Ghfba1 gene for regulating fruit branch angle of upland cotton, indel site and application thereof
By identifying the GhFBA1 gene and developing molecular markers through genome-wide association analysis, the problems of unstable genetic localization and high cost of molecular marker detection in the study of fruit branch angle in upland cotton were solved. This enabled effective regulation of fruit branch angle and optimization of cotton plant type, thereby improving breeding efficiency and mechanized harvesting efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GANSU AGRI UNIV
- Filing Date
- 2025-08-22
- Publication Date
- 2026-06-26
Smart Images

Figure CN120924597B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a GhFBA1 gene, an Indel site, and their applications that regulate the angle between fruiting branches of upland cotton. Background Technology
[0002] Cotton, as an important economic crop, plays a vital role in the agricultural economy through the production of its fiber, edible oil, and protein. The Northwest Inland Cotton-Growing Region has become the core area for cotton production, holding an absolute advantage in both yield and planting area. With the widespread adoption of mechanized harvesting technology, optimizing cotton plant structure has become particularly important, with the fruiting branch angle being a key trait affecting plant compactness, planting density, and mechanized harvesting efficiency.
[0003] Current research on fruit branch angle (FBA) in upland cotton still has many shortcomings. Regarding genetic mapping, although some studies have identified several QTLs controlling FBA in different populations, the explanatory power of these loci is generally low, and they lack cross-environmental stability verification, making them difficult to directly apply to breeding practices. While genome-wide association studies have identified some significantly associated SNP loci and candidate genes, the vast majority of these candidate genes remain only at the bioinformatics prediction stage, lacking necessary functional validation experiments.
[0004] In the development of molecular markers, existing research mainly relies on SNP markers. Although SNPs have the advantage of abundant quantity, they suffer from problems such as high detection costs and insufficient stability in practical breeding applications. In contrast, Indel markers have the advantages of simple detection, high polymorphism, and good stability, but there are no relevant reports on their use in cotton fruiting branch angle research.
[0005] Therefore, discovering the key genes that regulate the angle between cotton fruiting branches and developing stable and reliable molecular markers are of great significance for promoting molecular breeding of cotton plant type. Summary of the Invention
[0006] The purpose of this invention is to provide a GhFBA1 gene, an Indel site, and their applications for regulating the fruiting branch angle in upland cotton, thereby addressing the problems existing in the prior art. This invention demonstrates that reducing or inhibiting the expression of the GhFBA1 gene can significantly increase the fruiting branch angle in upland cotton, providing a clear molecular target for cotton plant architecture improvement. The specific Indel site (D04_5662667) within the GhFBA1 gene and its haplotypes (Hap1 and Hap2) show a significant correlation with the fruiting branch angle and can be used as molecular markers for rapid screening of cotton germplasm resources with ideal fruiting branch angles.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] This invention provides the application of the GhFBA1 gene or related biological materials in regulating the fruit branch angle of upland cotton, reducing or inhibiting the expression of the GhFBA1 gene in upland cotton, thereby increasing the fruit branch angle of the upland cotton; the nucleotide sequence of the GhFBA1 gene is as described in SEQ ID NO.5.
[0009] Optionally, the relevant biological materials include a silencing vector for the GhFBA1 gene and a recombinant microorganism containing the silencing vector.
[0010] Optionally, the upland cotton includes Ji Mian 8.
[0011] The present invention also provides a method for increasing the fruiting branch angle of upland cotton, including the step of reducing or inhibiting the expression of the GhFBA1 gene in the upland cotton; the nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.5.
[0012] Optionally, reducing or inhibiting the expression of the GhFBA1 gene in the upland cotton includes silencing the GhFBA1 gene using the VIGS vector system.
[0013] Optionally, the upland cotton includes Ji Mian 8.
