Cell lineage tracking system based on synNotch and CRISPR / Cas9 bar code technology and application thereof

Abstract

The invention discloses a cell lineage tracking system based on synNotch and CRISPR / Cas9 bar code technology and application thereof, the cell lineage tracking system comprises a system mGFP ligand vector for constructing Sender ligand cells and a system for constructing Receiver recipient cells, and the system comprises a synNotch receptor-rtTA fusion vector, a TetO-Cas9 expression vector, a gRNA expression vector and a Target vector library containing a Barcode sequence. A synNotch system and a CRISPR / Cas9 gene editing technology are combined with a bar code strategy, a unique bar code is generated, the contact sequence between cells is recorded, the method is compatible with a single-cell sequencing technology, transcription information of the cells is provided, long-term tracking of the contact history between the cells is achieved, the method can be used for tracking interaction and functions between the cells in a tumor microenvironment, and the application prospect is wide. Through long-term tracking and functional analysis of interaction between macrophages, especially macrophages and tumor cells, the accuracy of interaction analysis is remarkably improved, and a more accurate target spot is provided for targeted therapy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology, and particularly relates to a cell lineage tracking system based on synNotch and CRISPR / Cas9 barcode technology and application thereof. BACKGROUND

[0002] Currently, therapeutic targeting of immune cells has revealed the potential to harness the immune system to eliminate cancer cells. However, many cancers do not respond to immunotherapy, and many patients ultimately die from metastatic disease. Therefore, understanding the interaction of immune cells with tumor cells is crucial to improve the response rate to immunotherapy. Previous understanding of tumor-immune interactions has employed several approaches. Different forms of microscopy have revealed the location of immune cells within tumors relative to blood vessels or tumor cells, but cannot isolate or be used to analyze downstream interacting cells. Transcriptional-based approaches, whether applying a cell-cell proximity assumption or analyzing known receptor-ligand pairs to infer tumor-immune interactions, are not conducive to intuitive confirmation of interactors. Some synthetic tools have been recently developed to reveal cell-cell interactions. For example, tumor-secreted cell-penetrating fluorescent proteins label the surrounding metastatic niche around tumor cells. However, these methods identify the cellular composition of the niche around tumor cells, not the physical tumor cell interactions.

[0003] The existing technology has limitations in monitoring the continuous interaction between cells, and it is difficult to achieve long-term tracking of the interaction history between cells. SUMMARY

[0004] In view of the above shortcomings of the prior art, the present application aims to provide a new system and method, which produces unique barcodes by utilizing the synNotch system and CRISPR / Cas9 gene editing technology combined with barcode strategy, records the contact sequence between cells, and is compatible with single-cell sequencing technology, provides transcription information of cells, and realizes long-term tracking of the contact history between cells; the cell interaction tracking system based on synNotch and CRISPR / Cas9 barcode technology of the present application can be used for tracking the interaction and function between cells in the tumor microenvironment, especially the long-term tracking and functional analysis of the interaction between macrophages and tumor cells.

[0005] The first object of the present application is to provide a cell lineage tracking system based on synNotch and CRISPR / Cas9 barcode technology, comprising a system for constructing Sender ligand cells and a system for constructing Receiver receptor cells, wherein the system for constructing Sender ligand cells is an mGFP ligand vector which expresses an mGFP ligand and contains a G418 resistance gene NeoR; the system for constructing Receiver receptor cells comprises a synNotch receptor-rtTA fusion vector, a TetO-Cas9 expression vector, a gRNA expression vector and a Target vector library containing a Barcode sequence; the synNotch receptor-rtTA fusion vector expresses a synNotch receptor-rtTA fusion protein, the TetO-Cas9 expression vector is a Cas9 expression vector containing a TetO element, and the gRNA expression vector expresses a specific 5×gRNA sequence.

[0006] Preferably, the mGFP ligand vector is obtained by constructing an mGFP ligand vector by the following method: using pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector as a vector backbone, double enzyme digestion is performed with Xbal endonuclease and NotI endonuclease; the mGFP fragment is connected to the enzyme-digested pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector backbone, and the obtained pLV3-CMV-mGFP-Neo vector is the mGFP ligand vector; the nucleotide sequence of the mGFP fragment is shown in SEQ ID NO. 1.

