Klebsiella pneumoniae typing detection primer group based on multiple fluorescent quantitative PCR, kit and detection method
By designing a primer set and kit for Klebsiella pneumoniae typing detection using multiplex real-time PCR, the problems of low sensitivity and specificity in existing technologies have been solved, enabling rapid and accurate Klebsiella pneumoniae typing detection. This method is suitable for routine clinical laboratories and expands detection efficiency and platform usage.
Patent Information
- Application Number
- CN202511227113.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-11-07
AI Technical Summary
Existing Klebsiella pneumoniae typing detection technologies suffer from low sensitivity and specificity, high testing costs, and complex operation, making them difficult to promote and apply in routine clinical laboratories.
A primer set and kit for Klebsiella pneumoniae typing detection based on multiplex quantitative PCR were designed, including specific primers and probes. By simultaneously reading multiplex PCR reaction and fluorescence signal, the design of fluorescent probes and the detection process were optimized to improve the sensitivity and specificity of detection.
It enables rapid and accurate typing of Klebsiella pneumoniae, suitable for routine clinical laboratory diagnosis, expands to 6 genotypes, improves detection efficiency, is suitable for large-scale clinical screening, and is easy to operate, shortening the detection time to 1 hour.
Smart Images

Figure CN120905415A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of Klebsiella pneumoniae detection technology, specifically relating to a primer set, kit, and detection method for Klebsiella pneumoniae typing based on multiplex quantitative PCR. Background Technology
[0002] The statements herein provide only background information in relation to this invention and do not necessarily constitute prior art.
[0003] Klebsiella pneumoniae ( Klebsiella pneumoniae Klebsiella pneumoniae (KP), a capsular Gram-negative bacillus, has become the second most common Gram-negative bacterium in clinical isolation rate after Escherichia coli, making it an important pathogen for both nosocomial and community-acquired infections. Based on its virulence characteristics and phenotypic differences, this bacterium can be divided into classical Klebsiella pneumoniae (KP). classical K. pneumoniae (cKP) and highly virulent Klebsiella pneumoniae ( hypervirulent K. pneumoniae The two major subgroups are hvKP. [1] Serological typing systems based on capsular polysaccharide antigen (K antigen) have identified more than 70 serotypes. [2] Among them, serotypes K1, K2, K5, K20, K54, and K57 are defined as highly virulent capsular serotypes due to their significant clinical prevalence and strong invasiveness. [3] Different serotypes of Klebsiella pneumoniae cause different types of disease and require different treatments. Therefore, typing of Klebsiella pneumoniae is essential for developing effective treatment plans.
[0004] Current serotyping techniques primarily rely on traditional serological agglutination assays and molecular biological typing methods. Traditional serological methods have several limitations, such as high costs for the preparation and storage of specific antisera, long potency verification cycles, potential biosafety hazards during procedures, and susceptibility to subjective interpretation. Molecular biological typing methods mainly include multiplex quantitative PCR and whole-genome sequencing. While whole-genome sequencing-based molecular typing offers high resolution, its high testing costs, complex bioinformatics analysis processes, and specialized database requirements limit its widespread application in routine clinical laboratories. [4] Existing Klebsiella pneumoniae typing kits based on real-time quantitative PCR technology suffer from low sensitivity and specificity, as well as limited serotype detection and low efficiency. Therefore, developing a rapid, accurate, and routinely applicable serological typing technique for clinical laboratory diagnosis is of significant clinical value in guiding precise anti-infective therapy and improving patient prognosis.