[0014] This invention also provides a reagent for detecting molecular markers related to the fruit branch angle of upland cotton in identifying the size of the fruit branch angle of upland cotton. The molecular marker is a "T" deletion variation at position 773 of the GhFBA1 gene, as shown in SEQ ID NO.5. If the GhFBA1 gene of the upland cotton has this deletion variation, the fruit branch angle of the upland cotton is large; if the GhFBA1 gene of the upland cotton does not have this deletion variation, the fruit branch angle of the upland cotton is small.
[0015] Optionally, the detection reagent includes primers for amplifying the GhFBA1 gene.
[0016] The present invention also provides a method for identifying the size of the fruiting branch angle of upland cotton, comprising amplifying the GhFBA1 gene of the upland cotton, sequencing the amplified product, and determining whether the fruiting branch angle of the upland cotton is large if there is a "T" deletion at position 773 of the nucleotide sequence of the GhFBA1 gene, and small if there is no "T" deletion at position 773 of the nucleotide sequence of the GhFBA1 gene; the nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.5.
[0017] Optionally, the amplification primers for the GhFBA1 gene are shown in SEQ ID NO.4-5.
[0018] The present invention discloses the following technical effects:
[0019] This invention identified GhFBA1, a key gene regulating the fruiting branch angle in upland cotton, through genome-wide association analysis (GWAS), and revealed its important role in cotton plant architecture regulation. Experiments confirmed that reducing or inhibiting GhFBA1 gene expression significantly increases the fruiting branch angle in upland cotton, providing a clear molecular target for cotton plant architecture improvement.
[0020] Furthermore, this invention also clarified the significant association between the specific Indel site (D04_5662667) and its haplotypes (Hap1 and Hap2) within the GhFBA1 gene and the fruit branch angle, which can be used as molecular markers for rapid screening of cotton germplasm resources with ideal fruit branch angles, significantly improving breeding efficiency.
[0021] The implementation of this invention can effectively optimize cotton plant structure, increase the fruiting branch angle to a suitable range, thereby improving light penetration and ventilation in cotton fields, reducing boll shedding rate, and enhancing mechanized harvesting efficiency. Through marker-assisted selection, new cotton varieties adapted to different planting needs can be precisely bred, providing important technical support for molecular design breeding and mechanized production of upland cotton, and possessing broad prospects for agricultural application. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 Manhattan plot and QQ plot for correlation analysis of fruit branch angle of BLUP upland cotton in five different planting environments;
[0024] Figure 2 This is a diagram showing the linkage disequilibrium analysis of significant SNP sites on chromosomes A06(A) and D04(B).
[0025] Figure 3 The distribution frequency of different haplotypes of the GhFBA1 gene in two varieties with extreme fruit branch angles;
[0026] Figure 4 Box plots showing the fruit branch angle phenotypes corresponding to different haplotypes of the GhFBA1 gene;
[0027] Figure 5 The expression level of the GhFBA1 gene in the fourth, fifth, and sixth fruit branches of the extreme fruit branch angle variety;
[0028] Figure 6 The images show the relevant vector maps used for gene silencing, where A is the pCloneEZ-TOPO cloning vector map and B is the CLCrV vector map.
[0029] Figure 7 The results are for the amplification of the target fragment and the PCR identification of positive bacterial cultures.
[0030] Figure 8 Detection of GhFBA1 silencing efficiency;
[0031] Figure 9 Phenotypic analysis of GhFBA1 silent plants, where A represents the fruit branch angle phenotype of silent plants and B represents the phenotypic statistical analysis of silent plants;
[0032] Figure 10 The GhFBA1 protein model was constructed, with the left image showing the unmutated protein and the right image showing the Indel-deficient protein.
[0033] Figure 11 The results are for validation of the Indel site within the GhFBA1 gene, where TGA is the stop codon. Detailed Implementation
[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0039] Example 1: Genome-wide association analysis of the fruit-branch angle in upland cotton
[0040] 1. Experimental materials and phenotypic identification
[0041] Sixty-nine upland cotton germplasm accessions were selected and planted in 2020 at the Shihezi and Korla experimental stations of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences, the Dunhuang cotton experimental station of the Gansu Academy of Agricultural Sciences, and the Alar experimental station in Xinjiang. These accessions were named SHZ20, KEL20, DH20, and ALE20. In 2021, they were planted at the Shihezi and Korla experimental stations of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences and named SHZ21 and KEL21. These upland cotton germplasm accessions exhibited stable genetic characteristics through self-pollination. After screening, 418 core upland cotton germplasm accessions were finally selected for genome-wide association analysis.
[0042] The angles of the middle fruiting branches (4th, 5th, and 6th fruiting branches) of natural populations of upland cotton germplasm grown in the above six environments were measured, and the average value of the middle fruiting branch angles (FBA) was calculated. 456 The best linear unbiased predictor value (BLUP) of the phenotype was calculated using a mixed linear model, and the generalized heritability was 74.66%.
[0043] 2. Genome-wide association analysis
[0044] Using whole-genome resequencing, 4,452,629 high-quality SNP markers were obtained by screening for MAF ≥ 0.05 and deletion rate ≤ 0.5%. Variance types were annotated using SnpEff software. Subgroups were identified using PCA (VCF2PCACluster), phylogenetic tree (FastME), and Admixture (K = 1–15), with an optimal K = 3. An MLM model using EMMAX software was employed, with population structure as a covariate and a threshold P ≤ 1 × 10⁻⁶. -5 Significantly associated loci were identified. A total of 231 SNPs significantly associated with the fruit branch angle were identified. Based on multiple environmental and BLUP association results, linkage loci significantly associated with the FBA trait were found on chromosomes A06 and D04, indicating the presence of QTLs significantly associated with the FBA trait on chromosomes A06 and D04. Figure 1 Among them, strongly linked blocks exist in the A06 (22.61-23.12Mb) and D04 (5.63-5.79Mb) chromosomal regions. Figure 2 ).
[0045] 3. Functional annotation of candidate genes in genome-wide association analysis
[0046] Significant variant sites were extracted using R language, and significant variant sites located in gene promoters and coding sequences (CDS) were screened using the upland cotton TM-1 genome annotation file as a reference. Further screening on chromosome D04 revealed a variant site (D04_5662667) in the coding region of the GhFBA1 gene.
[0047] Further analysis was conducted to determine whether the variant site led to changes in amino acids, and candidate genes were functionally annotated using the Zhejiang University Upland Cotton TM-1 Genome Database (http: / / cotton.zju.edu.cn / index.htm). The variant site (D04_5662667) within the GhFBA1 gene was ultimately identified as an Indel variant with a p-value of 6.14. This variant site caused premature termination of protein translation (Table 1), suggesting that the variant site within this gene may lead to changes in gene function and thus participate in the regulation of cotton fruiting branch angle.
[0048] Table 1 Functional annotations of internal variant sites in candidate genes
[0049]
[0050] Example 2: Further identification of key genes in the fruit branch angle of upland cotton.
[0051] 1. Candidate gene association analysis
[0052] Based on resequencing data from 418 core upland cotton germplasms, significant variant sites were extracted from the candidate gene GhFBA1, and haplotypes were constructed. Fifty extreme varieties with the largest and smallest fruit branch angles were selected, and the haplotype frequency distribution was analyzed. The phenotypic differences between different haplotypes were assessed using a t-test.
[0053] The results showed that the GhFBA1 gene D04_5662667 was divided into two variant types (Hap1:CA; Hap2:C). Based on the haplotype frequency distribution in the extreme 50° fruit branch angle varieties, it was found that in varieties with a large fruit branch angle of 50°, the frequency of Hap1 in the GhFBA1 gene was 46%, and the frequency of Hap2 was 100%. In varieties with a small fruit branch angle of 50°, the frequency of Hap1 in the GhFBA1 gene was 54%, and the frequency of Hap2 was 0%. Figure 3 ).
[0054] By performing a T-test on the phenotypic values corresponding to haplotypes within the GhFBA1 gene in 418 varieties, it was found that the fruit branch angle increased significantly after the internal locus variation of the GhFBA1 gene compared with the unvaried variety. Figure 4 This indicates that internal mutations in the GhFBA1 gene may have a positive effect on the angle between cotton fruit branches.
[0055] 2. Differences in the expression of candidate genes in extreme varieties
[0056] To further investigate the expression patterns of candidate genes in varieties with extreme fruit branch angles, the fourth, fifth, and sixth fruit branches of the small-angle variety Jimian 8 and the large-angle variety Shan 689 (both provided by Xinjiang Academy of Agricultural Sciences) were selected as experimental materials, and qRT-PCR was used for detection. The expression levels of the target genes were normalized using the housekeeping gene GhActin. The relative expression levels of each tissue were calculated using a 2-1 ratio. -ΔΔCT The method was calculated. Finally, significance testing was performed using SPSS 26.0 software. The primers used in the qRT-PCR assay are as follows:
[0057] qGhFBA1-F: ACGGATTCAGGCATACGGAC, SEQ ID NO.1;
[0058] qGhFBA1-R: GCCTTAGGCGAATCGGGTAT, SEQ ID NO. 2.
[0059] The results showed that the expression of the GhFBA1 gene differed significantly among the fourth, fifth, and sixth fruit branches. Figure 5 This further suggests that it may play an important role in the formation and regulation of the fruit branch angle.
[0060] Example 3: Functional Verification of Key Genes for the Fruit Branch Angle in Upland Cotton
[0061] In this embodiment, to further verify the function of key genes, the silenced fragments of key genes were cloned, and the CLCrV expression vector was constructed. Endogenous gene silencing was performed on the upland cotton variety Jimian 8 with a small angle, and its role in regulating the fruit branch angle of upland cotton was explored.
[0062] 1. Experimental materials
[0063] The test materials were two varieties of upland cotton, Zhongmian 113 and Jimian 8 (small angle), and Shan 689 (large angle), provided by Xinjiang Academy of Agricultural Sciences.
[0064] The VIGS vector systems (CLCrVA, CLCrVB, and CLCrV-ChⅡ) used for gene silencing were donated by the Transgenic Research Group of the Cotton Research Institute, Chinese Academy of Agricultural Sciences. The vectors, such as... Figure 6 As shown.
[0065] 2. Cloning of the target gene silencing fragment
[0066] RNA was extracted from leaves of Zhongmian 113 and reverse transcribed into cDNA. This cDNA was used as a template for amplification. The target gene was amplified using designed specific silencing primers (GhFBA1-F: GACTAGTAGCATTAGTGTTCCTTTTCCACAG, SEQ ID NO.3; GhFBA1-R: AGGCGCGCCACAAGAGGAAGCTTTCCAAGG, SEQ ID NO.4) and Taq 2×PCRMix with Dye V2 premix (containing dye).
[0067] The PCR reaction system was as follows: 10 μL of Taq 2×PCRMix with Dye V2 (dye pius), cDNA template (100 ng / μL) with a final concentration of <500 ng, 1.6 μL of primer-F (2.5 μM), 1.6 μL of primer-R (2.5 μM), and ddH2O to make up to 20 μL.
[0068] The reaction program was set as follows: 94℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 58℃ annealing for 30s, 65℃ extension for 1min, for a total of 30 cycles, and finally 65℃ final extension for 5min.
[0069] After agarose gel electrophoresis, the PCR products were excised and the target fragment was recovered using a DNA purification and recovery kit. The purified product was ligated into the pCloneEZ-TOPO vector (C5866) at room temperature for 5 minutes and transformed into DH5α competent cells. The transformation system was incubated on ice for 30 minutes, heat-shocked at 42°C for 30 seconds, and then added to LB liquid medium with shaking at 37°C for 1 hour. The cells were plated on LB agar plates containing Kan+ and incubated at 37°C. Single colonies were then picked and inoculated into LB liquid medium containing Kan+ and incubated at 37°C for 8 hours. PCR amplification was performed using the bacterial culture as a template, and positive clones were screened by electrophoresis. Plasmids were extracted from the positive bacterial cultures using the AFT Spin PlasmidMin Kit and then sequenced. The results are as follows: Figure 7 Electrophoresis analysis showed that the size of the target band in the recombinant plasmid CLCrV-gene was as expected.
[0070] 3. Transformation with Agrobacterium GV3101
[0071] Take 1 μL of the successfully sequenced CLCrV-gene plasmid and place it in Agrobacterium GV3101 competent cells. After gently mixing, place the cells on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C and 200 rpm for 2 h. Spread the recovered bacterial culture onto solid medium containing 50 ng / μL Kan+ and 25 ng / μL Rif and incubate at 28°C for 2 days. Pick single colonies and incubate overnight at 28°C. PCR is used to confirm positive strains. Then mix the bacterial culture with 50% glycerol at a 1:1 ratio and store at -80°C.
[0072] 4. Virus-induced gene silencing
[0073] Successfully transformed Agrobacterium CLCrV:GhFBA1, CLCrVA, CLCrVB, and CLCrV:GhChⅡ were revived in liquid medium (50 ng / μL Kan+, 25 ng / μL L IF). After revival, the bacterial suspension was expanded and cultured. Once the suspension became turbid, the cells were collected by centrifugation at 6000 rpm for 10 min, and the supernatant was discarded. The bacterial cells were resuspended in MMA resuspension to OD. 600 =1.8, stand in the dark for 3-5 hours. Mix CLCrVB with bacterial suspensions containing CLCrV:GhFBA1, CLCrVA and CLCrV:GhChⅡ at a 1:1 ratio and mix thoroughly.
[0074] Seven days after emergence, healthy and fully expanded cotyledons of the Jimian 8 cotton seedling were selected for the experiment. The cotyledons were punctured on the underside with a needle, and a mixed resuspension was injected into the cotyledons using a 1mL syringe, ensuring complete filling. The plants were then placed in darkness for 24 hours, followed by incubation at 25°C in a light incubator (16 hours light / 8 hours darkness). New leaves were sampled when the young leaves of the CLCrV:GhChⅡ plants began to show yellowing. RNA was extracted from the third true leaf of the silenced plants for positive plant detection, and the silencing efficiency was determined by qRT-PCR. Silent plants with gene expression levels below 0.5 compared to the control plants were transplanted (…). Figure 8 ( ), for use in subsequent trait observation and analysis.
[0075] 5. Phenotypic traits of silent plants
[0076] When comparing the phenotypic performance of silent plants and control plants, it was found that compared with control plants, the growth and development of CLCrV:GhFBA1 silent plants were significantly slower and the fruit branch angle was significantly increased by 8-9°. Figure 9 ).
[0077] Example 4: Functional prediction and validation of Indel markers within the GhFBA1 gene
[0078] 1. Constructing the GhFBA1 protein
[0079] To predict the three-dimensional structure of the protein encoded by the GhFBA1 gene, a model was constructed using SWISS-MODEL (https: / / swissmodel.expasy.org / ). A search using SWISS-MODEL identified 2215 structural templates homologous to the GhFBA1 protein. The template with the highest sequence similarity to the unmodified sequence was A0A2N9GGD6.1.A, with a sequence similarity of 70.52% and a coverage rate of 99%. This template, predicted by AlphaFold v2, is a protein containing a prolyloligopeptidase (POP) catalytic domain, belonging to the serine protease family (S9 family).
[0080] The primary function of POP is to hydrolyze proline residues in oligopeptides, playing a crucial role in biological processes such as protein metabolism, signal transduction, and neural regulation. A model constructed based on this template shows that the GhFBA1 protein possesses a typical β-sheet structure and is highly conserved with the template protein at key functional sites. For the sequence after the Indel mutation, multiple homologous templates were also found, with the highest similarity being 1jt2.1.A, showing a sequence similarity of 12.76% and a coverage of 56%. Despite the low similarity of this template, a three-dimensional model of the variant protein was successfully constructed using the ProMod3 software package. Comparison of the three-dimensional structures of the wild-type and variant proteins revealed that the Indel mutation leads to significant changes in protein structure. Figure 10 Specifically, the secondary structure near the mutation site is distorted, affecting protein folding and stability. Furthermore, the mutation leads to changes in the protein's surface charge distribution, potentially impacting its interactions with other molecules. These results suggest that the Indel mutation may have a significant impact on the function of the GhFBA1 protein.
[0081] 2. Validation of the Indel site within the GhFBA1 gene
[0082] To further confirm the existence of this Indel site, full-length primers for the GhFBA1 gene were designed:
[0083] WGhFBA1-F:TCCCTGAATTTGAGCTGGACT, SEQ ID NO.5;
[0084] WGhFBA1-R: AGTCTCAAAAAGGGTGGGTGT, SEQ ID NO. 6.
[0085] The cDNA of varieties with small fruit branch angles (A971Bt, Luyuan343, Jinmian33 and Jimian8) and varieties with large fruit branch angles (FH682, Xinluzao7, Xinluzao36 and Glacdamian) (all provided by the College of Life Science and Technology of Gansu Agricultural University) was used as templates for PCR amplification, constructed into cloning vectors and sequenced. The sequencing results were compared with DNAMAN 9.0 to determine whether the site actually existed.
[0086] The results showed that amplification analysis of fragments in the Indel region of small-fruit-branch angle varieties (A971Bt, Luyuan343, Jinmian33, and Jimian8) and large-fruit-branch angle varieties (FH682, Xinluzao7, Xinluzao36, and Glacdamian) revealed a single base deletion at 973 bp in the GhFBA1 gene (nucleotide sequence shown in SEQ ID NO.7) of the large-fruit-branch angle varieties, while this deletion was not observed in the small-fruit-branch angle varieties. Figure 11 This deletion results in a frameshift mutation, leading to the premature appearance of the stop codon TGA, which in turn causes premature termination of gene translation. Therefore, this Indel site can serve as a molecular marker associated with the fruit branch angle trait in upland cotton.
[0087] GhFBA1 gene (SEQ ID NO.7):
[0088] ttcttcacttcttcaactatcattctatcttttgcgatctacaaataacatcttggaatgtccaacctttaatatctatatt acacccaccctttttgagactttagactaatcttagattcaatttattagtgaattgtttcaattagactttaggcttacaagtgttcaagcctgttattgttaatctgttgtcagcaATGCTGAATCGTGGAACAAAGTTAAAGGCATGGCATGGACAAAAAAAATACCCGGTTGTGGTCCCAGTTATGTTTGTGGTATCAGTCTCAGTAGCATTAGTGTTCCTTTTCCACAGAAATGATGAAAAACGGATTCAGGCATACGGACTGCCACCGGAGAGAAAATGGAATAGGTTTGAGTCTTTGGTGCAGTTTAATCCAAAAAAGAGAATTCCGGAATGGGACGGATTTGATATGGCAAATACCCGATTCGCCTAAGGCTGTTCTTTTTCTAGCTCATGGATGTAGTGGCAGAGCTGCTAATTTTTGGGATAAGTCCTAAATGTCCTGAATGTG TTGGTTTGCCTGAGGAAAGGCTGCTTGTGCTTCATGCTCTTGCTCGTAAATTTGCTGTCTTGACTATATCAAGTGCAGGGAGGTGCTGGGCATTTGGGGAAGAAAGGTTGATTGTTGAAGATATTATAACATGGTGGGTTAAGAGACAGAACCTTGGAAAGCTTCCTCTTGTGGCTTTGGGGGCCTCTTCTGGTGGGTATTTTGCATCTGCAATTGC TAATGATTTGAAGTTTAGTAGTATTACACTTGTGATTGCTGAAGGATTATTTGATCACATGGACATTAGAGAGGACTATCACCGACCCTTTTTGTGCACATGCCTAAAGATTTACGCAGGCAACAACAAAAAATAACTGAATTCATTGAAGTTTTGAGAAATAAAGGGGTTGATGTTGCAGAGATTGAATGCATGGAGTTGCCTCTGTCACCAACTTTTT TGTTTGATAGAATCCCAGGTCTTGATCAGACTATTTCTGCTACGTTGTTCAACTTATTCAGGGAGAAAGGCTTTGTCGACGAGAATGGGTATATGAAACGGGATGGGCGTGCGACACGTTGGAAAGATGCTCTCCAGGATAGTAAGCCTAATTTGCTAGAAAAGGATTTGGTGCATCCCGTTGA GGAGGAGCTAAATCTTGCATTTGCCTATCATGAAATGACTAGTTTGCAATCTGAAGAGATTTTTAAATGGTTTGAGTCTCATATGGCCTGAacagtactcaattgtgcgacattctcctttctttctgtttgaccaaagtactgactgtcaaaagtgatcgtacatacaactcatcgtaacaa tccctgaatttgagctggact gaattgtttattgcttgaagcttgtcttcaaacaactgaagactaggatgtaaagttactaccttgaaccaaactgcaacatccact (The bold underlined part indicates the Indel variant site. Note: lowercase bases are genomic sequences added outside the gene coding region, and the underlined sequence is the sequence of the matching primer).
[0089] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the GhFBA1 gene or related biological materials in regulating the angle between fruiting branches of upland cotton, characterized in that, In upland cotton, the expression of the GhFBA1 gene is reduced or suppressed, resulting in an increased fruiting branch angle; the nucleotide sequence of the GhFBA1 gene is as described in SEQ ID NO.7; the related biological material is a silencing vector for the GhFBA1 gene and a recombinant microorganism containing the silencing vector.
2. The application according to claim 1, characterized in that, The upland cotton mentioned includes Ji Mian 8.
3. A method for increasing the angle between fruiting branches of upland cotton, characterized in that, The method includes the step of reducing or inhibiting the expression of the GhFBA1 gene in the upland cotton; the nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.
7.
4. The method according to claim 3, characterized in that, Reducing or inhibiting the expression of the GhFBA1 gene in the upland cotton includes silencing the GhFBA1 gene using the VIGS vector system.
5. The method according to claim 3, characterized in that, The upland cotton mentioned includes Ji Mian 8.
6. The application of a detection reagent for molecular markers related to the angle between fruiting branches of upland cotton in identifying the size of the angle between fruiting branches of upland cotton, characterized in that, The molecular marker is a deletion variation of a base "T" at position 973 of the GhFBA1 gene, as shown in SEQ ID NO.
7. If the GhFBA1 gene of the upland cotton has this deletion variation, the fruiting branch angle of the upland cotton is large; if the GhFBA1 gene of the upland cotton does not have this deletion variation, the fruiting branch angle of the upland cotton is small.
7. The application according to claim 6, characterized in that, The detection reagent includes primers for amplifying the GhFBA1 gene.
8. A method for determining the size of the angle between fruiting branches of upland cotton, characterized in that, The process includes amplifying the GhFBA1 gene of the upland cotton, sequencing the amplified product, and determining whether the upland cotton has a large fruiting branch angle if there is a "T" deletion at position 973 of the nucleotide sequence of the GhFBA1 gene; otherwise, the upland cotton has a small fruiting branch angle. The nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.
7.
9. The method according to claim 8, characterized in that, The amplification primers for the GhFBA1 gene are shown in SEQ ID NO.4 and SEQ ID NO.5.
Citation Information
Patent Citations
Cotton fruit branch included angle major gene GhFBA1 and application thereof in regulation and control of cotton plant type
CN117821473A
Application of GhNSRB in regulating early maturing character of upland cotton
CN118726462A