A marker for rapid identification of jujube phyllostine resistance and methods of use and application thereof
By detecting base insertions and deletions in the promoter region of the ZjMAPK2 gene, a rapid method for identifying jujube witches'-broom disease resistance is provided, solving the problem of time-consuming and labor-intensive identification in existing technologies, and achieving efficient and accurate identification of jujube witches'-broom disease resistance and variety screening.
Patent Information
- Application Number
- CN202511245525.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-02
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2045-09-02
AI Technical Summary
The lack of rapid and effective molecular markers for identifying jujube witches' broom disease resistance in existing technologies means that screening and identifying jujube witches' broom disease resistant resources requires an ideal identification environment, large-scale population observation, and years of monitoring, which is time-consuming and labor-intensive.
PCR amplification and sequencing were performed using the promoter regions (114–158 bp and 1267–1309 bp) of the ZjMAPK2 gene. By detecting base insertions and deletions, resistance to jujube witches' broom disease was identified, providing a rapid and accurate identification method.
It enables rapid and low-cost identification of jujube witches'-broom disease resistance under different environments, reduces the workload of identification, improves the accuracy of identification, and supports rapid screening and breeding of resistant varieties.
Smart Images
Figure CN120924707B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and in particular to a marker for rapid identification of resistance to jujube witches' broom disease, as well as its method of use and application. Background Technology
[0002] Jujube (Latin name: *Ziziphus jujuba* Mill.) is an important specialty fruit tree native to my country, also known as date, jujube, thorny date, and thorny date. It belongs to the genus *Ziziphus* of the family Rhamnaceae, and is a deciduous small tree, usually diploid (2n = 24). Zanhuang jujube is the only known naturally occurring triploid variety in my country, with a chromosome set of triploid (3n). Furthermore, researchers have successfully cultivated triploid jujube varieties through hybridization breeding techniques; for example, Yan Fenfen's team obtained more than 80 triploid progeny plants. Homologous tetraploid (4n) types exist in hairy-leaved jujube.
[0003] Jujube is the largest dried fruit tree species in my country, with extremely high economic and nutritional value. It can be eaten fresh or dried. Jujube fruit contains a large amount of fatty acids, sugars, minerals, amino acids, vitamins and polyphenols. According to the "Shennong's Classic of Materia Medica", jujube is warm in nature and sweet in taste, and has the effects of tonifying the spleen and replenishing qi, nourishing blood and calming the mind.
[0004] The bark of a normally growing jujube tree is brown or grayish-brown. It has long branches, short branches, and budless twigs (new shoots) that are smoother than the long branches, purplish-red or grayish-brown, and zigzag-shaped. Each branch has two stipular spines; the longer spine can reach 3 cm in length and is thick and straight, while the shorter spine curves downwards and is 4-6 mm long. The short branches are short and thick, oblong, and emerge from older branches. The current year's twigs are green, drooping, and solitary or clustered in groups of 2-7 on the short branches. Leaves are 3-7 cm long and 1.5-4 cm wide, with a blunt or rounded apex, rarely acute, with a small pointed tip; the base is slightly asymmetrical, nearly rounded, and the margin has rounded serrations. The upper surface is dark green and glabrous, while the lower surface is light green, glabrous or only sparsely pubescent along the veins, with three basal veins. The petiole is 1-6 mm long, or up to 1 cm on long branches, glabrous or sparsely pubescent. The stipular spines are slender and often fall off later.
[0005] Jujube witches' broom, also known as witches' broom disease, is a highly contagious, difficult-to-cure, and highly lethal vascular system infectious disease caused by *Phytophyta jujuba*. It is difficult to avoid in jujube-growing areas and occurs frequently. Treatment is very difficult, and a complete cure is virtually impossible. Infected jujube trees die within about three years, with a mortality rate of nearly 100%. To prevent the spread of the disease, infected trees must be uprooted, making it considered a devastating disease for jujube trees. Jujube trees infected with witches' broom exhibit a series of symptoms, including witches' broom, yellowing, stunting, small leaves, and discolored leaves, along with significant stunted growth and withered branches and leaves. This often leads to the death of the entire tree or large areas of affected trees, severely impacting jujube yield, quality, and the economic benefits for fruit growers.
