LAMP (loop-mediated isothermal amplification) primer composition for detecting porcine epidemic diarrhea virus and application of LAMP primer composition

Abstract

The invention relates to the technical field of molecular biology and virology, in particular to an LAMP (loop-mediated isothermal amplification) primer composition for detecting porcine epidemic diarrhea virus and application thereof, the LAMP primer composition comprises an external primer pair, an internal primer pair and a loop primer pair; wherein the external primer pair comprises a forward primer F3 and a reverse primer B3; the internal primer pair comprises a forward primer FIP and a reverse primer BIP; the loop primer is a loop reverse primer LB. The LAMP primer composition for detecting the PEDV has the advantages of high sensitivity and high specificity, the PEDV can be rapidly and efficiently detected, and the operation environment does not need to be strictly controlled. The kit prepared from the LAMP primer composition has the advantages of high efficiency, reliability, simplicity and rapidness in operation, convenience in carrying and low detection cost, and can be prospectively used for early diagnosis of PEDV (porcine epidemic diarrhea virus).

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology and virology, in particular, to a LAMP primer composition for detecting porcine epidemic diarrhea virus and application thereof. BACKGROUND

[0002] Porcine epidemic diarrhea (PED) is a highly contagious digestive tract disease caused by porcine epidemic diarrhea virus (PEDV) of the Coronaviridae family, with acute watery diarrhea, vomiting, dehydration and high mortality rate of piglets as the main characteristics. PEDV was first discovered in the United Kingdom in 1971 and isolated and identified in Belgium in 1978. Since then, PEDV has spread and prevailed in Europe and Asia; since the end of 2010, PEDV has frequently occurred in various pig farms in China; in early 2013, PEDV first appeared in the United States, and subsequently broke out in many pig farms across the country, resulting in the death of more than 7 million newborn piglets within one year of the epidemic. In the past 50 years, PEDV has caused huge economic burden to pig farms all over the world and caused serious economic losses to the pig industry. In addition, PEDV often co-infects pigs with other coronaviruses such as transmissible gastroenteritis virus (TGEV) and porcine rotavirus (PRV), causing similar clinical symptoms, making it difficult to make differential diagnosis. Therefore, it is urgent to develop new, simple and effective methods for detecting PEDV; rapid and accurate diagnosis of PEDV is crucial for preventing and controlling the disease.

[0003] At present, there are many methods for detecting PEDV, such as conventional virus isolation, direct electron microscope (EM), enzyme-linked immunosorbent assay (ELISA), and molecular biology techniques including reverse transcription polymerase chain reaction (RT-PCR), in situ hybrization (ISH) and real-time RT-PCR, etc. These methods are time-consuming and require well-trained personnel or expensive and complex instruments. The most commonly used are RT-PCR and real-time RT-PCR techniques, which require professional laboratory personnel to operate and precise instruments, and cannot be used in some poor conditions.

[0004] The currently widely accepted PEDV detection method is the molecular genome detection method using PCR. That is, real-time quantitative polymerase chain reaction (qPCR), which is a widely used molecular biology technology method because it can detect PEDV DNA with high sensitivity, real-time detection, quantification and rapid analysis. Although its analysis speed is very fast, its instrument is relatively expensive, and the environment and professional skill requirements for experimental operation are high. In the primary medical point, due to the limited facility resources, the equipment cost and professional technical knowledge cannot meet the requirements of qPCR.

[0005] Loop-mediated isothermal amplification (LAMP) is a widely used molecular biology detection technology in recent years. Compared with traditional PCR, LAMP detection does not require complex equipment and can be amplified at constant temperature. It is simple to operate and the result is fast. LAMP relies on Bst DNA polymerase to realize the self-circulating strand displacement of nucleic acid, and amplifies the target DNA or RNA under isothermal conditions through specific LAMP primer group sequences, which can significantly improve the sensitivity and specificity. Developing LAMP technology for PEDV detection to achieve the sensitivity of qPCR will become a promising alternative and will be very beneficial to the monitoring and control of PEDV. However, the existing LAMP detection method for PEDV has the defects of being easily disturbed and prone to false positives.

[0006] Therefore, it is of great significance to establish a rapid and sensitive detection method for PEDV detection and early diagnosis. SUMMARY

[0007] The purpose of the present application is to solve the problems of qPCR detection of PEDV on the market, such as the need for expensive and precise instruments, high environmental requirements, complicated method, long time-consuming, etc. At the same time, the present LAMP detection method for PEDV has the defects of being easily disturbed and prone to false positives. Therefore, the present application provides a LAMP primer composition for detecting porcine epidemic diarrhea virus and its application. The LAMP primer composition for detecting PEDV has the advantages of high sensitivity and high specificity, and can quickly and efficiently detect PEDV without strict control of the operating environment. The LAMP primer composition prepared as a kit has the advantages of high efficiency and reliability, simple and fast operation, convenient carrying and low detection cost, and can be used for early diagnosis of PEDV.

[0008] In order to achieve the above-mentioned purpose, in a first aspect, the present application provides a LAMP primer composition for detecting porcine epidemic diarrhea virus, which comprises an external primer pair, an internal primer pair and a loop primer pair; wherein, The outer primer pair comprises a forward primer F3 and a reverse primer B3; The inner primer pair comprises a forward primer FIP and a reverse primer BIP; The loop primer is a loop reverse primer LB; The forward primer F3 has a nucleotide sequence as shown in SEQ ID NO: 1; The reverse primer B3 has a nucleotide sequence as shown in SEQ ID NO: 2; The forward primer FIP has a nucleotide sequence as shown in SEQ ID NO: 3; The reverse primer BIP has a nucleotide sequence as shown in SEQ ID NO: 4; The loop reverse primer LB has a nucleotide sequence as shown in SEQ ID NO: 5.

[0009] In a second aspect, the present application provides a use of the LAMP primer composition as described in the present application in the preparation of a product for detecting porcine epidemic diarrhea virus.

[0010] In a third aspect, the present application provides a LAMP kit for detecting porcine epidemic diarrhea virus, the kit comprising the LAMP primer composition as described in the present application and a dye.

[0011] In a fourth aspect, the present application provides a method for detecting porcine epidemic diarrhea virus, the method comprising: S1, extracting RNA of a sample to be tested as a to-be-tested RNA; S2, using the LAMP primer composition as described in the present application or the LAMP kit as described in the present application to perform a LAMP reaction with the to-be-tested RNA as a template; S3, determining a result of the LAMP reaction.

[0012] The inventors of the present application found in the research process that the LAMP detection method is a relatively new method, which relies on Bst DNA polymerase to realize the self-circulating strand displacement of nucleic acid. Compared with the traditional fluorescent quantitative PCR, LAMP not only has high sensitivity and specificity, short detection time, low cost, but also is more convenient because it does not need expensive and complex instruments. LAMP has great advantages in diagnosing viruses and other pathogens: it has extremely high sensitivity and specificity, and even a small amount of viral genetic material can be accurately detected; fast results, universality suitable for various types of samples, ease of use and cost-effectiveness further improve its diagnostic utility. It has been proven that LAMP is very valuable for virus monitoring and epidemic control, especially in resource-limited situations, it can achieve timely and reliable detection; it has been widely used to detect various pathogens such as influenza, classical swine fever and foot-and-mouth disease. In addition, LAMP amplicons can be visualized by agarose gel electrophoresis and ethidium bromide staining; signal detection requires professional equipment or observation of color change with the naked eye using fluorescent dyes; pH-sensitive neutral red color developers are expected to enhance the contrast of color change, providing potential for practical applications. However, the existing LAMP method for detecting PEDV has obvious non-specificity, is easily interfered and prone to false positives in the detection process of domestic PEDV mutant strains, and cannot meet the detection and early diagnosis needs of domestic PEDV.

[0013] Based on this, the inventors of the present application carefully designed the specific primer set sequence by taking the PEDV conserved region N gene (GenBank No. MW981424.1) stored in the National Center for Biotechnology Information (NCBI) as the target sequence, obtained the LAMP primer composition of the present application for detecting PEDV, which can effectively cover possible mutant strains of domestic PEDV, can detect all PEDV mutants in China at present, and has wide coverage. In particular, the LAMP primer composition of the present application has no reaction with pathogens other than PEDV and will not cause false positives, and has higher specificity.