[0007] Preferably, the synNotch receptor-rtTA fusion vector is obtained by constructing a synNotch receptor-rtTA fusion vector by the following method: using pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector as a vector backbone, double enzyme digestion is performed with Xbal endonuclease and NotI endonuclease; the rtTA fragment and the anti-GFP nanobady laG17-NOTCH CORE fragment are connected to the enzyme-digested pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector backbone, and the obtained PLV3-CMV-aGFP-Notch-rtTA-Neo vector is the synNotch receptor-rtTA fusion vector; the nucleotide sequence of the rtTA fragment is shown in SEQ ID NO. 2, and the nucleotide sequence of the anti-GFP nanobady laG17-NOTCH CORE fragment is shown in SEQ ID NO. 3.

[0008] In the process of constructing the PLV3-CMV-aGFP-Notch-rtTA-Neo vector, the primers for amplifying the rtTA fragment for ligation are rtTA-F1: GCGGCAACTTTGTATACAAAAGTTGATGTCTAGACTGGACAAGAG and rtTA-R1: CTTCAACATCACCACAAGTGAGGAGAGAACCTCTACCTTCTTACCCGGGGAGCATGTCAAGG; and the primers for amplifying the anti-GFP nanobady laG17-NOTCH CORE fragment for ligation are notch-F1: GACCTCCATAGAAGATTCTAGAgccaccATGGCATTGCCCGTGACCGCCCT and notch-R1: CAACTTTTGTATACAAAGTTGCCGCCGGCGCTTGCGGGACAG.

[0009] Preferably, the synNotch receptor-rtTA fusion vector is obtained by the following method: using the pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector as a vector backbone, performing double enzyme digestion with Xbal endonuclease and Notl endonuclease; connecting the rtTA fragment, the anti-GFP nanobady laG17-NOTCH CORE fragment, and the mCherry fragment with the enzyme-digested pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector backbone to construct a pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector, which is the synNotch receptor-rtTA fusion vector; the nucleotide sequence of the rtTA fragment is shown in SEQ ID NO. 2, the nucleotide sequence of the anti-GFP nanobady laG17-NOTCH CORE fragment is shown in SEQ ID NO. 3, and the nucleotide sequence of the mCherry fragment is shown in SEQ ID NO. 4.

[0010] In the process of constructing the pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector, the primers for amplifying the rtTA fragment for ligation are rtTA-F1: GCGGCAACTTTGTATACAAAAGTTGATGTCTAGACTGGACAAGAG and rtTA-Linker-R1: ACTTCCACCACCGCCTGAACCTCCACCGCCAGAACCACCTCCGCCCCCGGGGAGCATGT; the primers for amplifying the anti-GFP nanobady laG17-NOTCH CORE fragment for ligation are notch-F1: GACCTCCATAGAAGATTCTAGAgccaccATGGCATTGCCCGTGACCGCCCT and notch-R1: CAACTTTTGTATACAAAGTTGCCGCCGGCGCTTGCGGGACAG; and the primers for amplifying the mCherry fragment for ligation are mCherry-F1: GGCGGAGGTGGTTCTGGCGGTGGAGGTTCAGGCGGTGGTGGAAGTATGGTGAGCAAGGGCGAGGAGGAT and mCherry-R1: CGGAGCGATCGCAGATCCTTCGCGGCCGCCTTGTACAGCTCGTCCATGCCGCCGGTGGAGTG.

[0011] Preferably, the TetO-Cas9 expression vector is obtained by the following method: double enzyme digestion of the pCW-Cas9 ② vector with SmaI and FseI endonucleases, ligation of a BFP fragment to the digested pCW-Cas9 ② vector backbone to obtain the pCW-Cas9-BFP vector, which is the TetO-Cas9 expression vector; the nucleotide sequence of the BFP fragment is shown in SEQ ID NO. 6.

[0012] In the process of constructing the pCW-Cas9-BFP vector, the primers for amplifying the BFP fragment for ligation are BFP-F1: GCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGCGAGCTGATTAAGGAGAAC and BFP-R1: TTGGATCGATCCTTACTTAGTTAATTAAGCTTGTGCCCCAGTTTGCT.

[0013] Preferably, the gRNA expression vector is obtained by the following method: the pUltra-U6-gRNAs1-5 vector is cut by Age I endonuclease and Xba I endonuclease, the BSD fragment is connected with the cut pUltra-U6-gRNAs1-5 vector backbone to obtain the pUltra-U6-gRNAs1-5-BSD vector, which is the gRNA expression vector; the nucleotide sequence of the BSD fragment is shown as SEQ ID NO. 5.

[0014] In the process of constructing the pUltra-U6-gRNAs1-5-BSD vector, the primers for amplifying the BSD fragment for ligation are BSD-F1: ACGAAGCTTGGGCTGCAGGTCCGATCCATGGCCAAGCCTTTGTCTCAAG and BSD-R1: ACTTCCCCTGCCCTCGCCGGAGGATCCTGCCCTCCCACACATAACCAG.

