Application of CNVR detection reagent in predicting fat and lean tails of sheep and method for predicting fat and lean tails of sheep by using CNV marker

By detecting CNVR and combining it with qPCR, the problem of predicting fat and thin tails in sheep in existing technologies has been solved, achieving efficient prediction and early selection, and improving the accuracy of breeding and breeding efficiency.

CN120905403APending Publication Date: 2025-11-07INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511244849.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-11-07

Smart Images

  • Figure CN120905403A_ABST
    Figure CN120905403A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of variety identification, and relates to application of a CNVR detection reagent in prediction of fat and lean tails of sheep, the reagent, a kit and a method for predicting fat and lean tails of sheep through CNV. The invention provides an application of a reagent for detecting CNVR in predicting fat and lean tails of sheep, and the CNVR takes a sheep genome AR-UIRamv2.0 as a reference and is located at Chr15: 3770601-3813600. By detecting the CNVR, efficient prediction of fat tails or thin tails of the sheep can be achieved, the method is used for early selection of different tail types of sheep, the seed selection accuracy is improved, the breeding period is shortened, the breeding process is accelerated, and a scientific basis is provided for molecular marker-assisted selection of the sheep.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of variety identification, and particularly relates to application of a reagent for detecting a copy number variation region (CNVR) in predicting fat and lean tails of sheep and a method for predicting fat and lean tails of sheep through copy number variation (CNV). BACKGROUND

[0002] Different sheep breeds have different tail phenotypes after adaptive evolution after initial domestication. The phenotypic diversity of sheep tail type provides an ideal material for comparative analysis of its genetic basis. Evolutionary biologists, animal geneticists, breeders and producers have always wanted to clearly understand the potential genetic mechanisms behind the differences in sheep tail phenotypes. Understanding the causal genes and mutations behind these differences will help to explore the mystery of evolution, improve animal production performance, promote animal welfare, and provide help to understand human diseases related to fat deposition (i.e. obesity).

[0003] The earliest record of fat-tailed sheep dates back about 5000 years, and it is believed that fat-tailed sheep evolved from lean-tailed sheep. The formation of fat tail is an adaptive response mechanism to drought and climate change. However, excessive deposition of fat in the tail affects the reproductive and movement ability of sheep, the distribution of fat in the animal body, and brings problems such as increased feeding costs and reduced consumer preference. Genomic studies provide an unprecedented opportunity to understand the mechanism of fat formation in the tail of sheep to determine the potential causal variation between phenotypic differences. In the past decade, researchers have also conducted genomic and transcriptomic studies on the mechanism of fat deposition in the tail of sheep. A variety of genes are considered to have several potential important candidate genes, including the BMP2 and PDGFD genes associated with the fat-tailed phenotype, and the TBXT gene associated with the number of tail vertebrae and tail length. Among them, PDGFD has been studied in depth, a SNP mutation site and an ASE (Allele-specific expression, allele-specific expression) are found in the first exon, 1 ASE is found in the third exon, a 6.8 kb region is found to be positively selected in the first intron, and 5 ASEs are found in the 3'UTR. Although potential genes associated with sheep tail characteristics have been revealed, there is still a lack of an efficient method for predicting fat and lean tails of sheep through CNV. SUMMARY

[0004] The purpose of the present application is to provide a reagent for detecting CNVR in predicting fat and lean tails of sheep and a method for predicting fat and lean tails of sheep through CNV. By detecting the CNVR described in the present application, efficient prediction of fat or lean tails of sheep can be achieved.

[0005] The application provides application of a reagent for detecting CNVR in prediction of fat and lean tail of sheep, the CNVR is located at Chr15:3770601-3813600 with reference to a sheep genome ARS-UI_Ramb_v2.0.

[0006] Preferably, the reagent for detecting CNVR comprises primers for predicting fat and lean tail of sheep by CNV, and the nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO. 2.

[0007] Preferably, the reagent further comprises internal reference primers, and the nucleotide sequences of the internal reference primers are shown as SEQ ID NO. 3 and SEQ ID NO. 4.

[0008] The application further provides a method for predicting fat and lean tail of sheep by CNV, comprising the following steps:

[0009] The genome of the sheep is detected by the reagent for detecting CNVR, if the copy number is repeated, it is judged as fat-tailed sheep, and if the copy number is normal, it is judged as lean-tailed sheep; the CNVR is located at Chr15:3770601-3813600 with reference to a sheep genome ARS-UI_Ramb_v2.0.

[0010] Preferably, after the detection, the sheep reference genome for comparison is ARS-UI_Ramb_v2.0.

[0011] Preferably, the detection method comprises a qPCR method.