[0005] References: [1] Han X, Yao J, He J, Liu H, Jiang Y, Zhao D, Shi Q, Zhou J, Hu H, Lan P, Zhou H, Li X. Clinical and laboratory insights into the threat of hypervirulent Klebsiella pneumoniae. Int J Antimicrob Agents. 2024 Sep;64(3):107275. [2] Kocsis B. Hypervirulent Klebsiella pneumoniae: An update on epidemiology, detection and antibiotic resistance. Acta Microbiol Immunol Hung. 2023 Dec 4;70(4):278-287. [3], Lee CR, Lee JH, Park KS, Jeon JH, Kim YB, Cha CJ, Jeong BC, Lee SH. Antimicrobial Resistance of Hypervirulent Klebsiella pneumoniae: Epidemiology, Hypervirulence-Associated Determinants, and Resistance Mechanisms. Front Cell Infect Microbiol. 2017 Nov 21;7:483; Sanikhani R, Moeinirad M, Shahcheraghi F, Lari A, Fereshteh S, Sepehr A, Salimi A, Badmasti F. Molecular epidemiology of hypervirulent Klebsiella pneumoniae: a systematic review and meta-analysis. Iran J Microbiol. 2021 Jun;13(3):257-265; Hussain I, Ishrat S, Ho DCW, Khan SR, Veeraraghavan MA, Palraj BR, Molton JS, Abid MB. Endogenous endophthalmitis in Klebsiella pneumoniae pyogenic liver abscess: Systematic review and meta-analysis. Int J Infect Dis. 2020 Dec;101:259-268. [4], Octavia S, Kalisvar M, Venkatachalam I, Ng OT, Xu W, Sridatta PSR, Ong YF, Wang L, Chua A, Cheng B, Lin RTP, Teo JWP. Klebsiella pneumoniae and Klebsiella quasipneumoniae define the population structure of blaKPC-2 Klebsiella: a 5 year retrospective genomic study in Singapore. J Antimicrob Chemother. 2019 Nov 1;74(11):3205-3210; Zhong XS, Li YZ, Ge J, Xiao G, Mo Y, Wen YQ, Liu JP, Xiong YQ, Qiu M, Huo ST, Cheng MJ, Chen Q. Comparisons of microbiological characteristics and antibiotic resistance of Klebsiella pneumoniae isolates from urban rodents, shrews, and healthy people. BMC Microbiol. 2020 Jan 14;20(1):12. SUMMARY
[0006] In order to make up for the shortcomings of the prior art, the present application provides a Klebsiella pneumoniae typing detection primer group, kit and detection method based on multiplex fluorescent quantitative PCR. Based on the fluorescent probe and detection process designed in the present application, the sensitivity and specificity of Klebsiella pneumoniae detection are significantly improved.
[0007] In order to achieve the above effects, the present application provides the following technical solutions: As a first aspect of the present application, a Klebsiella pneumoniae typing detection primer group based on multiplex fluorescent quantitative PCR is provided, comprising the following primers: a Klebsiella pneumoniae 16S upstream primer as shown in the sequence table SEQ ID NO. 1; a Klebsiella pneumoniae 16S downstream primer as shown in the sequence table SEQ ID NO. 2; a Klebsiella pneumoniae K1 type upstream primer as shown in the sequence table SEQ ID NO. 3; Klebsiella pneumoniae K1 type downstream primer as shown in the sequence listing of SEQ ID NO. 4; Klebsiella pneumoniae K2 type upstream primer as shown in the sequence listing of SEQ ID NO. 5; Klebsiella pneumoniae K2 type downstream primer as shown in the sequence listing of SEQ ID NO. 6; Klebsiella pneumoniae K5 type upstream primer as shown in the sequence listing of SEQ ID NO. 7; Klebsiella pneumoniae K5 type downstream primer as shown in the sequence listing of SEQ ID NO. 8; Klebsiella pneumoniae K20 type upstream primer as shown in the sequence listing of SEQ ID NO. 9; Klebsiella pneumoniae K20 type downstream primer as shown in the sequence listing of SEQ ID NO. 10; Klebsiella pneumoniae K54 type upstream primer as shown in the sequence listing of SEQ ID NO. 11; Klebsiella pneumoniae K54 type downstream primer as shown in the sequence listing of SEQ ID NO. 12; Klebsiella pneumoniae K57 type upstream primer as shown in the sequence listing of SEQ ID NO. 13; Klebsiella pneumoniae K57 type downstream primer as shown in the sequence listing of SEQ ID NO. 14.
[0008] As a second aspect of the present application, there is provided a Klebsiella pneumoniae typing detection kit based on multiplex fluorescent quantitative PCR, comprising the primer set of the first aspect.
[0009] Further, the following probes are further included: Klebsiella pneumoniae 16S probe as shown in the sequence listing of SEQ ID NO. 15; Klebsiella pneumoniae K1 type probe as shown in the sequence listing of SEQ ID NO. 16; Klebsiella pneumoniae K2 type probe as shown in the sequence listing of SEQ ID NO. 17; Klebsiella pneumoniae K5 type probe as shown in the sequence listing of SEQ ID NO. 18; Klebsiella pneumoniae K20 type probe as shown in the sequence listing of SEQ ID NO. 19; Klebsiella pneumoniae K54 type probe as shown in the sequence listing of SEQ ID NO. 20; Klebsiella pneumoniae K57 type probe as shown in the sequence listing of SEQ ID NO. 21.
[0010] In some embodiments, the fluorescent group of the probe comprises VIC, CY5, FAM and ROX, and the quenching group of the probe comprises BHQ1, BHQ2 and MGB.
[0011] Specifically, the 16S probe of Klebsiella pneumoniae has a fluorescent group of VIC and a quenching group of BHQ1; the K1 type probe of Klebsiella pneumoniae has a fluorescent group of VIC and a quenching group of BHQ1; the K2 type probe of Klebsiella pneumoniae has a fluorescent group of CY5 and a quenching group of BHQ2; the K5 type probe of Klebsiella pneumoniae has a fluorescent group of FAM and a quenching group of MGB; the K20 type probe of Klebsiella pneumoniae has a fluorescent group of ROX and a quenching group of BHQ2; the K54 type probe of Klebsiella pneumoniae has a fluorescent group of CY5 and a quenching group of BHQ2; and the K57 type probe of Klebsiella pneumoniae has a fluorescent group of FAM and a quenching group of MGB.
[0012] Further, in the kit, the specific primers and probes for detecting the K1 type, K2 type and K5 type of Klebsiella pneumoniae are the multiplex PCR reaction A liquid, and the specific primers and probes for detecting the 16S, K20 type, K54 type and K57 type of Klebsiella pneumoniae are the multiplex PCR reaction B liquid.
[0013] Further, the kit further comprises: a positive control and a negative control; the positive control is a plasmid liquid carrying Klebsiella pneumoniae and six serotype gene fragments; and the negative control is deionized water.
[0014] In some embodiments, the multiplex PCR reaction A and B liquid further comprises 2x PerfectStar II Probe qPCR SuperMix and Passive Reference Dye 50x.
[0015] As a third aspect of the present application, a Klebsiella pneumoniae detection method based on multiplex fluorescence quantitative PCR is provided, comprising the following steps: Step 1, extracting nucleic acid DNA of a strain or a specimen to be detected; Step 2, using the nucleic acid DNA extracted in step 1 as a template, and performing PCR amplification by using the primer set provided in the first aspect; Step 3, synchronously reading a fluorescence signal after completing one round of the PCR amplification.
[0016] In step 1, the specimen can be sputum, urine, feces or blood, and more further, a serum specimen.
[0017] In step 2, the specific process comprises: The PCR reaction system is prepared, and the total volume of the reaction is 20 mu L; the volume of the template DNA is 1 mu L, the volume of the 16S upstream primer is 0.8 mu L, the volume of the 16S downstream primer is 0.6 mu L, the volume of the K1 upstream primer is 0.4 mu L, the volume of the K1 downstream primer is 0.4 mu L, the volume of the K2 upstream primer is 0.6 mu L, the volume of the K2 downstream primer is 0.6 mu L, the volume of the K5 upstream primer is 0.4 mu L, the volume of the K5 downstream primer is 0.4 mu L, the volume of the K20 upstream primer is 0.4 mu L, the volume of the K20 downstream primer is 0.4 mu L, the volume of the K54 upstream primer is 0.4 mu L, the volume of the K54 downstream primer is 0.4 mu L, the volume of the K57 upstream primer is 0.6 mu L, and the volume of the K57 downstream primer is 0.6 mu L; the volume of the 16S probe is 0.6 mu L, the volume of the K1 probe is 0.24 mu L, the volume of the K2 probe is 0.24 mu L, the volume of the K5 probe is 0.24 mu L, the volume of the K20 probe is 0.32 mu L, the volume of the K54 probe is 0.24 mu L, and the volume of the K57 probe is 0.24 mu L. 10 mu L of 2x PerfectStar II Probe qPCR SuperMix is added. 0.4 mu L of Passive Reference Dye (50x) is added. Distilled water is added to 20 mu L.
[0018] The PCR amplification reaction program is as follows: 1 initial denaturation: 94 DEG C, 30 seconds.
[0019] 2 cycle amplification includes denaturation stage: 94 DEG C, 5 seconds, annealing stage: 60 DEG C, 30 seconds, 45 cycles, and synchronous completion of fluorescence signal acquisition.
[0020] Compared with the prior art, the present application has the following beneficial effects: 1. The present application provides a Klebsiella pneumoniae typing detection primer group and kit based on multiplex fluorescent quantitative PCR, which has high sensitivity and specificity, and the detection method can realize rapid and accurate typing of Klebsiella pneumoniae, and is suitable for clinical routine laboratory diagnosis.
[0021] 2. The primer group and kit provided by the present application have high amplification efficiency, compared with conventional double and triple nucleic acid detection, the present application can be expanded to 6 gene typing and identification of Klebsiella pneumoniae, and the system has strong compatibility, can significantly improve the detection efficiency, and is especially suitable for clinical large-scale screening or resource-limited scenarios. In addition, the technical solution provided by the present application can be further expanded to use platforms, and provides a standardized development path for other pathogen typing detection.
[0022] 3. The multiplex nucleic acid detection provided by the present application overcomes the problem that multiple pairs of primers may cause primer dimers or non-specific amplification, is based on thermodynamic parameter matching, ensures that the Tm values of all primers differ by less than or equal to 2 DEG C, avoids differences in amplification efficiency, and at the same time, differentiates the probes by using different fluorescent reporter groups (such as VIC / K1, CY5 / K2) to avoid spectral overlap.
[0023] 4, The kit provided by the present application has the advantages of convenient operation, shortening the detection time to 1 hour, and less reagent consumption. BRIEF DESCRIPTION OF DRAWINGS
[0024] The accompanying drawings, which form a part of this specification, are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification. The embodiments of these drawings are set to explain the present application, and do not constitute an improper limitation on the present application.
[0025] Figure 1 The annealing temperature comparison results of Klebsiella pneumoniae and six serotypes for the embodiments of the present application; Figure 2 The fluorescence reaction curve of the finally determined Klebsiella pneumoniae K1, K2 and K5 serotype probes for the embodiments of the present application; Figure 3 The fluorescence reaction curve of the finally determined Klebsiella pneumoniae 16S, K20, K54 and K57 serotype probes for the embodiments of the present application; Figure 4 The sensitivity results of Klebsiella pneumoniae and six serotypes for the embodiments of the present application; Figure 5 The specificity results of Klebsiella pneumoniae and six serotypes for the embodiments of the present application. DETAILED DESCRIPTION
[0026] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.
[0027] In some embodiments of the present application, a Klebsiella pneumoniae and serotype detection primer group, kit and detection method based on multiplex fluorescent quantitative PCR are provided. The multiplex fluorescent quantitative PCR Klebsiella pneumoniae and serotyping detection kit comprises multiplex PCR reaction A, B liquid, positive control and negative control; the multiplex PCR reaction A liquid comprises specific probes and primers for detecting Klebsiella pneumoniae K1 type, Klebsiella pneumoniae K2 type and Klebsiella pneumoniae K5 type, respectively; the multiplex PCR reaction B liquid comprises specific probes and primers for detecting Klebsiella pneumoniae 16S, Klebsiella pneumoniae K20 type, Klebsiella pneumoniae K54 type and Klebsiella pneumoniae K57 type, respectively.
[0028] Based on the kit, by processing the sample, preparing the reaction system, performing PCR amplification, reading the fluorescence signal and other steps, accurate quantitative detection of Klebsiella pneumoniae and serotyping can be quickly and efficiently realized. Moreover, the present application significantly improves the sensitivity and accuracy of detection by optimizing the design of fluorescent probes and the detection process.
[0029] In some embodiments, the fluorescent group of the probe comprises VIC, CY5, FAM and ROX, and the quenching group of the probe comprises BHQ1, BHQ2 and MGB.
[0030] In some embodiments, a Klebsiella pneumoniae detection method based on multiplex fluorescent quantitative PCR is provided, comprising the following steps: Step 1, extracting nucleic acid DNA of the strain or specimen to be tested; The specimen can be sputum, urine, feces, blood.
[0031] Step 2, using the above-mentioned primer group to perform PCR amplification with the nucleic acid DNA extracted in step 1 as a template; the specific process comprises: Preparation of PCR reaction system, reaction A liquid: the total reaction volume is 20 μL, the template DNA volume is 1 μL, K1 upstream primer 0.4 μL, downstream primer 0.4 μL, K2 upstream primer 0.6 μL, downstream primer 0.6 μL, K5 upstream primer 0.4 μL, downstream primer 0.4 μL, K1 probe 0.24 μL, K2 probe 0.24 μL, K5 probe 0.24 μL, 2×PerfectStarⅡ Probe qPCR SuperMix 10 μL. Passive Reference Dye (50x) 0.4 μL. Double distilled water is added to 20 μL.
[0032] Reaction B liquid: the total reaction volume is 20 μL, the template DNA volume is 1 μL, 16S upstream primer 0.8 μL, downstream primer 0.6 μL, K20 upstream primer 0.4 μL, downstream primer 0.4 μL, K54 upstream primer 0.4 μL, downstream primer 0.4 μL, K57 upstream primer 0.6 μL, downstream primer 0.6 μL; 16S probe 0.6 μL, K20 probe 0.32 μL, K54 probe 0.24 μL, K57 probe 0.24 μL. 2×PerfectStarⅡ Probe qPCR SuperMix 10 μL. Passive Reference Dye (50x) 0.4 μL. Double distilled water is added to 20 μL.
