Premature high amino acid content and high brittleness white strain of flammulina velutipes ZJJZG003, identification of InDel marker and application thereof

Through hybridization breeding and InDel marker technology, a white enoki mushroom strain ZJJZG003 with early maturity, high amino acid content, and high crispness was developed, which solved many defects of existing enoki mushroom varieties and achieved the effects of early maturity, high yield, improved taste, and accurate identification.

CN120944717BActive Publication Date: 2026-03-27KUNMING INST OF EDIBLE FUNGI CHINA NAT SUPPLY & MARKETING GENERAL COOP
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-16
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing enoki mushroom varieties have characteristics such as early fruiting, strong aroma, crisp texture, uniform fruiting, and high yield, which are difficult to achieve. Furthermore, the brittleness of the stem is difficult to measure, and the selenium content is low, which cannot meet the human body's needs. The application of InDel markers in the identification of enoki mushrooms has not been reported.

Method used

A white enoki mushroom strain ZJJZG003, characterized by early maturity, high amino acid content, and high crispness, was developed, along with its identification using the InDel marker. The ZJJZG003 strain was obtained through hybridization breeding, and multiple pairs of InDel primers were designed for genotyping. Strains that met specific fragment lengths were screened and cultivated using a specific culture medium.

Benefits of technology

It has achieved early maturity and high yield of the strain, increased amino acid content, improved taste, enhanced tolerance to extreme temperatures, and improved antibacterial rate. It also provides a crispy outer shell structure and an accurate identification method, thereby improving the cultivation efficiency and quality of enoki mushrooms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944717B_ABST
    Figure CN120944717B_ABST
Patent Text Reader

Abstract

The application discloses a white flammulina velutipes strain ZJJZG003 with early maturity, high amino acid content and high brittleness, an InDel marker for identification and application of the strain, and relates to the technical field of edible mushroom breeding. Flammulina filiformis The strain is obtained by crossing F24 and W1, has a faster growth speed, and has a mycelium growth speed of 5.63 mm / d at 30 DEG C and a growth speed of 4.75 mm / d at 25 DEG C, which are much higher than the growth speeds of the parents, and the time for primordium appearance is shortened.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of edible mushroom breeding, in particular to a white Flammulina velutipes strain ZJJZG003 with early maturity, high amino acid content and high brittleness, an InDel marker for identification and application thereof. BACKGROUND

[0002] Flammulina velutipes, also known as winter mushroom, hairy handle money fungus, structure fungus and porcini, is rich in nutrients, delicious and has medicinal value. The eight essential amino acids in Flammulina velutipes account for 44.5% of the total amount of amino acids, which is higher than that of general mushrooms. The content of arginine, lysine and zinc is relatively high, far exceeding other mushrooms, so it is known as "intellectual mushroom".

[0003] At present, artificially cultivated Flammulina velutipes can be divided into white and yellow according to color. The white Flammulina velutipes is a Japanese introduced variety, and the yellow Flammulina velutipes is a traditional cultivated variety in China.

[0004] The white Flammulina velutipes has white color, neat fruiting and high yield, and the cultivation area of white Flammulina velutipes is large. Although the yellow Flammulina velutipes has the characteristics of early fruiting, strong mushroom aroma and crisp taste, it has low yield, easy to open the umbrella and easy to brown, which affects normal sales, circulation and limited cultivation area.

[0005] Therefore, it is necessary to breed a new Flammulina velutipes variety which has the characteristics of early fruiting, crisp taste of yellow Flammulina velutipes and neat fruiting, high yield of white Flammulina velutipes.

[0006] At the same time, the existing Flammulina velutipes also has the problems that the stem part cannot measure the brittleness data, does not have a measurable structure of crisp outer shell structure, has heavy bitter taste, weak ability to inhibit the growth of miscellaneous bacteria, weak tolerance to high and low temperature, once in the process of artificial cultivation, the strain growth is affected by extreme weather, and the yield is reduced. At the same time, the selenium content in the existing Flammulina velutipes is low, and the human body's need for selenium elements cannot be effectively supplemented by using Flammulina velutipes.