[0012] Preferably, the reaction condition of the qPCR is 95℃ 5min, 95℃ 10s, 60℃ 10s, 70℃ 15s, and the cycle is 40 times.

[0013] The application provides application of a reagent for detecting CNVR in prediction of fat and lean tail of sheep. Through detection of the CNVR, efficient prediction of fat tail or lean tail of sheep can be realized, early selection of sheep with different tail types is used, selection accuracy is improved, a breeding cycle is shortened, a breeding process is accelerated, and a scientific basis is provided for molecular marker assisted selection of sheep. Test results show that 48 sheep are resequenced, based on a sheep reference genome (ARS-UI_Ramb_v2.0), Vst analysis is performed on sheep with different tail types, it is found that a copy number variation region CNVR (Chr15:3770601-3813600) is subjected to strong selection; copy number duplication occurs in fat-tailed sheep, and normal copy number belongs to lean-tailed sheep. GWAS analysis of different tail types is performed on 178 sheep through large group verification, and the region is also found to be related to tail type. QPCR verification is performed on Hu sheep (fat-tailed sheep) and East Friezian sheep (lean-tailed sheep), and the copy number is calculated by using formula 2x2 -ΔΔCt The results are the same as the sequencing results, and copy number duplication occurs in fat-tailed sheep. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0015] Figure 1 A Vst value Manhattan graph of CNVRs provided by the present application is provided.

[0016] Figure 2 A Manhattan graph of GWAS analysis of different tail types provided by the present application is provided.

[0017] Figure 3 A copy number result graph of CNVR on chromosome 15 in sheep with different tail types provided by the present application is provided.

[0018] Figure 4 A qPCR verification result graph of CNVR provided by the present application is provided. DETAILED DESCRIPTION

[0019] The application provides application of a reagent for detecting CNVR in prediction of fat and lean tail of sheep, the CNVR is located at Chr15:3770601-3813600 with reference to a sheep genome ARS-UI_Ramb_v2.0. Through detection of the CNVR, efficient prediction of fat tail or lean tail of sheep can be realized.

[0020] In the present application, the reagent for detecting CNVR includes primers for predicting fat and lean tail of sheep by CNV, and the nucleotide sequences of the primers are shown in SEQ ID NO. 1 (GGTTTTGGAGCCCTATGCCA) and SEQ ID NO. 2 (ACCACCTGCTGTTCCTTTGT).

[0021] In the present application, the reagent also includes internal reference primers, and the nucleotide sequences of the internal reference primers are shown in SEQ ID NO. 3 (TCAACGACTGGATGACTGCC) and SEQ ID NO. 4 (TTTCCCACTTGGGCCAGTTT).

[0022] The present application also provides a method for predicting fat and lean tail of sheep by CNV, comprising the following steps:

[0023] The reagent for detecting CNVR or the kit for detecting CNVR is used to detect the genome of sheep, if the copy number is repeated, it is judged as fat-tailed sheep, and if the copy number is normal, it is judged as lean-tailed sheep; the CNVR is located at Chr15: 3770601-3813600 with the sheep genome ARS-UI_Ramb_v2.0 as reference. In the present application, the sheep reference genome used for comparison after detection is preferably ARS-UI_Ramb_v2.0. In the present application, the detection method preferably includes qPCR method. In the present application, the reaction conditions of qPCR are 95℃ for 5min, 95℃ for 10s, 60℃ for 10s, 70℃ for 15s, and cycling for 40 times.

[0024] In order to further illustrate the present application, the application of the reagent for detecting CNVR in predicting fat and lean tail of sheep, and the reagent, kit and method for predicting fat and lean tail of sheep by CNV are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0025] Example 1

[0026] 1. Resequencing: Resequencing was performed on 16 fat-tailed sheep (Lanzhou big-tailed sheep, Altai sheep, big-tailed cold sheep, Guangling big-tailed sheep and Tong sheep) and 32 lean-tailed sheep (Tibetan sheep, Weining sheep and Hanzhong sheep), sequencing was performed by Illumina HiSeq2000 platform, the reference genome for comparison was ARS-UI_Ramb_v2.0, CNV variation detection and CNVR merging operation were performed, CNVnator (parameters: -call 100) was used for detection, and potential deletion and duplication were determined by different reads coverage depth on the genome.

[0027] 2. Selective sweep analysis

[0028] The Vst analysis was performed on different tail types of sheep, wherein the Vst analysis is an index similar to the Fst, which is used to measure the size of the difference between groups of each CNVR statistics, and the calculation method is Vst=(Vt-Vs) / Vt, wherein Vt represents the standard deviation of the size of the copy number of the region of all samples, and Vs represents the value of the standard deviation of each group after being weighted according to the size of the group. The value of Vst is mostly between 0-1, and the greater the value, the greater the difference in the copy number variation between groups, and vice versa.

[0029] The Vst analysis was performed on two groups of sheep with different tail types, and a CNVR (3770601-3813600, Vst=0.7224) on chromosome 15 was found to be strongly selected (as shown in the Manhattan plot of the Vst value of CNVRs); gene annotation was performed on it, and it was found that this region was located upstream of the PDGFD gene. Figure 1

[0030] 3. GWAS analysis

[0031] The GWAS analysis of the tail types of 178 sheep was performed by using CNVruler, a linear regression model was used to perform the association analysis of the CNVRs and the fat tail and the thin tail, the phenotype value of the fat tail sheep was set to 1, the phenotype value of the thin tail sheep was set to 0, the threshold value was set to FDRp value <0.05, and the CNVRs related to the tail type were detected.

[0032] The results are shown in Figure 2 (Manhattan plot of GWAS analysis of different tail types), and the GWAS analysis of the tail types of 178 sheep was performed, and this CNVR on chromosome 15 was also identified to be related to the tail type and was in the peak value (peak_value=6.7913).

[0033] The copy number of this CNVR was detected in 178 sheep by using CNVnator (parameters: -call 100), and the results are shown in Figure 3 (Figure of the copy number results of the CNVR on chromosome 15 in different tail types of sheep), it was found that the copy number duplication occurred in the fat tail sheep, and it was normal copy number (in the box) in the thin tail sheep. Figure 3

[0034] 4. Verification of CNVR by qPCR

[0035] ​​Three DNA samples of HUS (fat-tailed sheep) and EFS (lean-tailed sheep) were selected to verify the CNVR by qPCR, with three biological replicates and three technical replicates. The sequences of CNVRs were obtained from the NCBI website, and Primer-Blast was used to design primers for CNVR. According to previous studies, DGAT2 was used as an internal reference gene; the specific primer information was CNVR-F: GGTTTTGGAGCCCTATGCCA (SEQ ID NO. 1), CNVR-R: ACCACCTGCTGTTCCTTTGT (SEQ ID NO. 2); DGAT1-F: TCAACGACTGGATGACTGCC (SEQ ID NO. 3), DGAT1-R: TTTCCCACTTGGGCCAGTTT (SEQ ID NO. 4). qPCR was performed according to the instructions of TB Green Premix Ex Taq TM II (Takara, China). The qPCR experiment was performed using a LightCycler / LightCycler 480 system (Roche Diagnostics). The qPCR conditions were 95°C for 5 min, 95°C for 10 s, 60°C for 10 s, 70°C for 15 s, and cycling 40 times. The Ct value results were obtained using the formula 2 -ΔΔCt Method calculation. Finally, the copy number of the target region was obtained by the 2x2 -ΔΔCt equation.

[0036] Results as shown in Figure 4 (CNVR qPCR verification results) showed that the copy number in HUS was twice that of EFS, and the results were the same as the sequencing results. This CNVR occurred duplication in fat-tailed sheep.

[0037] Although the above embodiment makes a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which belong to the protection scope of the present application.

Claims

1. Use of an agent that detects CNVR in the prediction of fat versus lean tail in sheep, characterised in that, The CNVR is located at Chr15:3770601-3813600 in the sheep genome ARS-UI_Ramb_v2.

0.

2. Use according to claim 1, characterized in that, The reagent for detecting the CNVR comprises primers for predicting fat and lean tail of sheep by CNV, and nucleotide sequences of the primers are shown as SEQ ID NO. 1 and SEQ ID NO.

2.

3. Use according to claim 2, characterized in that, The reagent further comprises internal reference primers, and nucleotide sequences of the internal reference primers are shown as SEQ ID NO. 3 and SEQ ID NO.

4.

4. A method of predicting fat versus lean tail in sheep by CNV, characterized in that, The method comprises the following steps: The genome of the sheep is detected by the reagent for detecting the CNVR, if the copy number is repeated, it is judged as fat-tailed sheep, and if the copy number is normal, it is judged as lean-tailed sheep; the CNVR is located at Chr15:3770601-3813600 in the sheep genome ARS-UI_Ramb_v2.

0.

5. The method of claim 4, wherein, After the detection, the sheep reference genome for comparison is ARS-UI_Ramb_v2.

0.

6. The method of claim 4, wherein, The detection method comprises a qPCR method.

7. The method of claim 6, wherein, The reaction condition of the qPCR is 95℃ for 5 min, 95℃ for 10 s, 60℃ for 10 s, 70℃ for 15 s, and cycling for 40 times.