[0015] Preferably, the Target vector library containing Barcode sequence is obtained by the following method: the pB-CMV-MCS-EF1α-Puro vector is double-cut by Xba I endonuclease and Hpa I endonuclease, the Target sequence fragment, the EF1α promoter-PuroR-WPRE fragment and the cut pB-CMV-MCS-EF1α-Puro vector backbone are connected to construct the vector pB-CMV-MCS-EF1α-Target-Puro; the static barcode sequence containing 10 random bases is artificially synthesized and connected with the pB-CMV-MCS-EF1α-Target-Puro vector backbone cut by EcoRI endonuclease to obtain the pB-CMV-MCS-EF1α-BC-Puro vector, which is the Target vector library containing Barcode sequence; the nucleotide sequence of the Target sequence fragment is shown as SEQ ID NO. 8, and the nucleotide sequence of the EF1α promoter-PuroR-WPRE fragment is shown as SEQ ID NO. 7.

[0016] EF1a-WPRE-F1: CCACGCTGTTTTGACCTCCATAGAAGATTGGCTCCGGTGCCCGTCAGTGGGCAGAG and EF1a-WPRE-R1: GCCTTGTAAGTCATTGGTCTTAAAGTCGACGCGGGAGGCGGCCCAAAGGGAGATCC; the primers for amplifying the fragment of Target sequence for ligation are Target-F1: CGACTTTAAGACCAATGACTTAC and Target-R1: GCTGCAATAAACAAGTTTAGTT. The primers for amplifying the fragment of static barcode containing 10 random bases for ligation are TargetBC-F1: TTTGTCCAATTATGCTCGAGGTCGAGAATTNNNNNNNNNNCGTTGATCGCACGCCA and Target BC-R1: TAGTTGGTTCCTACTGGCGTGCGATCAACG.

[0017] A second object of the present application is to provide the use of the system in cell lineage tracing.

[0018] The present application has the following advantages compared with the prior art: Direct capture of physical interaction: Compared with existing microscopy techniques (which can only locate the relative position of immune cells and tumor cells), the present application can isolate and analyze tumor-immune cell pairs that actually make physical contact, thus revealing the real interaction mechanism, rather than indirect inference.

[0019] Beyond the limitations of transcriptome inference: Compared with transcriptome-based methods (which rely on cell-cell proximity assumptions or known receptor-ligand pairs to infer interactions), the present application directly confirms interacting cells through experimental means, avoiding false positives or omissions caused by indirect association, significantly improving the accuracy of interaction analysis.

[0020] Breakthrough of niche analysis limitations: Unlike existing synthetic tools (such as cell-penetrating fluorescent protein labeling techniques) that can only identify the cell composition of the niche around the tumor, the present application directly identifies physically contacted cells, clearly distinguishing between bystander cells and truly interacting cells, providing more accurate targets for targeted therapy.

[0021] Promote immunotherapy optimization: By precisely analyzing the direct interaction of tumor-immune cells, the present application helps to reveal the mechanism of immunotherapy resistance, provides a molecular basis for designing combination therapies to improve patient response rates, and ultimately improves the survival prognosis of patients with metastatic cancer.

[0022] The above technical effects are directly brought by the core features of the present application (such as directly capturing physical interaction cells, experimentally verifying interaction relationship, etc.), and are inevitable advantages that the prior art cannot achieve. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is a pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector map.

[0024] Figure 2 is a pLV3-CMV-mGFP-Neo vector map.

[0025] Figure 3 is a PLV3-CMV-aGFP-Notch-rtTA-Neo vector.

[0026] Figure 4 is a pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector map.

[0027] Figure 5 is a pUltra-U6-gRNAs1-5 vector map.

[0028] Figure 6 is a pLV-sgRNA vector map.

[0029] Figure 7 is a pUltra-U6-gRNAs1-5-BSD vector map.

[0030] Figure 8 is a pCW-Cas9 vector map.

[0031] Figure 9 is a LV-EF1α-41BB-BFP-BSD vector map.

[0032] Figure 10 is a pCW-Cas9-BFP vector map.

[0033] Figure 11 is a LentiGuide-Puro vector map.

[0034] Figure 12 is a pB-CMV-MCS-EF1α-Puro vector map.

[0035] Figure 13 is a pB-CMV-MCS-EF1α-Target-Puro vector map.

[0036] Figure 14 is a pB-CMV-MCS-EF1α-BC-Puro vector map.

[0037] Figure 15 Figure 1 is the confocal microscopic imaging of Sender cells and Receiver cells co-cultured for 0 days (A) and 2 days (B).