[0006] For many years, people have been searching for effective ways to control jujube witches' broom disease. Among these methods, screening disease-resistant resources, improving the disease resistance of varieties, and selecting disease-resistant varieties are important approaches to control jujube witches' broom disease. However, traditional methods for identifying resistance to jujube witches' broom disease through natural infection require an ideal environment for identification, extensive population observation, and years of monitoring and identification. This is not only inefficient but also consumes a lot of human, financial, and time resources. Summary of the Invention
[0007] The purpose of this invention is to provide a marker for rapid identification of resistance to jujube witches' broom disease, as well as its method and application, to solve the problem that there is currently no molecular marker closely linked to resistance to jujube witches' broom disease, and that screening for jujube witches' broom disease-resistant resources and breeding jujube witches' broom disease-resistant varieties requires an ideal identification environment, a large number of population observations, and many years of monitoring and identification, which is time-consuming and labor-intensive.
[0008] To achieve the above objectives, this invention provides the application of the ZjMAPK2 gene (sequence number LOC107411280) in the identification of resistance to jujube witches' broom disease. The CDS sequence of the ZjMAPK2 gene is shown in SEQ ID NO.1; the sequence of the promoter is shown in SEQ ID NO.2.
[0009] A marker for rapid identification of resistance to jujube witches'-broom disease is located in the promoter region of the ZjMAPK2 gene. Using sequences from NCBI (https: / / www.ncbi.nlm.nih.gov / ) as a reference, the promoter (first 2000 bp of the CDS sequence) of resistant varieties shows base insertions and mutations in 114–158 bp and base deletions in 1267–1309 bp. In susceptible varieties, at least one homologous ZjMAPK2 gene promoter does not show base insertions or mutations in 114–158 bp and does not show base deletions in 1267–1309 bp.
[0010] Preferably, for the ZjMAPK2 gene promoter on the other homologous chromosome of the susceptible variety, there are two possibilities: either the promoter 114–158 bp and 1267–1309 bp on the other homologous chromosome do not have base insertions or mutations, and the promoter 1267–1309 bp does not have base deletions; or the promoter 114–158 bp on the other homologous chromosome has base insertions or mutations, and the promoter 1267–1309 bp has base deletions.
[0011] Preferably, the base insertion in the ZjMAPK2 gene promoter from 114 to 158 bp includes two locations, one at 122 bp and the other at 155 bp.
[0012] The method described above for rapidly identifying markers for resistance to jujube witches' broom involves PCR amplification of the 2000bp region of the promoter of the ZjMAPK2 gene, followed by Sanger sequencing or capillary electrophoresis of the amplified products. The determination is based on the sequence of the 114–158bp and 1267–1309bp promoter regions of the ZjMAPK2 gene or the peak pattern of capillary electrophoresis.
[0013] Preferably, the primer sequences used for PCR amplification using the Sanger sequencing method are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0014] Preferably, the primer sequences used for PCR amplification by capillary electrophoresis are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0015] The application of a marker for rapid identification of jujube witches'-broom disease resistance, as described above, in jujube variety breeding.
[0016] Therefore, the present invention provides a marker for rapid identification of jujube witches'-broom disease resistance, its method of use, and its application, the specific technical effects of which are as follows:
[0017] (1) The markers for rapid identification of jujube witches' broom disease resistance provided by this invention are located in the 114-158bp and 1267-1309bp regions of the promoter region of the ZjMAPK2 gene; the promoter region of resistant varieties has base insertions and mutations in the 114-158bp region and base deletions in the 1267-1309bp region; the promoter region of susceptible varieties has at least one homologous chromosome of the ZjMAPK2 gene with no base insertions and mutations in the 114-158bp region and no base deletions in the 1267-1309bp region.
[0018] (2) The marker for rapid identification of jujube witches' broom disease resistance provided by the present invention exists stably in the currently known jujube witches' broom disease resistant and susceptible varieties. It can be used for the identification of jujube witches' broom disease resistant varieties. It is simple and convenient, has low environmental dependence, short time consumption and low cost. It can greatly reduce the workload of identification and improve the accuracy of identification. It is of great significance for rapid screening and breeding of jujube witches' broom disease resistant varieties.