[0007] The InDel marker is a molecular marker developed based on the mutation caused by the insertion or deletion of nucleotide fragments of different sizes in the same site of the genome between close relatives or different individuals of the same species. The InDel marker is a co-dominant marker, which is a molecular marker with wide distribution, high density and strong variation stability. The InDel marker genotype is simple and fast, and is very suitable for the development of high-density molecular markers. Genetic evidence shows that genome InDel is the main source of gene defects and one of the important sources of species evolution.

[0008] At present, InDel markers have been widely used in the fields of genetic map construction, gene positioning and cloning, and association analysis, but the related InDel sequences for identifying the mushroom strains of Flammulina velutipes with the characteristics of early fruiting, strong mushroom aroma, crisp taste, neat fruiting, and high yield have not been disclosed in the prior art. Moreover, whether the mushroom strains are suitable for the identification of the marker to distinguish different varieties of Flammulina velutipes is also an unknown field of research.

[0009] The information disclosed in the background section is only intended to increase the understanding of the general background of the application and should not be considered as admitting or in any form implying that the information constitutes prior art known to those of ordinary skill in the art. SUMMARY

[0010] The present application provides a white Flammulina velutipes strain ZJJZG003 with early maturity, high amino acid content, and high brittleness, an identification InDel marker, and application thereof.

[0011] The present application provides a white Flammulina velutipes strain ZJJZG003 with early maturity, high amino acid content, and high brittleness, an identification InDel marker, and application thereof. Flammulina filiformis ).

[0012] Another aspect of the present application also provides an InDel marker for identifying the early-mature high-amino-acid-content and high-brittleness white Flammulina velutipes strain ZJJZG003 as above, wherein the strain to be detected simultaneously satisfies: the product fragment amplified by INDEL004 primer is 204 bp, 207 bp; the product fragment amplified by INDEL012 primer is 292 bp, 299 bp; the product fragment amplified by INDEL013 primer is 202 bp, 206 bp; the product fragment amplified by INDEL016 primer is 289 bp, 292 bp, 296 bp, 300 bp, 302 bp, 306 bp; the product fragment amplified by INDEL018 primer is 284 bp, 288 bp; the product fragment amplified by INDEL025 primer is 270 bp, 275 bp, 288 bp; the product fragment amplified by INDEL026 primer is 252 bp, 255 bp, 261 bp; the product fragment amplified by INDEL027 primer is 296 bp, 299 bp; the product fragment amplified by INDEL028 primer is 171 bp, 177 bp; the product fragment amplified by INDEL029 primer is 222 bp, 228 bp, 231 bp; the product fragment amplified by INDEL031 primer is 268 bp, 273 bp; the product fragment amplified by INDEL034 primer is 148 bp, 152 bp; the product fragment amplified by INDEL038 primer is 217 bp, 224 bp, 227 bp, 246 bp; the product fragment amplified by INDEL042 primer is 204 bp, 207 bp; the product fragment amplified by INDEL043 primer is 238 bp, 242 bp, 246 bp; the product fragment amplified by INDEL050 primer is 292 bp, 295 bp; the product fragment amplified by INDEL051 primer is 276 bp, 279 bp; the product fragment amplified by INDEL075 primer is 238 bp, 242 bp, 244 bp, 248 bp; the product fragment amplified by INDEL078 primer is 237 bp, 242 bp, 246 bp, 250 bp; the product fragment amplified by INDEL082 primer is 293 bp, 299 bp; the product fragment amplified by INDEL101 primer is 197 bp, 200 bp; the product fragment amplified by INDEL107 primer is 283 bp, 290 bp, 292 bp; the product fragment amplified by INDEL118 primer is 280 bp, 285 bp, 290 bp; the product fragment amplified by INDEL125 primer is 217 bp, 224 bp; the product fragment amplified by INDEL145 primer is 287 bp, 293 bp, 296 bp, 297 bp; the product fragment amplified by INDEL147 primer is 146 bp, 149 bp, 152 bp, 160 bp;When the product fragment amplified by the INDEL166 primer is 208 bp, 212 bp, 217 bp; the product fragment amplified by the INDEL169 primer is 290 bp, 294 bp; the product fragment amplified by the INDEL170 primer is 272 bp, 278 bp; the product fragment amplified by the INDEL174 primer is 274 bp, 278 bp; the product fragment amplified by the INDEL177 primer is 274 bp, 277 bp, 281 bp; the product fragment amplified by the INDEL188 primer is 251 bp, 253 bp, 269 bp; the product fragment amplified by the INDEL191 primer is 258 bp, 261 bp, 263 bp, the strain to be detected is the strain ZJJZG003;

[0013] The sequence of INDEL004-F is set forth in SEQ ID:2; the sequence of INDEL004-R is set forth in SEQ ID:35; the sequence of INDEL012-F is set forth in SEQ ID:3; the sequence of INDEL012-R is set forth in SEQ ID:36; the sequence of INDEL013-F is set forth in SEQ ID:4; the sequence of INDEL013-R is set forth in SEQ ID:37; the sequence of INDEL016-F is set forth in SEQ ID:5; the sequence of INDEL013-R is set forth in SEQ ID:38; the sequence of INDEL018-F is set forth in SEQ ID:6; the sequence of INDEL018-R is set forth in SEQ ID:39; the sequence of INDEL025-F is set forth in SEQ ID:7; the sequence of INDEL025-R is set forth in SEQ ID:40; the sequence of INDEL026-F is set forth in SEQ ID:8; the sequence of INDEL026-R is set forth in SEQ ID:41; the sequence of INDEL027-F is set forth in SEQ ID:9; the sequence of INDEL027-R is set forth in SEQ ID:42; the sequence of INDEL028-F is set forth in SEQ ID:10; the sequence of INDEL028-R is set forth in SEQ ID:43; the sequence of INDEL029-F is set forth in SEQ ID:11; the sequence of INDEL029-R is set forth in SEQ ID:44; the sequence of INDEL031-F is set forth in SEQ ID:12; the sequence of INDEL031-R is set forth in SEQ ID:45; the sequence of INDEL034-F is set forth in SEQ ID:13; the sequence of INDEL034-R is set forth in SEQ ID:46; the sequence of INDEL038-F is set forth in SEQ ID:14; the sequence of INDEL038-R is set forth in SEQ ID:47; the sequence of INDEL042-F is set forth in SEQ ID:15; the sequence of INDEL042-R is set forth in SEQ ID:48; the sequence of INDEL043-F is set forth in SEQ ID:16; the sequence of INDEL043-R is set forth in SEQ ID:49; the sequence of INDEL050-F is set forth in SEQ ID:17; the sequence of INDEL050-R is set forth in SEQ ID:50; the sequence of INDEL051-F is set forth in SEQ ID:18; the sequence of INDEL051-R is set forth in SEQ ID:51; the sequence of INDEL075-F is set forth in SEQ ID:19; the sequence of INDEL075-R is set forth in SEQ ID:52; the sequence of INDEL078-F is set forth in SEQ ID:20; the sequence of INDEL078-R is set forth in SEQ ID:53; the sequence of INDEL082-F is set forth in SEQ ID:21;The sequence of INDEL082-R is shown as SEQ ID: 54; the sequence of INDEL101-F is shown as SEQ ID: 22; the sequence of INDEL101-R is shown as SEQ ID: 55; the sequence of INDEL107-F is shown as SEQ ID: 23; the sequence of INDEL107-R is shown as SEQ ID: 23; the sequence of INDEL118-F is shown as SEQ ID: 24; the sequence of INDEL118-R is shown as SEQ ID: 57; the sequence of INDEL125-F is shown as SEQ ID: 25; the sequence of INDEL125-R is shown as SEQ ID: 58; the sequence of INDEL145-F is shown as SEQ ID: 26; the sequence of INDEL145-R is shown as SEQ ID: 59; the sequence of INDEL147-F is shown as SEQ ID: 27; the sequence of INDEL147-R is shown as SEQ ID: 60; the sequence of INDEL166-F is shown as SEQ ID: 28; the sequence of INDEL166-R is shown as SEQ ID: 61; the sequence of INDEL169-F is shown as SEQ ID: 29; the sequence of INDEL169-R is shown as SEQ ID: 62; the sequence of INDEL174-F is shown as SEQ ID: 31; the sequence of INDEL174-R is shown as SEQ ID: 64; the sequence of INDEL177-F is shown as SEQ ID: 32; the sequence of INDEL177-R is shown as SEQ ID: 65; the sequence of INDEL188-F is shown as SEQ ID: 33; the sequence of INDEL188-R is shown as SEQ ID: 66; the sequence of INDEL191-F is shown as SEQ ID: 34; the sequence of INDEL191-R is shown as SEQ ID: 67.

[0014] Another aspect of the present application also provides a breeding method of the premature high-amino-acid-content and high-brittleness white Flammulina velutipes strain ZJJZG003 as described above, comprising the following steps:

[0015] Yellow Flammulina velutipes F24 and white Flammulina velutipes W1 are used as parent materials, and spores of the parent materials are collected to prepare mycelial blocks of single-spore strains of yellow Flammulina velutipes F24 and white Flammulina velutipes W1, respectively; the mycelial blocks of the single-spore strains are inoculated on the same plate medium, and after the two colonies are fused, the mycelium in the fusion area is inoculated on another culture medium to obtain a fusion strain with lock-like combination;

[0016] The fusion strain is inoculated and cultured, and the strains with weak mycelium and poor growth are eliminated, and the white Flammulina velutipes strain ZJJZG003 with white fruiting body, spherical cap, high uniformity of color at the base of the stem, high yield, and neat budding is screened out.

[0017] Another aspect of the present application also provides an application of the white Flammulina velutipes strain ZJJZG003 with high amino acid content and high brittleness in artificial cultivation.

[0018] Preferably, the cultivation material used in artificial cultivation is corn cob 35 parts by weight, rice bran 36 parts by weight, bran 8 parts by weight, cottonseed hull 5 parts by weight, beet pulp 4 parts by weight, soybean hull 4 parts by weight, beer residue 4 parts by weight, calcium hydrogen 1.3 parts by weight, lime 0.7 parts by weight, which are mixed and then mixed with water to make the water content 65-68%.

[0019] Preferably, the fermentation liquid inoculated on the cultivation material in artificial cultivation is prepared by inoculating the 5mm diameter ZJJZG003 activated mycelial block in the culture solution at 4-6 pieces per bottle, and then culturing at 20℃ for 8 days.

[0020] Preferably, the culture solution is soybean powder 5g, corn powder 3g, peptone 3g, glucose 18g, magnesium sulfate 0.7g, dipotassium hydrogen phosphate 1g, and water 1L.

[0021] The beneficial effects that can be produced by the present application include:

[0022] 1) The white Flammulina velutipes strain ZJJZG003 with high amino acid content and high brittleness provided by the present application is obtained by crossing F24 and W1, has a faster growth speed, the growth speed of mycelium cultured at 30℃ is 5.63mm / d, and the growth speed at 25℃ is also 4.75mm / d, which is much higher than the growth speed of the parent, and the time of primordium appearance is shortened, and the time of fruiting body growth is significantly shortened to 20 days.

[0023] 2) The white Flammulina velutipes strain ZJJZG003 with high amino acid content and high brittleness provided by the present application, the identification InDel marker and the application thereof, the total amount of amino acids of the strain is 8.55g / 100g, which is higher than 8.10g / 100g of the parent F24; the total amount of taste amino acids of ZJJZG003 is higher, which is 6.21g / 100g, and the bitter amino acid content of the strain ZJJZG003 is lower than that of the parent, which has the effect of improving the taste and increasing the fresh and sweet taste; and the potassium, selenium and vitamin B1 of ZJJZG003 are significantly higher than those of the parent F24, and the selenium is 2.76 times of the parent F24.

[0024] 3) The early-maturing white enoki mushroom strain ZJJZG003 provided in this application, which has high amino acid content and high crispness, can recover normal growth after being cultured in the dark at 5℃ and 35℃ for 7 days, and then returned to 25℃ for dark cultivation. Moreover, the growth rate of this strain after recovery is higher than that of the parent strain F24. This indicates that this strain has a stronger ability to tolerate high and low temperatures than existing enoki mushrooms. It can better tolerate high and low temperature environments during artificial cultivation, which is conducive to obtaining better yields after extreme weather.

[0025] 4) The early-maturing, high-amino acid content, and high-brittle white enoki mushroom strain ZJJZG003 provided in this application and its application. This strain showed a higher inhibition rate of 77% than the parent strain F24 in confrontation culture, indicating that this strain can better resist the infection of Trichoderma and Pseudomonas during growth and reduce the yield reduction caused by infection with miscellaneous fungi. This strain is especially suitable for artificial cultivation, can effectively increase yield, has strong resistance to high and low temperatures, and is tolerant to infection by miscellaneous fungi.

[0026] 5) The early-maturing white enoki mushroom strain ZJJZG003 with high amino acid content and high crispness provided in this application has a brittle outer shell structure in its stipe, which can be measured for crispness. The crispness of the other samples cannot be measured. The energy required for chewing is lower than that of the parent strain, and the hardness is slightly higher than that of the parent strain. This enoki mushroom has a better crisp and hard texture experience than existing enoki mushroom varieties, while the chewing intensity is reduced, which can provide users with a different eating experience.

[0027] 6) The white enoki mushroom strain ZJJZG003 provided in this application is identified using the InDel marker, which can accurately identify the strain and facilitate accurate identification.

[0028] White enoki mushroom strain ZJJZG003, taxonomically named *Flammulina velutipes* (… Flammlina filiformis The specimen, *Lactarius deliciosus*, was deposited on March 5, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCCNO.41175; and is classified as *Lactarius deliciosus*. Flammulina filiformis ). Attached Figure Description

[0029] Figure 1 These are colony morphology photographs of the white enoki mushroom strain ZJJZG003 obtained in Example 2 of this application and its parent strain F24; a is F24; b is ZJJZG003;

[0030] Figure 2 This is the developmental tree of the white enoki mushroom strain ZJJZG003 obtained in Example 3 of this application;

[0031] Figure 3 This is a schematic diagram showing the inner and outer diameters of the white enoki mushroom strain ZJJZG003 in Example 4 of this application;

[0032] Figure 4 The colony culture photos of white mushroom strain ZJJZG003, parent F24 under different culture temperatures in Example 4 of the present application; a is ZJJZG003; b is F24;

[0033] Figure 5 The genotype peak map of marker JZGINDEL004 in Example 6 of the present application;

[0034] Figure 6 The genotype peak map of marker JZGINDEL012 in Example 6 of the present application;

[0035] Figure 7 The genotype peak map of marker JZGINDEL013 in Example 6 of the present application;

[0036] Figure 8 The genotype peak map of marker JZGINDEL016 in Example 6 of the present application;

[0037] Figure 9 The genotype peak map of marker JZGINDEL018 in Example 6 of the present application;

[0038] Figure 10 The genotype peak map of marker JZGINDEL025 in Example 6 of the present application;

[0039] Figure 11 The genotype peak map of marker JZGINDEL026 in Example 6 of the present application;

[0040] Figure 12 The genotype peak map of marker JZGINDEL027 in Example 6 of the present application;

[0041] Figure 13 The genotype peak map of marker JZGINDEL028 in Example 6 of the present application;

[0042] Figure 14 The genotype peak map of marker JZGINDEL029 in Example 6 of the present application;

[0043] Figure 15 The genotype peak map of marker JZGINDEL031 in Example 6 of the present application;

[0044] Figure 16 The genotype peak map of marker JZGINDEL034 in Example 6 of the present application;

[0045] Figure 17 The genotype peak map of marker JZGINDEL038 in Example 6 of the present application;

[0046] Figure 18 Genotype peak plot for marker JZGINDEL042 in Example 6 of the present application;

[0047] Figure 19 Genotype peak plot for marker JZGINDEL043 in Example 6 of the present application;

[0048] Figure 20 Genotype peak plot for marker JZGINDEL050 in Example 6 of the present application;

[0049] