNA assembly and efficiency detection The insert with 20 bp homologous arms (nucleotide sequence shown in SEQ ID NO. 8) and linear vector (nucleotide sequence shown in SEQ ID NO. 9) were amplified and purified respectively. 20 bp-GBA-kit (Gibson assembly control group: using full type Gibson Assembly®-Basic Seamless Cloning and Assembly Kit as control), 20 bp-WT (WT control group: lysate obtained by lysing wild type strain without λRed system and T4 ligase), 20 bp-λRed (λRed alone group: lysate obtained by lysing strain with only λRed system), 20 bp-λRed+T4 (T4+λRed combination group: lysate obtained by lysing strain with λRed system and T4 ligase) and 20 bp-T4 (T4 DNA Ligase alone group: lysate obtained by lysing strain with only T4 ligase) were set up respectively, and each group was proportioned according to the reaction components in Table 1, and the assembly experimental operation process is shown in Figure 2 .
[0030] Table 1 Components of Lysis Solution Assembly Reaction
[0031] The Eva buffer used in this experiment was prepared with ultrapure water (ddH2O, prepared by Millipore ultrapure water machine), and the specific components are shown in the table below; all buffers were sterilized by 0.22 μm polyether sulfone (PES) filter membrane, stored at -20℃ in the dark, and the effective period was 1 month.
[0032] Table 2 Components of Eva Buffer
[0033] Each group was incubated at 37℃ for 15 minutes, and the reaction solution was directly used for competent transformation and plate culture. After plate culture, the number of positive clones was counted, and specific PCR confirmation was performed on randomly picked clones, and the positive rate was calculated.
[0034] The results are shown in Figure 3 , showing the number of positive clones and the positive clone rate of each group. Compared with WT, T4 DNA Ligase and λRed system respectively promoted the assembly of DNA fragments, and when T4 DNA Ligase and λRed system existed at the same time, the promotion was enhanced, and was significantly better than the positive rate of T4 DNA Ligase and λRed system alone (PValue<0.000)1; the positive clone rate of each group was more than 97%, among which the positive rate of λRed+T4 was similar to Gibson.
[0035] Example 3 30bp homologous arm seamless DNA assembly and efficiency detection The insert fragment (nucleotide sequence see SEQ ID NO. 10) containing 30bp homologous arm and linear vector (nucleotide sequence see SEQ ID NO. 11) were prepared. The assembly was carried out according to the steps of Example 2, and divided into 30bp-GBA-kit (Gibson assembly control group), 30bp-WT (WT control group), 30bp-λRed (λRed alone group), 30bp-λRed+T4 (T4+λRed combined group) and 30bp-T4 (T4 DNA Ligase alone group), Figure 4 The historical map of two fragment 30bp Overhang assembly products.
[0036] Each group was incubated at 37°C for 15 minutes, and the reaction solution was directly used for competent transformation and plate culture. After plate culture, the number of positive clones was counted, and 5 clones were randomly picked for specific PCR confirmation (target band: 720bp, electrophoresis conditions: 1% agarose, 1xTAE, 160V, 28min; input: 2 μL), and the positive rate was calculated.
[0037] The results are shown in Figure 5 Figure 1, lanes 1, 12, and 23 are TAKARA-DL2000 DNA Marker, lanes 2-6 are 30bp GBA product transformation clone broth PCR, lanes 7-11 are 30bp-λRed assembly product transformation clone broth PCR, lanes 13-17 are 30bp-T4+λRed assembly product transformation clone broth PCR, lanes 18-22 are 30bp-T4 assembly product transformation clone broth PCR; among them, two of the GBA assembly transformation were empty, and the rest were correct clones.
[0038] Figure 12 The full length of the Sanger sequencing sequence of the positive clone of the 30bp Overhang assembly transformation was detected to detect the effect of T4 DNA Ligase.
[0039] Figure 6 The results show that compared with WT, T4 DNA Ligase has a promoting effect on DNA fragment assembly, and when T4 DNA Ligase and λRed system exist at the same time, this promoting effect is enhanced, which is significantly better than WT, P Value<0.0001, and the number of positive clones is close to the number of GBA, and the positive clone rate of each group is more than 99%.
[0040] Example 4 42bp homologous arm seamless DNA assembly and efficiency detection The insert fragment containing 42 bp homologous arms (nucleotide sequence see SEQ ID NO. 12) and linear vector (nucleotide sequence see SEQ ID NO. 12) were prepared. Referring to the steps of Example 2, the assembly was divided into 42bp-GBA-kit (Gibson assembly control group), 42bp-WT (WT control group), 42bp-λRed (λRed alone group), 42bp-λRed+T4 (T4+λRed combined group) and 42bp-T4 (T4 DNA Ligase alone group).
[0041] Each group was incubated at 37°C for 15 minutes, and the reaction solution was directly used for competent transformation and plate culture. After plate culture, the number of positive clones was counted, and clones were randomly picked for specific PCR confirmation, and the positive rate was calculated.
[0042] The results are shown in Figure 7 Compared with WT, T4 DNA Ligase and λRed system respectively promoted the assembly of DNA fragments, and when T4 DNA Ligase and λRed system existed at the same time, the promotion was enhanced, and was significantly better than WT, P Value<0.0001; the positive clone rate of each group was more than 99%.
[0043] Example 5 Multi-fragment DNA assembly and efficiency detection Six DNA fragments (nucleotide sequences see SEQ ID NO. 14-19) were prepared and divided into 6parts-GBA-kit (Gibson assembly control group), 6parts-WT (WT control group), 6parts-λRed (λRed alone group), 6parts-λRed+T4 (T4+λRed combined group) and 6parts-T4 (T4 DNA Ligase alone group).
[0044] Table 3 Six-fragment assembly reaction components
[0045] Each group was incubated at 37°C for 15 minutes, and the reaction solution was directly used for competent transformation and plate culture. After plate culture, the number of positive clones was counted, and clones were randomly picked for specific PCR confirmation, and the positive rate was calculated.
[0046] The results are shown in Figure 8As shown, multi-fragment GBA can be successfully assembled, and T4 has a significant difference with WT, but different from before is that when λRed system and T4 Ligase exist simultaneously, the assembly efficiency is not as good as that of T4 Ligase alone. In general, when T4 Ligase exists, it promotes the assembly of multi-DNA fragments, which is significantly better than WT, P Value < 0.0001; during multi-fragment assembly, the positive clone rate of the assembly in this embodiment is significantly better than that of GBA.
[0047] Example 6 Assembly effect of T3, T7 DNA Ligase under different Overhang lengths T3, T7 DNA Ligase (nucleotide sequences are shown as SEQ ID NO. 6~7, respectively) alone and in combination with λRed were respectively used for assembly experiments under 20bp and 42bp overhang conditions, and the experimental steps were the same as in Examples 2 and 4.
[0048] Each group was incubated at 37°C for 15 minutes, and the reaction solution was directly used for competent transformation and plate culture. After plate culture, the number of positive clones was counted, and clones were randomly picked for specific PCR confirmation, and the positive rate was calculated.
[0049] The results are shown in Table 3: Figure 9 As shown, compared with WT, T3 / T7 DNA Ligase and λRed system respectively promote the assembly of DNA fragments, and when T4 DNA Ligase and λRed system exist simultaneously, this promoting effect is enhanced, which is significantly better than WT, P Value ≤ 0.0001.
[0050] Example 7 Comprehensive comparison of seamless assembly system and Gibson reaction To comprehensively evaluate the differences between the assembly system in this embodiment and the Gibson assembly system, this embodiment compared and analyzed the two cloning methods from five key dimensions, including: per reaction cost, reaction time, reaction volume, reaction temperature, and positive clone rate of multi-fragment splicing.