[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 This is the comparison result of the promoter 114-158bp of the ZjMAPK2 gene in some varieties / strains in Example 3 of this invention;
[0022] Figure 2 This is the comparison result of the promoter 1267-1309bp of the ZjMAPK2 gene in some varieties / strains in Example 3 of this invention;
[0023] Figure 3 These are capillary electrophoresis sequencing results of some varieties / strains in Example 3 of this invention; where A is the capillary electrophoresis sequencing result of "Kaifeng 2" (114-158 bp); B is the capillary electrophoresis sequencing result of "T11" (114-158 bp); C is the capillary electrophoresis sequencing result of "T13" (114-158 bp); D is the capillary electrophoresis sequencing result of "Xingguang" (114-158 bp); E is the capillary electrophoresis sequencing result of "Dongzao" (114-158 bp); F is the capillary electrophoresis sequencing result of "Fuxiang" (114-158 bp); G is the capillary electrophoresis sequencing result of "Yuhong" (114-158 bp); H is the capillary electrophoresis sequencing result of "T" (114-158 bp). Capillary electrophoresis sequencing results: I represents the 1267–1309 bp capillary electrophoresis sequencing results of "Kaifeng 2"; J represents the 1267–1309 bp capillary electrophoresis sequencing results of "T11"; K represents the 1267–1309 bp capillary electrophoresis sequencing results of "T13"; L represents the 1267–1309 bp capillary electrophoresis sequencing results of "Xingguang"; M represents the 1267–1309 bp capillary electrophoresis sequencing results of "Dongzao"; N represents the 1267–1309 bp capillary electrophoresis sequencing results of "Fuxiang"; O represents the 1267–1309 bp capillary electrophoresis sequencing results of "Yuhong"; P represents the 1267–1309 bp capillary electrophoresis sequencing results of "T". Detailed Implementation
[0024] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0025] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0026] The instruments, equipment, reagents and materials used in the embodiments were all obtained through commercial means; the methods and steps not described in detail in the embodiments are all conventional techniques in the art.
[0027] Example 1
[0028] Specific primers were designed based on the promoter sequence of the ZjMAPK2 gene (CDS sequence shown in SEQ ID NO.1, as shown in SEQ ID NO.2). The upstream primer sequence is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4. The primer sequence information was sent to a company for primer sequence synthesis. The received primers were centrifuged at 10,000 rpm and 4°C for 10 min. Then, according to the instructions for the received primers, each primer was dissolved to prepare a 10 mM stock solution. A certain amount of the stock solution was then used to prepare a 10 μM / L working solution. The primer stock solution was stored at -80°C, and the working solution was stored at 4°C.
[0029] SEQ ID NO.1:
[0030] ATGTCGGGTGCTAACCAGACCAACGCCGGCGGTCAGTTCAGTGATTTTCCGGCGGTCCAGACTCATGGAGGCCAGTTCGTTCAGTATAATATATTTGGAAACCTCTTCGAGATCACCTCCAAGTATCGGCCCCCGATCATGCCCATCGGTCGCGGTGCGTATGGTATTGTCTGCTCGATTATGAATACGGAGACCAATGAAATGGTTGCCATCAAGAAGATCGCCAACGCGTTTGATAATCATATGGATGCTAAGCGTACGCTTCGGGAGATCAAGCTTCTTCGCCATCTTGATCACGAAAACGTTGTGGCCATAAAAGATGTGGTTCCTCCACCTTTACGGAGGGAATTTACTGATGTCTATATAGCTACCGAACTCATGGACACCGATCTCCATCAAATTATTCGTTCAAATCAAAGTTTATCAGAGGAGCACTGTCAGTACTTCTTGTATCAGATTCTTCGAGGCCTGAAATACATACATTCAGCTAATGTTATTCACAGAGACTTGAAGCCGAGCAACCTGTTATTAAATGCAAATTGCGATCTTAAGATATGCGATTTCGGGCTTGCTCGTCCCACGGCGGAGAATGAGTATATGACAGAGTATGTTGTCACTAGATGGTATAGAGCACCTGAATTATTGTTGAACTCTTCGG ACTACACTGCTGCGATTGATGTATGGTCTGTGGGTTGCATTTTCATGGAGCTTATGAACAGAAAGCCTCTATTTCCAGGAAAAGATCATGTACATCAAATGCGCTTATTGACAGAGCTCCTTGGCACACCAACTGAGTCTGATCTTGGGTTTGTTCGAAATGGGATGCGAGAAGAT ATATAAGGCAACTGGCTCCATTTCCTTGTCAGTCATTAGCCACGGTTTTTCCACATATTCATCCATTGGCCATAGATCTTGTTGATAAAATGTTGACATTTGATCCTTCTAAAAGAATAACAGAAGAGCTTCTTGAGAAAGTACACTTCACTGATTTTGGTTTTGAGCTCGTCTGA
[0031] SEQ ID NO.2:
[0032]
[0033] SEQ ID NO.3:TGAAATTTATTTTTTTTTAAATTTAAAG
[0034] SEQ ID NO.4:ATCCGTGCGTACGTACAGTACTCA
[0035] Example 2
[0036] Genomic DNA was extracted from disease-resistant and susceptible jujube varieties, as detailed below:
[0037] From the jujube trees planted in Fuping, disease-resistant and disease-susceptible varieties were selected from those reported in the literature or verified in experiments. Two tender leaves were taken from each variety, and genomic DNA of each variety was extracted using the CTAB method. After drying in a fume hood, 50 μL of sterile water was added, and the genomic DNA solution of each variety was obtained after the precipitate was completely dissolved.
[0038] The selected varieties are shown in Table 1.
[0039] Table 1. Information on the investigated jujube varieties and statistical results.
[0040]
[0041]
[0042] Note: R indicates resistance, and S indicates susceptibility.
[0043] Example 3
[0044] The markings provided by this invention are verified as follows:
[0045] (1) Using the primers designed in Example 1, PCR was performed using the genomic DNA solutions of various jujube varieties obtained in Example 2 as templates. The amplification system was as follows: 1 μL of Tks Gflex DNA Polymerase, 10 μL of 2X Gflex PCR Buffer, 0.8 μL of upstream primer, 0.8 μL of downstream primer, and 50 μL of sterile ddH2O was added to bring the volume to 50 μL. The amplification program was as follows: 94℃ for 1 min; 98℃ for 10 s, 55℃ for 20 s, 68℃ for 60 s, 34 cycles; 72℃ for 2 min; and incubation at 4℃.
[0046] (2) The amplified products were sent to the company for Sanger sequencing. The obtained sequences were compared and analyzed using DNAMAN software. The comparison results of the promoter 114-158bp of some jujube varieties / lines ZjMAPK2 are as follows: Figure 1 As shown, the alignment results for 1267–1309 bp are as follows: Figure 2As shown, it can be seen that the promoter 114–158 bp of the ZjMAPK2 gene in jujube varieties currently reported in the literature or verified in experiments all contain base insertions (mutations), while the promoter 1267–1309 bp all contain 43 bp base deletions. In contrast, the promoter 114–158 bp of the ZjMAPK2 gene in jujube varieties reported in the literature or verified in experiments does not contain base deletions (mutations) on at least one homologous chromosome, and the promoter 1267–1309 bp does not contain the 43 bp base deletion.
[0047] The promoter of the ZjMAPK2 gene exhibits base insertions and mutations in the 114–158 bp range and base deletions in the 1267–1309 bp range, denoted as R; the promoter does not exhibit base insertions and mutations in the 114–158 bp range and base deletions in the 1267–1309 bp range, denoted as S. The statistical results are shown in Table 1.
[0048] (3) The amplified products were subjected to capillary electrophoresis and sequencing. The promoter of the ZjMAPK2 gene (114–158 bp) was amplified using primers shown in SEQ ID NO. 5 and SEQ ID NO. 6, and the promoter of the ZjMAPK2 gene (1267–1309 bp) was amplified using primers shown in SEQ ID NO. 7 and SEQ ID NO. 8. Capillary electrophoresis results for some jujube varieties / strains are shown below. Figure 3 As shown, capillary electrophoresis detects the number of base pairs (bp) in a sequence. For example, Kaifeng No. 2 is homozygous and disease-resistant, so one bp number was detected. However, jujube is heterozygous and disease-susceptible, so two different bp numbers were detected. The difference between them is the number of missing bases, with an error of 1-2 bp.
[0049] SEQ ID NO.5:
[0050] TGTAAAACGACGGCCAGTCGAGCTTTCACCATAGAGACAAAA
[0051] SEQ ID NO.6:GGTAGCATAGTCTCTTACAAATTTGAA
[0052] SEQ ID NO.7:
[0053] TGTAAAACGACGGCCAGTGAAGATTAGGGAATTCAAATCCG
[0054] SEQ ID NO.8:AAAGCAAATATGCGTGACAGTTC
[0055] The statistical results are shown in Table 1. When the genotypes of both chromosomes are R, it indicates homozygous resistance; when the genotype of one chromosome is R and the genotype of the other chromosome is S, it indicates heterozygous susceptibility; when the genotypes of both chromosomes are S, it indicates homozygous susceptibility.
[0056] Therefore, the markers for rapid identification of jujube witches'-broom disease resistance provided by this invention are located at 114–158 bp and 1267–1309 bp in the promoter region of the ZjMAPK2 gene. In resistant varieties, the promoter region at 114–158 bp contains base insertions and mutations, while at 1267–1309 bp contains base deletions. In susceptible varieties, at least one homologous ZjMAPK2 gene promoter region at 114–158 bp does not contain base insertions or mutations, and at 1267–1309 bp does not contain base deletions. The provided markers for rapid identification of jujube witches'-broom disease resistance are stably present in currently known resistant and susceptible varieties, and can be used for the identification of resistant varieties. This method is simple, convenient, has low environmental dependence, is time-efficient, and low-cost, significantly reducing the workload and improving accuracy. It is of great significance for the rapid screening and breeding of jujube witches'-broom disease resistant varieties.
[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A method for rapidly identifying molecular markers for resistance to jujube witches' broom disease, characterized in that: right ZjMAPK2 The 2000bp region of the gene promoter was amplified by PCR, and the amplification products were subjected to Sanger sequencing or capillary electrophoresis, according to... ZjMAPK2 The sequence of the gene promoter (114-158 bp and 1267-1309 bp) or the peak pattern of capillary electrophoresis can be used to determine the gene. The molecular marker is located at ZjMAPK2 The promoter region of a gene; ZjMAPK2 The CDS sequence of the gene is shown in SEQ ID NO.1; the sequence of the promoter is shown in SEQ ID NO.2; the promoter of the disease-resistant variety has base insertions and mutations in 114~158bp and base deletions in 1267~1309bp; At least one homologous chromosome is present in susceptible varieties. ZjMAPK2 The promoter of the gene has no base insertions or mutations in the 114-158 bp range, and no base deletions in the 1267-1309 bp range; another homologous chromosome of the susceptible variety... ZjMAPK2 The promoters of the gene, at 114-158 bp and 1267-1309 bp, can have two possibilities: another homologous chromosome. ZjMAPK2 The promoter of the gene has no base insertions or mutations in the 114-158 bp range, and no base deletions in the 1267-1309 bp range; another homologous chromosome ZjMAPK2 The promoter of the gene contains base insertions and mutations in the 114-158bp range and base deletions in the 1267-1309bp range. ZjMAPK2 The gene promoter has two base insertions in the 114-158 bp range, one at 122 bp and the other at 155 bp.
2. The method of using the molecular marker according to claim 1, characterized in that: The primer sequences used for PCR amplification using the Sanger sequencing method are shown in SEQ ID NO.3 and SEQ ID NO.
4.
3. The method of using the molecular marker according to claim 1, characterized in that: The primer sequences used for PCR amplification by capillary electrophoresis are shown in SEQ ID NO.5 and SEQ ID NO.
6.
4. The application of the method of using molecular markers as described in any one of claims 1 to 3 in the breeding of jujube varieties.