[0038] Figure 16 Figure 2 is the activation of BFP expression in Sender and Receiver cells co-cultured.

[0039] Figure 17 Figure 3 is a cell lineage tree.

[0040] Figure 18 Figure 4 is a schematic diagram of the synNotch and CRISPR Cas9 system; wherein A is the interaction of two cells, B is the interaction of two cells, C is a schematic diagram of the Target barcode produced after cell contact, and D is a schematic diagram of single cell sequencing. DETAILED DESCRIPTION

[0041] The following examples are further illustrations of the present application and are not intended to limit the present application.

[0042] The general technical route of the present application is as follows: In a first aspect, a synNotch-regulated CRISPR / Cas9-barcode editing technology platform is constructed to realize the interaction between signal sending cells (Sender) and signal receiving cells (Receiver) to trigger the expression of Cas9, and then to generate a unique DNA barcode on the target DNA sequence.

[0043] To realize this system, the Sender cells need to express the mGFP ligand, and the Receiver cells need to express the synNotch receptor fused with rtTA (retrotranscriptional activator). When the two are combined, the cleavage of γ-secretase is triggered, releasing the intracellular part of rtTA; in the presence of tetracycline antibiotics (such as doxycycline (DOX)), this released rtTA will activate the expression of Cas9 controlled by TetO (tetracycline operator), and then realize the editing of the target DNA and generate a unique DNA barcode (Figure 2). Figure 18

[0044] The specific scheme is as follows: Construction of mGFP ligand vector (synNotch ligand vector): through molecular cloning technology, a vector expressing mGFP ligand and containing G418 resistance gene NeoR is constructed, and its functionality is verified by sequencing technology.

[0045] ​Construction of synNotch receptor-rtTA fusion vector: a vector expressing synNotch receptor and rtTA fusion protein was developed, and its expression was confirmed by sequencing and Western blotting.

[0046] Construction of TetO-Cas9 expression vector pCW-Cas9-BFP: a Cas9 expression vector containing TetO elements was constructed, which can efficiently drive the expression of Cas9 in the presence of DOX.

[0047] Construction of gRNA expression vector: specific 5×gRNA sequences were designed and synthesized, and gRNA expression vectors were constructed to ensure accurate guidance of gRNA.

[0048] Design a Target vector library containing Barcode sequences, which are inserted into the 3'-UTR region of the reporter gene (such as GFP), which facilitates detection by single-cell RNA sequencing, and construct a DNA barcode vector library.

[0049] In the second aspect, the above-mentioned vectors are used to package lentivirus, and Sender ligand cells and Receiver receptor cells are constructed respectively.

[0050] The mGFP ligand vector is used to construct the Sender ligand cell.

[0051] The synNotch receptor-rtTA fusion vector, TetO-Cas9 expression vector, gRNA expression vector, and Target vector library containing Barcode sequences are used in turn to construct the Receiver receptor cell.

[0052] The endonucleases Xbal, NotI, AgeI, XbaI, and EcoRI used below are purchased from New England BioLabs (NEB) company. The relevant original vectors used, pUltra-U6-gRNAs1-5 and LentiGuide-Puro vector, are purchased from Addgene plasmid platform: https: / / www.addgene.org / , pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector, pCW-Cas9② vector, pB-CMV-MCS-EF1α-Puro, and pLV-sgRNA vector are purchased from Miaoling plasmid platform: https: / / www.miaolingbio.com / .

[0053] Example 1: Construction of the vectors used 1. Construction of mGFP ligand vector The pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector (Figure 1 ) as the vector backbone, double enzyme digestion was performed with Xbal endonuclease and Notl endonuclease to form sticky ends, and the EGFP fragment in the vector was cut off, and the enzyme digestion system was as follows: 1 μg of vector, 2 μL of Xbal endonuclease, 2 μL of Notl endonuclease, and water was added to 50 μL; the pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector backbone after enzyme digestion was recovered.

[0054] The mGFP fragment (the nucleotide sequence of which is shown as SEQ ID NO. 1, 717 bp) was artificially synthesized (Beijing Chengke Biological Technology Co., Ltd.). The primers for amplifying the mGFP fragment for ligation were mGFP-F (gacctccatagaagattctagagccaccATGGAGACCGACACCCTCTTGCTCTG) and mGFP-R (atcgcagatccttcgcggccgcTTATCGGGGTTTTTTTTGCCAC).

[0055] The amplified mGFP fragment was ligated with the enzyme-digested pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector backbone, and the Novozyme fragment recombination system Clone Express® MultiS One Step Cloning Kit C113 kit was used, and the reaction system was as follows: 100 ng of vector backbone; 30 ng of mGFP fragment; 4 μL of 5x CE MultiS Buffer; 2 μL of Exnase MultiS; ddH2O was added to 20 μL; the recombination reaction conditions were 37 °C for 30 min and 4 °C for 5 min. Thus, the mGFP ligand vector pLV3-CMV-mGFP-Neo vector was constructed (pLV3-CMV-mGFP-Neo) Figure 2 ).

[0056] 2. Construction of synNotch receptor-rtTA fusion vector 2.1 Construction of PLV3-CMV-aGFP-Notch-rtTA-Neo vector The pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector (pLV3-CMV-3xFLAG-MCS-EGFP-Neo) Figure 1 ) as the vector backbone, double enzyme digestion was performed with Xbal endonuclease and Notl endonuclease to form sticky ends, and the EGFP fragment in the vector was cut off, and the enzyme digestion system was as follows: 1 μg of vector, 2 μL of Xbal endonuclease, 2 μL of Notl endonuclease, and water was added to 50 μL; the pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector backbone after enzyme digestion was recovered.

[0057] The rtTA fragment (the nucleotide sequence of which is shown as SEQ ID NO. 2) was amplified with the primers rtTA-F1 (GCGGCAACTTTGTATACAAAAGTTGatgtctagactggacaagag) / rtTA-R1 (cttcaacatcaccacaagtgaggagagaacctctaccttcttacccggggagcatgtcaagg).

[0058] The anti-GFP nanobady laG17-NOTCH CORE fragment (the nucleotide sequence of which is shown as SEQ ID NO. 3) was artificially synthesized (Beijing Chengke Biological Technology Co., Ltd.).

[0059] The amplified rtTA fragment, the anti-GFP nanobady laG17-NOTCH CORE fragment (the primers for amplifying the anti-GFP nanobady laG17-NOTCH CORE fragment for ligation are notch-F1 (GACCTCCATAGAAGATTCTAGAgccaccATGGCATTGCCCGTGACCGCCCT) and notch-R1 (CAACTTTTGTATACAAAGTTGCCGCCGGCGCTTGCGGGACAG)), and the enzyme-digested pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector backbone were ligated using the Novozyme fragment recombination system Clone Express® MultiS One Step Cloning Kit C113 kit, and the reaction system was as follows: vector backbone: 100 ng; target fragment: 30 ng each; 5x CE MultiS Buffer: 4 μL; Exnase MultiS: 2 μL; ddH2O: supplemented to 20 μL; recombination reaction conditions: 37 °C for 30 min, 4 °C for 5 min; thereby the PLV3-CMV-aGFP-Notch-rtTA-Neo vector was constructed. Figure 3 )。

[0060] 2.2 Construction of pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector Amplification of mCherry fragment (nucleotide sequence as shown in SEQ ID NO. 4): primers are mCherry-F1 (GGCGGAGGTGGTTCTGGCGGTGGAGGTTCAGGCGGTGGTGGAAGTatggtgagcaagggcgaggaggat) and mCherry-R1 (CGGAGCGATCGCAGATCCTTCGCGGCCGCcttgtacagctcgtccatgccgccggtggagtg).

[0061] Using the pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector skeleton obtained after enzyme digestion in 2.1, and the anti-GFP nanobady laG17-NOTCH CORE fragment amplified by primers notch-F1 and notch-R1, the rtTA fragment amplified by primer pair rtTA-F1 (GCGGCAACTTTGTATACAAAAGTTGatgtctagactggacaagag) / rtTA-Linker-R1 (ACTTCCACCACCGCCTGAACCTCCACCGCCAGAACCACCTCCGCCcccggggagcatgt); the amplified rtTA fragment, anti-GFP nanobady laG17-NOTCH CORE fragment and mCherry fragment are ligated with the pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector skeleton after enzyme digestion, using the Novagen fragment recombination system Clone Express®MultiS One Step Cloning Kit C113 kit, the reaction system is as follows: vector skeleton: 100 ng; target fragment: 30 ng each; 5x CE MultiS Buffer: 4 μL; Exnase MultiS: 2 μL; ddH2O: supplemented to 20 μL; recombination reaction conditions: 37 °C for 30 min, 4 °C for 5 min; thus the pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector is constructed. Figure 4 ).

[0062] 3. Construction of gRNA expression vector The pUltra-U6-gRNAs1-5 vector is digested by AgeI endonuclease and XbaI endonuclease (New England Biolabs, USA) to prepare the pUltra-U6-gRNAs1-5 vector skeleton. Figure 5 ).

[0063] The pLV-sgRNA vector (Figure 6 The BSD fragment (nucleotide sequence as shown in SEQ ID NO.5) was amplified in the primers: BSD-F1: ACGAAGCTTGGGCTGCAGGTCCGATCCATGGCCAAGCCTTTGTCTCAAG, BSD-R1: ACTTCCCCTGCCCTCGCCGGAGGATCCTGCCCTCCCACACATAACCAG.

[0064] The amplified BSD fragment was ligated to the digested pUltra-U6-gRNAs1-5 vector backbone using the same ligation reaction system as before, to obtain the pUltra-U6-gRNAs1-5-BSD vector. Figure 7 This is a gRNA expression vector that expresses a 5×gRNA sequence.

[0065] 4. Constructing the pCW-Cas9-BFP vector pCW-Cas9② vector was double-digested with SmaI and FseI restriction enzymes. Figure 8 ), and obtained the pCW-Cas9② vector skeleton.

[0066] In the LV-EF1α-41BB-BFP-BSD vector ( Figure 9 The BFP fragment (nucleotide sequence shown in SEQ ID NO.6) was amplified in the primer sequence: BFP-F1: gccggcggccacgaaaaaggccggccaggcaaaaaagaaaagagcgagctgattaaggagaac, BFP-R1: ttggatcgatccttacttagttaattaagcttgtgccccagtttgct.

[0067] The amplified BFP fragment was ligated into the digested pCW-Cas9② vector backbone, and the ligation reaction system was the same as before, to obtain the pCW-Cas9-BFP vector. Figure 10 ).

[0068] 5. Construct the Target vector pB-CMV-MCS-EF1α-BC-Puro vector In LentiGuide-Puro vector ( Figure 11) to amplify the EFla promoter-PuroR-WPRE fragment (nucleotide sequence as shown in SEQ ID NO. 7), wherein the amplification primers are EF1a-WPRE-F1: CCACGCTGTTTTGACCTCCATAGAAGATTggctccggtgcccgtcagtgggcagag, and EF1a-WPRE-R1: GCCTTGTAAGTCATTGGTCTTAAAGTCGACgcgggaggcggcccaaagggagatcc.

[0069] The pB-CMV-MCS-EFla-Puro vector was double-digested with Xbal endonuclease and Hpal endonuclease (New England Biolabs, USA) to obtain the pB-CMV-MCS-EFla-Puro vector skeleton. Figure 12

[0070] Synthesis of Target sequence: The Target sequence fragment without static barcode was artificially synthesized (Shanghai Generay Biotech Co., Ltd.), and the nucleotide sequence thereof is shown in SEQ ID NO. 8 (containing Target 1-5). The primers for amplifying the Target sequence fragment for ligation are Target-F1: CGACTTTAAGACCAATGACTTAC and Target-R1: GCTGCAATAAACAAGTTTAGTT.

[0071] Multi-fragment ligation: The Target sequence fragment, the EFla promoter-PuroR-WPRE fragment, and the digested pB-CMV-MCS-EFla-Puro vector skeleton were ligated to construct the vector pB-CMV-MCS-EFla-Target-Puro, which can be used for subsequent ligation of static barcode fragments, as shown in SEQ ID NO. 9. Figure 13

[0072] ​​Static barcode vector pB-CMV-MCS-EF1a-BC-Puro construction: Artificial synthesis (Shanghai Shenguo Bioengineering Co., Ltd.) with 10 random base static barcode sequence; The above static barcode fragment (amplification of primer containing 10 random base static barcode for connection: Target BC-F1: TTTGTCCAATTATGCTCGAGGTCGAGAATTNNNNNNNNNNCGTTGATCGCACGCCA and Target BC-R1: TAGTTGGTTCCTACTGGCGTGCGATCAACG) and the pB-CMV-MCS-EF1a-Target-Puro vector skeleton obtained after EcoRI enzyme digestion were connected, that is, the pB-CMV-MCS-EF1a-BC-Puro vector was obtained. Figure 14 ).

[0073] Example 2: Sender ligand cell and Receiver receptor cell construction 1. Construction of Sender cell The mGFP ligand vector pLV3-CMV-mGFP-Neo plasmid was introduced into HEK293T cells together with the lentivirus packaging plasmid psPAX2 and the envelope plasmid pMD2.G. Then, the supernatant containing lentivirus particles was collected and concentrated from the culture solution, and these concentrated lentivirus particles were subsequently used to infect the HEK293T target cell line. After the end of the infection process, G418 antibiotic was added to the cell culture medium to screen for cell populations that successfully integrated the exogenous gene and could stably express.

[0074] 2. Construction of Receiver cell (1) The synNotch receptor-rtTA fusion vector pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo, PLV3-CMV-aGFP-Notch-rtTA-Neo plasmid was introduced into HEK293T cells in turn together with the lentivirus packaging plasmid psPAX2 and the envelope plasmid pMD2.G. Then, the supernatant containing lentivirus particles was collected and concentrated from the culture solution, and subsequently used to infect the HEK293T target cell line. After the end of the infection process, G418 antibiotic was added to the cell culture medium to screen for cell populations that successfully integrated the exogenous gene and could stably express.

[0075] (2) The TetO-Cas9 expression vector pCW-Cas9-BFP carrier plasmid is introduced into HEK293T cells together with the lentivirus packaging plasmid psPAX2 and the envelope plasmid pMD2.G. Then, the supernatant containing lentivirus particles is collected and concentrated from the culture solution, which is then used to infect the target cell line constructed in (1) above.

[0076] (3) The gRNA expression vector plasmid pUltra-U6-gRNAs1-5-BSD is introduced into HEK293T cells together with the lentivirus packaging plasmid psPAX2 and the envelope plasmid pMD2.G. Then, the supernatant containing lentivirus particles is collected and concentrated from the culture solution, which is then used to infect the target cell line constructed in (2) above.

[0077] (4) When the pB-CMV-MCS-EF1a-BC-Puro plasmid library is transfected using Lipo8000™, the plasmid is mixed at a ratio of 4:1 (transposon: transposase), and then the cell line constructed in (3) above is transfected at a ratio of 2 μL Lipo8000 / 24 well at a confluence of 60%-70%. The medium is changed after 4-6 hours, and expression or stable strains are detected after 48 hours.

[0078] Example 3: Co-culture of Sender and Receiver cells to trigger nuclear signal The constructed Sender and Receiver cells are diluted to 250000 cells / mL, respectively, and mixed at a volume ratio of 1:1.

[0079] 300 μL of the above mixture is taken to a confocal culture dish (glass bottom diameter 20 mm, glass bottom thickness 1 mm), and co-cultured in a culture box for 2 days. The culture dish in the culture box is taken out, the medium in the dish is carefully aspirated, and washed with 1xPBS for 3 times. The cells are fixed with 100 μL of 4% paraformaldehyde for 20 min, the paraformaldehyde in the dish is carefully aspirated, and washed with 1xPBS for 3 times. The cells are stained with 50 μL of 5 μg / mL DAPI solution for 20 min, the DAPI in the dish is carefully aspirated, and washed with 1xPBS for 3 times. 100 μL of 1xPBS is added to the culture dish. It is placed in a confocal instrument to take pictures. The results are shown in Figure 15 As shown, after the Sender and Receiver cells are co-cultured for 2 days, the rtTA-mCherry fusion protein is removed from the cell membrane localization and enters the nucleus, indicating that the rtTA nuclear signal is successfully triggered.

[0080] Example 4: Co-culture of Sender and Receiver cells to activate Cas9 expression Receiver cells (transfected with pLV3-CMV-aGFP-Notch-rtTA-Neo and pCW-Cas9-BFP plasmids) were co-cultured with Sender cells for 72 h, and 2 μg / mL DOX was added to the culture medium to avoid light culture. Flow cytometry analysis was performed. The results are shown in FIG. 16. As the culture time increased, the BFP signal gradually increased, indicating that the expression of downstream Cas9 was successfully activated. Figure 16

[0081] Example 5: Co-culture of Sender cells and Receiver cells can cause the generation of downstream Barcode The DNA barcodes generated by the synNotch and CRISPR / Cas9-gRNA barcode system were detected by next-generation sequencing technology. First, the co-cultured cells were subjected to flow cytometry sorting, the Sender cells were removed, and only the Receiver cells were retained. Subsequently, total RNA was extracted from these cells, a cDNA library was constructed, and next-generation sequencing was performed. The barcode had high insertion efficiency and specificity at 5 different target sequence (Target 1, Target 2, Target 3, Target 4, Target 5) with different insertions and deletions. According to the homology relationship of the Barcode of each target sequence, the proliferation evolution lineage of the cell line can be finally obtained (FIG. 20). Figure 17 ​​

Claims

1. A cell lineage tracing system based on synNotch and CRISPR / Cas9 barcoding technology, characterized in that, The system for constructing the sender ligand cell is an mGFP ligand vector which expresses an mGFP ligand and contains a G418 resistance gene NeoR; the system for constructing the receiver receptor cell comprises a synNotch receptor-rtTA fusion vector, a TetO-Cas9 expression vector, a gRNA expression vector and a Target vector library containing a Barcode sequence; the synNotch receptor-rtTA fusion vector expresses a synNotch receptor and rtTA fusion protein, the TetO-Cas9 expression vector is a Cas9 expression vector containing a TetO element, and the gRNA expression vector expresses specific 5×gRNA sequences.

2. The system of claim 1, wherein, The mGFP ligand vector is obtained by constructing the following method: using pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector as a vector skeleton, double enzyme digestion is performed with Xbal endonuclease and NotI endonuclease; the mGFP fragment is connected with the pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector skeleton after enzyme digestion, and the obtained pLV3-CMV-mGFP-Neo vector is the mGFP ligand vector; the nucleotide sequence of the mGFP fragment is shown as SEQ ID NO.

1.

3. The system of claim 1, wherein, The synNotch receptor-rtTA fusion vector is obtained by constructing the following method: using pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector as a vector skeleton, double enzyme digestion is performed with Xbal endonuclease and NotI endonuclease; the rtTA fragment and anti-GFP nanobady laG17-NOTCH CORE fragment are connected with the pLV3-CMV-3×FLAG-MCS-EGFP-Neo vector skeleton after enzyme digestion, and the obtained PLV3-CMV-aGFP-Notch-rtTA-Neo vector is the synNotch receptor-rtTA fusion vector; the nucleotide sequence of the rtTA fragment is shown as SEQ ID NO. 2, and the nucleotide sequence of the anti-GFP nanobady laG17-NOTCH CORE fragment is shown as SEQ ID NO.

3.

4. The system of claim 1, wherein, The synNotch receptor-rtTA fusion vector is obtained by the following method: using pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector as a vector skeleton, double enzyme digestion is carried out with Xbal endonuclease and NotI endonuclease; the rtTA fragment, anti-GFP nanobady laG17-NOTCH CORE fragment, mCherry fragment are connected with the enzyme-digested pLV3-CMV-3xFLAG-MCS-EGFP-Neo vector skeleton to construct pLV3-CMV-aGFP-Notch-rtTA-linker-mCherry-Neo vector, which is the synNotch receptor-rtTA fusion vector; the nucleotide sequence of the rtTA fragment is shown as SEQ ID NO. 2, the nucleotide sequence of the anti-GFP nanobady laG17-NOTCH CORE fragment is shown as SEQ ID NO. 3, and the nucleotide sequence of the mCherry fragment is shown as SEQ ID NO.

4.

5. The system of claim 1, wherein, The TetO-Cas9 expression vector is obtained by the following method: double enzyme digestion is carried out on pCW-Cas9 ② vector with SmaI endonuclease and FseI endonuclease, the BFP fragment is connected to the enzyme-digested pCW-Cas9 ② vector skeleton to obtain pCW-Cas9-BFP vector, which is the TetO-Cas9 expression vector; the nucleotide sequence of the BFP fragment is shown as SEQ ID NO.

6.

6. The system of claim 1, wherein, The gRNA expression vector is obtained by the following method: pUltra-U6-gRNAs1-5 vector is digested with AgeI endonuclease and XbaI endonuclease, the BSD fragment is connected to the enzyme-digested pUltra-U6-gRNAs1-5 vector skeleton to obtain pUltra-U6-gRNAs1-5-BSD vector, which is the gRNA expression vector; the nucleotide sequence of the BSD fragment is shown as SEQ ID NO.

5.

7. The system of claim 1, wherein, The Target vector library containing the Barcode sequence is obtained by the following method: the pB-CMV-MCS-EF1 alpha-Puro vector is double digested by XbaI endonuclease and HpaI endonuclease, the Target sequence fragment, the EF1 alpha promoter-PuroR-WPRE fragment and the digested pB-CMV-MCS-EF1 alpha-Puro vector backbone are connected to construct the vector pB-CMV-MCS-EF1 alpha-Target-Puro; the static barcode sequence containing 10 random bases is artificially synthesized and connected with the pB-CMV-MCS-EF1 alpha-Target-Puro vector backbone digested by EcoRI to obtain the pB-CMV-MCS-EF1 alpha-BC-Puro vector, which is the Target vector library containing the Barcode sequence; the nucleotide sequence of the Target sequence fragment is shown as SEQ ID NO. 8, and the nucleotide sequence of the EF1 alpha promoter-PuroR-WPRE fragment is shown as SEQ ID NO.

7.

8. Use of the system of any one of claims 1-7 in cell lineage tracking.

Images