[0014] In addition, the present application integrates and optimizes the LAMP reaction, so that the detection limit of detecting PEDV reaches or approaches the limit value of LAMP technology, and can be used for early diagnosis of PED, and has the advantages of high efficiency, reliability, accuracy, flexible detection, wide practicality, no need for expensive and complex instruments, simple and fast operation, convenient transportation and carrying at room temperature, and is suitable for various detection environments.

[0015] The LAMP primer composition of the present application can be used for clinical detection, and has passed the test of positive and negative samples of clinical sick pigs, indicating that the LAMP primer composition of the present application can be used for developing a PEDV clinical detection kit or a rapid detection device, and provides a very valuable primer design for developing an instant detection product of PEDV in the future. The LAMP primer composition of the present application not only greatly shortens the research and development cycle of the instant detection product, but also greatly reduces the time, manpower and trial and error costs. Moreover, the LAMP primer composition can be applied to the laboratory detection of the pathogenesis of PEDV or the clinical detection of PEDV-infected sick pigs, and has a wide application prospect and economic benefits.

[0016] Other features and advantages of the present application will be described in detail in the following specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0017] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, and are used together with the following specific embodiments to explain the present application, but do not constitute a limitation on the present application. In the drawings: Figure 1 is a fluorescence curve result graph of the sensitivity of the LAMP primer composition Set-1 in Example 2 to detect 100 copies and 200 copies of PE1-PEDV plasmid; Figure 2 is a fluorescence curve result graph of the sensitivity of the LAMP primer composition Set-2 in Example 2 to detect 100 copies and 200 copies of PE1-PEDV plasmid; Figure 3 is a fluorescence curve result graph of the sensitivity of the LAMP primer composition Set-3 in Example 2 to detect 100 copies and 200 copies of PE1-PEDV plasmid; Figure 4 is a fluorescence curve result graph of the sensitivity of the LAMP primer composition Set-4 in Example 2 to detect 100 copies and 200 copies of PE1-PEDV plasmid; Figure 5 is a detection capability result graph of the LAMP reaction at 60, 70, 80 plasmid copy numbers in Example 3; Figure 6 is a detection capability result graph of the LAMP reaction at 90, 100, 200 plasmid copy numbers in Example 3; Figure 7 is a result graph of 20 repeated experiments of the LAMP reaction at 70 copy numbers in Example 3; Figure 8 is a result graph of the LAMP method in Example 5 to detect 10 0 , 10 1 , 10 2 , 103 ,10 4 ,10 5 ,10 6 The peak time of detection of 10 Figure 9 is the fluorescence curve result chart of detection of 10 0 ,10 1 ,10 2 ,10 3 plasmid copies using the fluorescent quantitative PCR in Example 5; Figure 10 is the fluorescence curve result chart of detection of 10 0 ,10 1 ,10 2 ,10 3 plasmid copies using the LAMP method in Example 5; Figure 11 is the fluorescence curve result chart of detection of 10 4 ,10 5 ,10 6 plasmid copies using the fluorescent quantitative PCR in Example 5; Figure 12 is the fluorescence curve result chart of detection of 10 4 ,10 5 ,10 6 plasmid copies using the LAMP method in Example 5. DETAILED DESCRIPTION

[0018] The specific embodiments of the present application are described in detail below. It should be understood that the detailed description and specific examples described herein are intended for purposes of illustration only and are not intended to limit the present application.

[0019] The endpoints of the ranges and any values disclosed herein are not limited to the precise values stated. The endpoints of the ranges and the values are approximate values which are understood to encompass values near the recited ones. For numeric ranges, the endpoints between the various ranges, the endpoints between the various ranges and the individual point values, and the individual point values can be combined to create one or more new numeric ranges which are to be considered as being specifically disclosed herein.

[0020] In a first aspect, the present application provides a LAMP primer composition for detecting porcine epidemic diarrhea virus, the LAMP primer composition comprising an outer primer pair, an inner primer pair and a loop primer pair; wherein, the outer primer pair comprises a forward primer F3 and a reverse primer B3; the inner primer pair comprises a forward primer FIP and a reverse primer BIP; The loop primer is a loop reverse primer LB; The forward primer F3 has a nucleotide sequence as shown in SEQ ID NO: 1. The reverse primer B3 has a nucleotide sequence as shown in SEQ ID NO: 2. The forward primer FIP has a nucleotide sequence as shown in SEQ ID NO: 3. The reverse primer BIP has a nucleotide sequence as shown in SEQ ID NO: 4. The loop reverse primer LB has a nucleotide sequence as shown in SEQ ID NO: 5.

[0021] SEQ ID NO: 1 GAGCCACTTCGAAAGAACGT SEQ ID NO: 2 CACGAACAGCCACATTACCA SEQ ID NO: 3 CCGAAGCAAGCTGCTACGCTAAAGACATCCCAGAGTGGAGG SEQ ID NO: 4 TGATGCCTCAGGCTATGCTCAGCCAAAGAGCAATGCTGCAAC SEQ ID NO: 5 ATCGCCAGTTTAGCACCAAAT In the present application, the LAMP primer composition includes DNA molecules having the same function as the described nucleotide sequences after substitution and / or deletion and / or addition of one or several nucleotides of the primer sequences of the forward primer F3, the reverse primer B3, the forward primer FIP, the reverse primer BIP and the loop reverse primer LB.

[0022] In the present application, the primer composition targets the N gene of porcine epidemic diarrhea virus.

[0023] In the present application, the molar concentration ratio of the external primer pair, the internal primer pair and the loop primer pair in the LAMP primer composition is 1:5-8:2-4, and it can be understood that the forward primer and the reverse primer of each of the external primer pair, the internal primer pair and the loop primer pair usually adopt the same or approximately the same molar amount, and exemplarily, the molar ratio of the forward primer and the reverse primer of each of the external primer pair, the internal primer pair and the loop primer pair is 1:0.9-1.1.

[0024] In a second aspect, the present application provides use of the LAMP primer composition as described in the present application in the preparation of a product for detecting porcine epidemic diarrhea virus.

[0025] In the present application, the product can be a reagent or a rapid detection tool, etc., any detection form common in the art.

[0026] In a third aspect, the present application provides a LAMP kit for detecting porcine epidemic diarrhea virus, the kit comprising the LAMP primer composition described in the present application and a dye.

[0027] In the present application, the LAMP kit can also contain a container containing the LAMP primer composition, enzymes for performing amplification reactions, buffers, and specific probes, etc., components of the LAMP kit commonly used in the art.

[0028] In the present application, the dye is a fluorescent dye and / or a colorimetric dye, preferably a fluorescent dye.

[0029] In the present application, the fluorescent dye can be a fluorescent dye commonly used in the art suitable for LAMP kits, and preferably the fluorescent dye is selected from one or more of hydroxynaphthol blue, calcein, Sybr Green, EvaGreen, and Syto.

[0030] In the present application, by integrating and optimizing the LAMP reaction, the enzymes (complex enzyme preparation) and fluorescent dyes used for LAMP reaction can be in the form of freeze-dried microspheres.

[0031] In the LAMP reaction system, the purpose of the buffer is to provide an optimal enzyme reaction condition for the enzyme preparation. It can be understood that the buffer can be selected from, but not limited to, Tris-HCl buffer with a concentration of 15-60 mmol / L and a pH of 8.0-8.8.

[0032] In a third aspect, the present application provides a detection method for porcine epidemic diarrhea virus, the detection method comprising: S1, extracting RNA of a sample to be tested as a to-be-tested RNA; S2, using the LAMP primer composition described in the present application or the LAMP kit described in the present application to perform a LAMP reaction with the to-be-tested RNA as a template; S3, determining the results of the LAMP reaction product.

[0033] In the present application, a person skilled in the art can use a commercial DNA extraction kit to extract DNA from the sample to be tested, or use conventional technical means in the art to extract DNA from the sample to be tested.

[0034] In the present application, in step S1, the sample to be tested is a secretion of a pig, such as a pig nasopharyngeal swab, saliva, nasal discharge, urine, sweat, and the like, and is preferably a pig anal swab.

[0035] In the present application, in step S2, the conditions of the LAMP reaction include a temperature of 60-70°C, specifically 60°C, 62°C, 64°C, 66°C, 68°C, 70°C, or any value between the above two values; and a time of 20-40 min, specifically 20 min, 25 min, 30 min, 35 min, 40 min, or any value between the above two values.

[0036] In the present application, in step S3, the method for determining the result is to test the fluorescence value of the product of the LAMP reaction.

[0037] Specifically, the LAMP reaction system can be established in the following manner: LAMP reaction freeze-dried microspheres (containing a complex enzyme preparation and a fluorescent dye), 10-fold concentrated LAMP premixed primers 0.5-5 μL (containing 2 μM of each of forward primer F3 and reverse primer B3, 16 μM of each of forward primer FIP and reverse primer BIP, and 4 μM of loop reverse primer LB), 16-20 μL of virus DNA to be tested or virus-containing lysate, or 16-20 μL of DNAse-free distilled water. The total volume of the LAMP reaction system is 20-25 μL.

[0038] The present application will be described in detail below by way of examples.

[0039] In the following examples, the reagents and raw materials used are all conventional commercially available products unless otherwise specified.

[0040] Example 1 Primer design: A LAMP primer composition (hereinafter referred to as Set-1) including an external primer pair, an internal primer pair, and a loop primer pair was designed using the PEDV conserved region N gene (GenBank No. MW981424.1) stored in the National Center for Biotechnology Information (NCBI) as a target sequence, The external primer pair includes an external forward primer F3 and an external reverse primer B3, the internal primer pair includes an internal forward primer FIP and an internal reverse primer BIP, and the loop primer includes a loop reverse primer LB; The nucleotide sequence of the external forward primer F3 is shown in SEQ ID NO: 1; The nucleotide sequence of the outer reverse primer B3 is shown as SEQ ID NO: 2; The nucleotide sequence of the inner forward primer FIP is shown as SEQ ID NO: 3; The nucleotide sequence of the inner reverse primer BIP is shown as SEQ ID NO: 4; The nucleotide sequence of the loop reverse primer LB is shown as SEQ ID NO: 5.

[0041] SEQ ID NO: 1 GAGCCACTTCGAAAGAACGT SEQ ID NO: 2 CACGAACAGCCACATTACCA SEQ ID NO: 3 CCGAAGCAAGCTGCTACGCTAAAGACATCCCAGAGTGGAGG SEQ ID NO: 4 TGATGCCTCAGGCTATGCTCAGCCAAAGAGCAATGCTGCAAC SEQ ID NO: 5 ATCGCCAGTTTAGCACCAAAT A second set of comparative LAMP primer compositions (hereinafter referred to as Set-2) were designed autonomously, and the LAMP primer compositions of the outer forward primer, the outer reverse primer, the inner forward primer, the inner reverse primer, the loop forward primer and the loop reverse primer are shown as SEQ ID NO: 6-11.

[0042] SEQ ID NO: 6 GGAGGAGAATTCCCAAGG SEQ ID NO: 7 AAGAGTCCGCTAGCTCAC SEQ ID NO: 8 TTCCGCATCTCCAAAATTTTTGAAGGCGAAAATAGCGTAGCAG SEQ ID NO: 9 TGTTGATGCCTCAGGCTATGCACAGCCACATTACCACCA SEQ ID NO: 10 CCCTGGGTCCGAAGCAA SEQ ID NO: 11 AGCACCAAATGTTGCAGCA A second set of comparative LAMP primer compositions (hereinafter referred to as Set-3) were designed autonomously, the LAMP primer compositions of the outer forward primer, the outer reverse primer, the inner forward primer, the inner reverse primer, the loop forward primer and the loop reverse primer are shown in SEQ ID NO: 12-17.

[0043] SEQ ID NO: 12 AATCCAGGGCCACTTCGA SEQ ID NO: 13 GCTAAACTGGCGATCTGAGC SEQ ID NO: 14 AGCTGCTACGCTATTTTCGCCCTTGGAACGTGACCTCAAAGACA SEQ ID NO: 15 GGACCCAGAGGGGGCTTCAATTTTAGCCTGACGCATCAACAC SEQ ID NO: 16 TTGGGAATTCTCCTCCACTCTG SEQ ID NO: 17 TGGAGATGCGGAATTTGTCG A third set of comparative LAMP primer compositions (hereinafter referred to as Set-4) were designed autonomously, the LAMP primer compositions of the outer forward primer, the outer reverse primer, the inner forward primer, the inner reverse primer, the loop forward primer and the loop reverse primer are shown in SEQ ID NO: 18-23.

[0044] SEQ ID NO: 18 GAGCCACTTCGAAAGAACGT SEQ ID NO: 19 CACGAACAGCCACATTACCA SEQ ID NO: 20 CCGAAGCAAGCTGCTACGCTAAAGACATCCCAGAGTGGAGG SEQ ID NO: 21 TTGATGCCTCAGGCTATGCCCCCAAAGAGCAATGCTGCAAC SEQ ID NO: 22 AGATCGCCAGTTTAGCACCA The sequences of the above primer sets were synthesized and purified by a primer synthesis company.

[0045] Example 2 Sensitivity test 1. The experimental steps of LAMP reaction are as follows: (1) Before the experiment, prepare the following reagents: Prepare 10-fold concentrated primer mixture according to Table 1 and freeze at -20°C; Table 1 Composition of 10-fold concentrated primer mixture and 1-fold concentrated primer working solution

[0046] LAMP reaction freeze-dried microspheres are DryMicro RT-LAMP Master Mix products from Genuin Biotechnologies LLC (a subsidiary of Hefei Shangben Biotechnology Co., Ltd.) (website: https: / / www.genuinbiotech.com / product-page / drymicro-rt-lamp-master-mix#Product Information), which contain LAMP reaction complex enzyme preparation and fluorescent dye SYBR GREEN I.

[0047] (2) Thaw the 10-fold concentrated primer mixture on ice, mix well, centrifuge, and then prepare the LAMP reaction system according to Table 2, wherein the amount of LAMP reaction freeze-dried microspheres in each 20 μL LAMP reaction system is 1.

[0048] Table 2 LAMP reaction system

[0049] Mix the above reaction components well, centrifuge, adjust the program of the constant temperature PCR instrument or traditional fluorescent quantitative PCR instrument to 70°C, and put the above mixed PCR tube into the PCR instrument. After 30 min of reaction, the results of PCR reaction can be read from the fluorescence curve displayed on the screen of the PCR instrument or the Ct value given by the software.

[0050] 2. The experimental steps of sensitivity test are as follows: The pig anal swab sample (50 μL sample was sucked into 200 μL virus lysate for lysis) (collected from a pig farm in Guangdong Province), the PE1-PEDV 100 copy standard plasmid and the PE1-PEDV 200 copy standard plasmid provided in Example 1 were mixed, and were added into the LAMP reaction system containing the LAMP primer composition Set-1, Set-2, Set-3 and Set-4 provided in Example 1 (specifically shown in Table 2) to react, the reaction temperature was constant at 70°C, the reaction time was 30 min, and the fluorescence curve (fluorescent dye was contained in the freeze-dried microspheres, constant temperature nucleic acid detection instrument, and the fluorescence analysis results were read) analysis was carried out at the same time, which was used to detect the sensitivity of the four groups of LAMP primer compositions, and the results are shown in Figures 1-4 .

[0051] In the formula, the X axis represents the detection period (time, in min), the Y axis represents the fluorescence intensity of SYBR GREEN I, and Ct represents the threshold time when the signal exceeds the noise.

[0052] The results shown in Figures 1-4 show that the LAMP primer composition Set-1 for detecting PEDV designed in the application has a faster peak time in the LAMP reaction than the other three groups of primer composition sequences designed by the applicant, which indicates that the LAMP primer composition Set-1 has the fastest amplification, the detection rate is 100%, and the sensitivity is higher than that of the other three groups of primer composition sequences.

[0053] Example 3 Determination of limit of detection (LoD) This example is to study the lower limit of detection of the LAMP primer composition.

[0054] The concentration of the PE1-PEDV plasmid provided in Example 1 was gradually diluted to 200, 100, 90, 80, 70 and 60 copies, and 5 independent experimental repetitions were carried out (5 parallel experiments were carried out for each concentration group, and the positive detection rate was calculated = positive results / 5 x 100%) to ensure the reliability and consistency of the results; the specific results are shown in Figures 5-7 and Table 3.

[0055] Table 3 Positive detection rate analysis based on PE1-PEDV plasmid concentration

[0056] As shown in Figure 5 A, when the target PE1-PEDV plasmid concentration is 60 copies, the positive detection rate is 60%; and as shown in Figure 7As shown, 20 repeated experiments were carried out at 70 copies, and the positive rate of 20 LAMP reactions was 100%>95%, indicating that the detection limit of the LAMP primer combination of the present application was 70 copies / reaction.

[0057] Example 4 Potential pathogenic microorganism interference experiment The pathogenic microorganisms that may affect the LAMP detection of PEDV in clinic (see Table 4) were mixed with the lysis solution containing the pig anal swab sample (collected from a pig farm in Guangdong Province) respectively (50 μL sample was taken into 200 μL lysis solution for lysis), and then 1-fold detection limit concentration (1xLoD was 70 copies / μL), 2-fold detection limit concentration (2xLoD was 140 copies / μL) and 5-fold detection limit concentration (5xLoD was 350 copies / μL) of PE1-PEDV provided in Example 1 were added respectively as experimental groups; at the same time, the pathogenic microorganisms shown in Table 4 were mixed with the lysis solution containing the pig nasopharyngeal swab sample without adding PE1-PEDV as a negative control group (NTC); the mixed solutions of the experimental groups and the negative control group were added into the LAMP reaction system containing the LAMP primer combination Set-1 in Example 1 (the system composition is shown in Table 2), and the reaction was carried out at 70°C for 30 min, and each experiment was repeated for 3 times, and the specific results are shown in Table 4.

[0058] Table 4 List of potential pathogenic microorganisms affecting the LAMP detection of PEDV and detection results

[0059] As can be seen from the experimental results in Table 4, in the presence of pathogenic microorganisms without PEDV, the PEDV detection results were all negative, indicating that the LAMP primer combination for detecting PEDV designed by the present application had high specificity to Set-1, and in the presence of pathogenic microorganisms and PEDV, the detection results of PEDV were all positive, indicating that the LAMP primer combination for detecting PEDV designed by the present application was not interfered by other pathogenic microorganisms, and the LAMP primer combination for detecting PEDV designed by the present application was not interfered by the pathogenic microorganisms that the sick pigs might be infected with.

[0060] Example 5 The LoD of the LAMP primer combination Set-1 for detecting PEDV provided in Example 1 in the LAMP reaction was compared with the cycle threshold (cycle quantification, Cq) of the gold standard fluorescent quantitative PCR, and 10 0 -10 6The LAMP method used the LAMP primer combination Set-1 provided in Example 1 and the LAMP reaction system and steps described in Example 2, and the fluorescent quantitative PCR used a PEDV fluorescent PCR detection kit (purchased from Beijing Tianntai Biotechnology Co., Ltd.); the specific results are shown in Table 5. Figures 8-12 and Table 5.

[0061] The Cq value represents the number of cycles at which the fluorescent signal crosses a pre-defined threshold (limit value) above the background noise, indicating that the target DNA or RNA has been amplified to a point that can be reliably detected.

[0062] Table 5

[0063] The LAMP primer combination provided by the present application can make the LoD of the LAMP reaction reach or approach the limit value of the LAMP technology, i.e., 70 genome copies / reaction.

[0064] From Figures 8-12 From the comparison results, PCR showed higher sensitivity and specificity at all copy number levels, although the Ct value of LAMP was unstable at low copy numbers (1 copy, 10 1 copies), but from 10 2 copies, the LAMP reaction could stably detect all positive samples, and its detection ability was comparable to that of PCR. Compared with the Cq (or Ct) of the gold standard fluorescent quantitative PCR, the Cq value of the fluorescent quantitative PCR at 100 genome copies / reaction was 34 cycles, which was very close to the limit value Cq (or Ct) of the gold standard fluorescent quantitative PCR, 35 cycles, further indicating that the LAMP primer combination Set-1 of the present application had high sensitivity for PEDV detection.

[0065] Application Example 1 The qPCR and LAMP detection were simultaneously performed on 69 PEDV clinical positive samples and 73 negative samples (collected from a pig farm in Guangdong Province).

[0066] qPCR detection: 200 μL of the sample was subjected to nucleic acid extraction to obtain 50 μL of nucleic acid, and finally 1 μL of nucleic acid was added to the qPCR system for reaction, and the negative and positive results were counted, and the fluorescent quantitative PCR used a PEDV detection kit (purchased from Beijing Tianntai Biotechnology Co., Ltd.); LAMP detection, 50 μL sample was taken and added to 200 μL lysis solution for lysis, 19 μL lysis product was taken and added to the reaction system for reaction, negative and positive results were counted, LAMP method used LAMP primer composition Set-1 provided in Example 1 and LAMP reaction system and steps described in Example 2, results were shown in Table 6.

[0067] Since the used samples were retrospective clinical samples, virus nucleic acid in the samples might have been degraded, thus part of the negative results might be caused by the above reason.

[0068] Table 6 Comparison of LAMP and qPCR results of all clinical samples

[0069] From Table 6, it can be seen that LAMP primer composition Set-1 provided by the present application passed the clinical detection and can be applied to the development of IVD products.

[0070] The above describes the preferred embodiments of the present application, but the present application is not limited to the specific details in the above embodiments, within the technical concept scope of the present application, the technical solutions of the present application can be variously modified, and these simple modifications all belong to the protection scope of the present application.

[0071] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined by any suitable way without contradiction, in order to avoid unnecessary repetition, the present application will not further describe various possible combination ways.

[0072] In addition, various different embodiments of the present application can also be combined arbitrarily, as long as it does not deviate from the technical concept of the present application, it should also be considered as the disclosed content of the present application.

Claims

1. A LAMP primer composition for detecting porcine epidemic diarrhea virus, comprising an outer primer pair, an inner primer pair and a loop primer pair; wherein, the outer primer pair comprises a forward primer F3 and a reverse primer B3; the inner primer pair comprises a forward primer FIP and a reverse primer BIP; the loop primer is a loop reverse primer LB; characterized in that, the forward primer F3 has a nucleotide sequence as shown in SEQ ID NO: 1; the reverse primer B3 has a nucleotide sequence as shown in SEQ ID NO: 2; the forward primer FIP has a nucleotide sequence as shown in SEQ ID NO: 3; the reverse primer BIP has a nucleotide sequence as shown in SEQ ID NO: 4; the loop reverse primer LB has a nucleotide sequence as shown in SEQ ID NO:

5.

2. The LAMP primer composition according to claim 1, characterized by the LAMP primer composition comprises DNA molecules having the same function as the described nucleotide sequences after substitution and / or deletion and / or addition of one or several nucleotides to the primer sequences of the forward primer F3, the reverse primer B3, the forward primer FIP, the reverse primer BIP and the loop reverse primer LB.

3. The LAMP primer composition according to claim 1 or 2, characterized in that, the primer composition targets the N gene of porcine epidemic diarrhea virus.

4. The LAMP primer composition according to any one of claims 1 to 3, wherein the molar concentration ratio of the outer primer pair, the inner primer pair and the loop primer pair in the LAMP primer composition is 1:5-8:2-4. 5.Use of the LAMP primer composition according to any one of claims 1-4 in the preparation of a product for detecting porcine epidemic diarrhea virus.

6. A LAMP kit for detecting porcine epidemic diarrhea virus, characterized by, the kit comprises the LAMP primer composition according to any one of claims 1-4 and a dye.

7. The LAMP kit according to claim 6, characterized in that, the dye is a fluorescent dye and / or a colorimetric dye, preferably a fluorescent dye; preferably, the fluorescent dye is selected from one or two or more of hydroxynaphthol blue, calcein, Sybr Green, EvaGreen and Syto.

8. A method for detecting porcine epidemic diarrhea virus, characterized by, the detection method comprises: S1, extracting RNA of a sample to be tested as a to-be-tested RNA; S2, using the LAMP primer composition according to any one of claims 1-4 or the LAMP kit according to claim 6 or 7 to perform a LAMP reaction with the to-be-tested RNA as a template; S3, determining the result of the product of the LAMP reaction.

9. The detection method according to claim 8, characterized in that, In step S1, the sample to be tested is a secretion of a pig, preferably an anal swab of a pig.

10. The detection method according to claim 8 or 9, characterized in that, In step S2, the conditions of the LAMP reaction include a temperature of 60-70℃ and a time of 20-40 min; In step S3, the method for determining the result is to test the fluorescence value of the product of the LAMP reaction.

Images