[0051] The comparison results are shown in Table 4: Table 4 Comparison of seamless cloning assembly reaction and Gibson reaction
[0052] From the results of Table 1, the assembly system of the application is obviously superior to the Gibson assembly system in many aspects, the price per reaction is reduced from 32 dollars to only 0.08133 dollars, the cost is saved by nearly 400 times; the reaction time is compressed from the shortest 1 hour to 15 minutes, which is suitable for high-throughput and rapid construction; the normal temperature 37℃ condition is more suitable for the standard laboratory environment, and no additional temperature control equipment is needed; the positive clone rate reaches 0.93~1 in multi-fragment splicing, which is even better than Gibson; the assembly system of the application can be compatible with low reaction volume micro-reaction system, which is more beneficial to resource saving and high-throughput use.
[0053] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A cell-free cloning reaction system, characterized by, The cell lysate, the inserted DNA fragment and the linear vector; The cell lysate is obtained from induced expression and lysis of Escherichia coli, and the λRed system and the ligase system are expressed in the Escherichia coli; The λRed system comprises Exo protein, Beta protein and Gam protein; The nucleotide sequence encoding the Exo protein is shown as SEQ ID NO. 1, the nucleotide sequence encoding the Beta protein is shown as SEQ ID NO. 2, and the nucleotide sequence encoding the Gam protein is shown as SEQ ID NO. 3; The ligase system comprises DNA ligase; Expression of the λRed system is controlled by an RBS sequence, and the nucleotide sequence of the RBS sequence is shown as SEQ ID NO.
4.
2. The cell-free clonal reaction system of claim 1, wherein, The Escherichia coli is selected from any one of DH10B, DH5α, BW25113, BL21 (DE3), JM1165 or a genetically engineered strain thereof.
3. The cell-free clonal reaction system of claim 1, wherein, The DNA ligase is selected from any one of T4 DNA ligase, T3 DNA ligase and T7 DNA ligase.
4. The cell-free clonal reaction system of claim 1, wherein, The ligase system is expressed by a plasmid containing a p15A replication origin.
5. The cell-free clonal reaction system of claim 1, wherein, The inserted DNA fragment comprises a homologous arm fragment with a length of 15-45 bp.
6. The cell-free clonal reaction system of claim 1, wherein, The reaction condition of the cell-free cloning reaction system is incubation at 25-37°C for 10-60 min.
7. The cell-free clonal reaction system of claim 1, wherein, The preparation method of the cell lysate comprises the following steps: (1) placing the RBS sequence upstream of the start codon of the coding sequence of the Exo protein, the Beta protein and the Gam protein to obtain a λRed expression plasmid; (2) inoculating a host strain carrying the λRed expression plasmid and the ligase expression plasmid in LB liquid medium containing an antibiotic for pre-culture; (3) the bacteria liquid after the culture in (2) is diluted and inoculated in LB liquid culture medium to culture to OD 600 is 0.5~1, to obtain bacteria liquid 1; (4) adding IPTG to the bacterial liquid 1 for induction, and harvesting the bacterial body after continuous induction for 8-12 hours; (5) lysing the bacterial body obtained in (4) using Tris-HCl buffer containing triton X-100 to obtain the cell lysate.
8. The cell-free cloning reaction system of claim 7, wherein, In step (3), the concentration of IPTG is 0.5-1 mM.
9. A cell-free clonal reaction kit, characterized by, The cell lysate according to any one of claims 1-8.
10. Use of the cell-free cloning reaction system according to any one of claims 1-8 in molecular cloning, plasmid construction, library construction or gene path assembly.
Citation Information
Patent Citations
Enhanced homologous recombination mediated by lambda recombination proteins
US20030224521A1
Expression element combination, expression vector, host, use thereof, and assembly method
WO2023178544A1
Method for cell-free bacteriophage synthesis
WO2025078633A1