[0033] The PCR amplification reaction program is as follows: 1 Initial denaturation: 94℃, 30 seconds.
[0034] 2 Cycle amplification includes denaturation stage: 94℃, 5 seconds, annealing stage: 60℃, 30 seconds, 45 cycles.
[0035] Step 3, synchronously reading the fluorescence signal after completing 1 PCR amplification.
[0036] In the above embodiments, the sensitivity of the detection result can be improved by regulating the primer concentration, probe concentration and annealing temperature of the detection process.
[0037] The application is further described below in conjunction with the embodiments.
[0038] The reagents and instruments in the following embodiments are all conventional experimental reagents and instruments.
[0039] Embodiment 1, A Klebsiella pneumoniae serotyping detection kit based on multiplex fluorescent quantitative PCR comprises multiplex PCR reaction A, B liquids, Klebsiella pneumoniae and positive and negative controls of serum type. The multiplex PCR reaction A liquid comprises 2xPerfectStar II Probe qPCR SuperMix, Passive Reference Dye (50x), upper and lower primers and probes of Klebsiella pneumoniae K1 type, upper and lower primers and probes of Klebsiella pneumoniae K2 type, and upper and lower primers and probes of Klebsiella pneumoniae K5 type. The multiplex PCR reaction B liquid comprises 2xPerfectStar II Probe qPCR SuperMix, Passive Reference Dye (50x), upper and lower primers and probes of Klebsiella pneumoniae 16S, upper and lower primers and probes of Klebsiella pneumoniae K20 type, upper and lower primers and probes of Klebsiella pneumoniae K54 type, and upper and lower primers and probes of Klebsiella pneumoniae K57 type. The sequences of the primers and probes are as follows: Klebsiella pneumoniae 16S upper primer: GCAGTAAAGATGGTGGAGCTATG (SEQ ID NO. 1); Klebsiella pneumoniae 16S lower primer: AAGAGGTTGCAAACGATGGG (SEQ ID NO. 2); Klebsiella pneumoniae K1 type upper primer: ATATGGCCAGTCCGAAAGTG (SEQ ID NO. 3); Klebsiella pneumoniae K1 type lower primer: TATTCCCACTCCCTCTCCAA (SEQ ID NO. 4); Klebsiella pneumoniae K2 type upper primer: CATATTCATCCGTGGCAACAAG (SEQ ID NO. 5); Klebsiella pneumoniae K2 type lower primer: ACCGAAGAATCCAACTCCTAA (SEQ ID NO. 6); Klebsiella pneumoniae K5 type upper primer: AGTGATGCTCGCGAATGT (SEQ ID NO. 7); Klebsiella pneumoniae K5-type downstream primer: CCCGCGCCTACCTTATTT (SEQ ID NO. 8); Klebsiella pneumoniae K20-type upstream primer: CCCTACCCTCTGGAAGTCTAT (SEQ ID NO. 9); Klebsiella pneumoniae K20-type downstream primer: AACATGGGTATCAATGGGTAAGA (SEQ ID NO. 10); Klebsiella pneumoniae K54-type upstream primer: AAACGAAGGCTTCTGGAACA (SEQ ID NO. 11); Klebsiella pneumoniae K54-type downstream primer: AGCCCAGCACTCATACCTA (SEQ ID NO. 12); Klebsiella pneumoniae K57-type upstream primer: TTGTTACTCTGGAAGCGACAG (SEQ ID NO. 13); Klebsiella pneumoniae K57-type downstream primer: GGCTGCCATAAGCACTAGAA (SEQ ID NO. 14); Klebsiella pneumoniae 16S probe: 5'-VIC-AGACCTCCTGCGTGCAAAGCA-BHQl-3' (SEQ ID NO. 15); Klebsiella pneumoniae K1 -type probe: 5'-VIC-CTTGGCATCATGCAATAGCCACGTTT- BHQl-3' (SEQ ID NO. 16); Klebsiella pneumoniae K2-type probe: 5'-CY5-TTCAGTCCGACTATGAACATCGTTCCC- BHQ2-3' (SEQ ID NO. 17); Klebsiella pneumoniae K5-type probe: 5'-FAM-CGATAACAACCGCCACCTCTAAGCAT- MGB-3' (SEQ ID NO. 18); Klebsiella pneumoniae K20-type probe: 5'-ROX-CTTGGGCGGCACTGGATACAGTATAAT- BHQ2-3' (SEQ ID NO. 19); Klebsiella pneumoniae K54-type probe: 5'-CY5-TTGTCTGGAGTGTCTTGGTCATTAGCC- BHQ2-3' (SEQ ID NO. 20); Klebsiella pneumoniae K57-type probe: 5'-FAM-TTCGGTTATGTATTTCGTGCTGGAGGG- MGB-3' (SEQ ID NO. 21).
[0040] The Klebsiella pneumoniae and six serotype positive controls are plasmid solutions carrying Klebsiella pneumoniae and six serotype gene fragments, and the negative control is deionized water.
[0041] Example 2, The Klebsiella pneumoniae and typing detection method based on multiplex fluorescent quantitative PCR includes the following steps: 1. Nucleic acid extraction of cultured bacteria: 1) Use 10 μL inoculation ring to pick up 1 full ring of bacteria and add it to an EP tube containing 100-150 μL deionized water to resuspend the bacterial bodies, and place it in a metal bath at 100℃ for 15 min.
[0042] 2) After slow cooling, centrifuge at 12000 rpm for 10 min, and take the supernatant as the sample to be tested and store it at -20℃ for later use.
[0043] 2. Nucleic acid detection: 1) Add multiplex PCR reaction A and B liquids from the kit provided in Example 1 to an eight-tube array, respectively, and add the sample prepared in step 1 to the multiplex PCR reaction A and B liquids to prepare a PCR mixture for the sample to be tested, and centrifuge momentarily.
[0044] Prepare the PCR reaction system according to the amounts shown in Table 1, and the total volume of the reaction system is 20 μL. Table 1 PCR reaction system
[0045] 2) Perform PCR amplification on the PCR mixture for the sample to be tested; Place the closed PCR reaction plate in the full-automatic medical PCR analysis system Lepgen-96 for PCR amplification. The quantitative PCR amplification reaction conditions are as follows: Initial denaturation: 94℃, 30 seconds. Cycle amplification (45 cycles) includes a denaturation stage: 94℃, 5 seconds. Annealing stage: 60℃, 30 seconds.
[0046] 3) After each PCR amplification is completed, read the fluorescence signal synchronously.
[0047] After the PCR amplification reaction is completed, in the full-automatic medical PCR analysis system Lepgen-96 reading and analysis system, perform Klebsiella pneumoniae K1 type, Klebsiella pneumoniae K2 type, and Klebsiella pneumoniae K5 type detection in the A hole VIC, CY5, and FAM channels, respectively, and perform Klebsiella pneumoniae 16S, Klebsiella pneumoniae K20 type, Klebsiella pneumoniae K54 type, and Klebsiella pneumoniae K57 type detection in the B hole VIC, ROX, CY5, and FAM channels, respectively. Figure 2 and Figure 3The fluorescence curve of the final determined Klebsiella pneumoniae and serotype.
[0048] 4) Quality control standards Negative control: The negative control has no signal or CT value ≥ 35 through the ROX channel, VIC channel, CY5 channel and FAM channel, and is determined to be negative.
[0049] Positive control: In the control A well, the positive control K1 is detected in the VIC channel, i.e., the VIC channel detects Klebsiella pneumoniae K1 type, the positive control K2 is detected in the CY5 channel, i.e., the CY5 channel detects Klebsiella pneumoniae K2 type, and the positive control K5 is detected in the FAM channel, i.e., the FAM channel detects Klebsiella pneumoniae K5 type. In the control B well, the positive control 16S is detected in the VIC channel, i.e., the VIC channel detects Klebsiella pneumoniae 16S, the positive control K20 is detected in the ROX channel, i.e., the ROX channel detects Klebsiella pneumoniae K20 type, the positive control K54 is detected in the CY5 channel, i.e., the CY5 channel detects Klebsiella pneumoniae K54 type, and the positive control K57 is detected in the FAM channel, i.e., the FAM channel detects Klebsiella pneumoniae K57 type. The fluorescence quantitative CT value of the positive control is measured to be < 35, and if one of the positive control or the negative control does not meet the standard, the detection is invalid.
[0050] Example 3, Comparison of different detection conditions: Different detection conditions are set to compare the test results in order to further improve the accuracy and sensitivity of the detection results.
[0051] Firstly, the construction and verification of the standard plasmid are carried out. The PCR specific fragments are connected with the pUC19 vector system, and the plasmid is extracted after transformation to obtain the plasmid standard.
[0052] Then, the sample preparation is carried out.
[0053] Then, the annealing temperature, primer working concentration and probe working concentration are compared. The working concentrations of the single fluorescence quantitative primer and probe are compared, the single primer and probe are selected, diluted to 0.2 μM initial concentration with nuclease-free water, and the use amount is shown in Table 2, and deionized water is used as a negative control.
[0054] Table 2 Amount of each reagent in the PCR reaction system
[0055] 3.1 Comparison of different annealing temperatures The annealing temperature is adjusted, and the test is carried out in 6 gradients in the range of 59℃-64℃.
[0056] 3.2 Comparison of different primer concentrations Adjust the primer concentration and conduct experiments in 5 gradients, adding 0.1 μL to 0.5 μL of primer to a 20 μL system.
[0057] 3.3 Comparison of different probe concentrations Adjust the probe concentration. In a 20 μL system, add 0.1 μL to 0.5 μL of 16S probe in 5 gradients for testing, and add 0.04 μL to 0.2 μL of serum probe in 5 gradients for comparative testing.
[0058] Experimental results are as follows Figure 1 As shown in Tables 3, 4, 5, and 6.
[0059] Table 3 Comparison of annealing temperatures for Klebsiella pneumoniae and its serotypes
[0060] Table 4. Comparison of 16S primer and probe concentrations for Klebsiella pneumoniae
[0061] Table 5. Comparison of primer and probe concentrations for K1, K2, and K5 types of Klebsiella pneumoniae.
[0062] Table 6. Comparison of primer and probe concentrations for K20, K54, and K57 types of Klebsiella pneumoniae.
[0063] Depend on Figure 1 Comparing the results with those in Tables 3-6, the optimal temperatures for Klebsiella pneumoniae 16S are: 60℃, primer concentration 0.4μM, and probe concentration 0.3μM; Klebsiella pneumoniae K1 type: 62℃, primer concentration 0.2μM, and probe concentration 0.12μM; Klebsiella pneumoniae K2 type: 62℃, primer concentration 0.3μM, and probe concentration 0.12μM; Klebsiella pneumoniae K5 type: 62℃, primer concentration 0.2μM, and probe concentration 0.12μM; Klebsiella pneumoniae K20 type: 60℃, primer concentration 0.2μM, and probe concentration 0.16μM; Klebsiella pneumoniae K54 type: 60℃, primer concentration 0.3μM, and probe concentration 0.12μM; and Klebsiella pneumoniae K57 type: 60℃, primer concentration 0.3μM, and probe concentration 0.12μM. In summary, the annealing temperature is determined to be 60℃.
[0064] Example 4, This embodiment tests the sensitivity, specificity, and repeatability of the kit provided in Example 1. The specific methods are as follows: 1. Sensitivity test of the reagent kit Based on the optimal conditions determined by comparing Example 2 and Example 3, the standard plasmid with a concentration of 1 x 10 1 ~ 1 x 10 7 fg / μL was taken as a template to detect the sensitivity of each target fluorescent quantitative PCR, and a standard curve of fluorescent quantitative PCR was established, and the results are shown in Table 7 and Figure 4 Fig. 7. Among them, the X axis is the exponential of the concentration of the plasmid standard, and the Y axis is the CT value detected by the plasmid standard.
[0065] Table 7 Sensitivity of PCR
[0066] 2. Specificity test of the kit Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and Acinetobacter baumannii standard were diluted to an appropriate concentration, and DNA templates of Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa and Acinetobacter baumannii were obtained. The specificity of fluorescent quantitative PCR to plasmid standard and bacteria was detected, and the specificity results column chart is shown in Figure 5 .
[0067] From Figure 5 It can be seen that the CT value of the target gene is lower, and the CT value of other templates is > 35 or not detected, indicating that the specificity of the probe is good.
[0068] 3. Reproducibility test of the kit The standard with a concentration of 1 x 10 6 fg / μL, 1 x 10 4 fg / μL, 1 x 10 2 fg / μL was taken as a template to perform reproducibility test, and the intra-group and inter-group coefficient of variation was calculated, and the results are shown in Table 8.
[0069] Table 8 Reproducibility test of multiplex fluorescent quantitative PCR
[0070] From Table 8, it can be seen that the intra-group coefficient of variation is between 0.13% and 1.01%, and the inter-group coefficient of variation is between 0.20% and 1.07%, both of which are less than 3%, indicating that the detection method provided by the present application has good reproducibility.
[0071] The above only describes the preferred embodiments of the present application and is not used to limit the present application. For those skilled in the art, the present application can have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A primer set for detecting Klebsiella pneumoniae typing based on multiplex fluorescent quantitative PCR, characterized in that, The primers include: A 16S upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 1; A 16S downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 2; A K1 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 3; A K1 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 4; A K2 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 5; A K2 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 6; A K5 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 7; A K5 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 8; A K20 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 9; A K20 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 10; A K54 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 11; A K54 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 12; A K57 type upstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 13; A K57 type downstream primer of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO.
14.
2. A multiplex fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit, characterized by, The primer group for typing detection of Klebsiella pneumoniae based on multiplex fluorescent quantitative PCR according to claim 1.
3. The multiplex real-time fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit according to claim 2, characterized by, The probes include: A 16S probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 15; A K1 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 16; A K2 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 17; A K5 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 18; A K20 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 19; A K54 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO. 20; A K57 type probe of Klebsiella pneumoniae as shown in the sequence listing SEQ ID NO.
21.
4. The multiplex fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit according to claim 3, characterized by, The fluorescent groups of the probes include VIC, CY5, FAM and ROX, and the quenching groups of the probes include BHQ1, BHQ2 and MGB.
5. The multiplex real-time fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit according to claim 3, characterized by, In the kit, the specific primers and probes for detecting Klebsiella pneumoniae K1 type, K2 type and K5 type are multiplex PCR reaction A liquid, and the specific primers and probes for detecting Klebsiella pneumoniae 16S, K20 type, K54 type and K57 type are multiplex PCR reaction B liquid.
6. The multiplex real-time fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit according to claim 5, characterized by, The kit further includes: a positive control and a negative control; the positive control is a plasmid liquid carrying Klebsiella pneumoniae and six serotype gene fragments; and the negative control is deionized water.
7. The multiplex real-time fluorescent quantitative PCR-based Klebsiella pneumoniae typing test kit according to claim 5, characterized by, The multiplex PCR reaction A liquid and the multiplex PCR reaction B liquid further comprise 2x PerfectStar II Probe qPCR SuperMix and Passive Reference Dye 50x.
8. A multiplex fluorescent quantitative PCR-based Klebsiella pneumoniae detection method, characterized in that, The method comprises the following steps: Step 1, extracting nucleic acid DNA of the strain or specimen to be detected; Step 2, using the primer group of any one of claims 1-2 to perform PCR amplification with the nucleic acid DNA extracted in step 1 as a template; Step 3, reading the fluorescence signal after the PCR amplification is completed. 9.The multiplex fluorescent quantitative PCR-based Klebsiella pneumoniae detection method according to claim 8, characterized in that, In step 1, the specimen is selected from sputum, urine, feces or blood, and further is a serum specimen. 10.The multiplex fluorescent quantitative PCR-based Klebsiella pneumoniae detection method according to claim 8, characterized in that, In step 2, the specific process comprises: Preparation of a PCR reaction system, reaction A liquid: the total reaction volume is 20 μL, the template DNA volume is 1 μL, the K1 upstream primer is 0.4 μL, the K1 downstream primer is 0.4 μL, the K2 upstream primer is 0.6 μL, the K2 downstream primer is 0.6 μL, the K5 upstream primer is 0.4 μL, the K5 downstream primer is 0.4 μL, the K1 probe is 0.24 μL, the K2 probe is 0.24 μL, the K5 probe is 0.24 μL, 2x PerfectStar II Probe qPCR SuperMix is 10 μL, Passive Reference Dye 50x is 0.4 μL, and double-distilled water is added to 20 μL; or, Reaction B liquid: the total reaction volume is 20 μL, the template DNA volume is 1 μL, the 16S upstream primer is 0.8 μL, the 16S downstream primer is 0.6 μL, the K20 upstream primer is 0.4 μL, the K20 downstream primer is 0.4 μL, the K54 upstream primer is 0.4 μL, the K54 downstream primer is 0.4 μL, the K57 upstream primer is 0.6 μL, the K57 downstream primer is 0.6 μL; the 16S probe is 0.6 μL, the K20 probe is 0.32 μL, the K54 probe is 0.24 μL, the K57 probe is 0.24 μL; 2x PerfectStar II Probe qPCR SuperMix is 10 μL, Passive Reference Dye 50x is 0.4 μL, and double-distilled water is added to 20 μL; The PCR amplification reaction program is as follows: Initial denaturation: 94℃, 30 seconds; the cycle amplification comprises a denaturation stage: 94℃, 5 seconds, an annealing stage: 60℃, 30 seconds, 45 cycles, and synchronous completion of fluorescence signal acquisition.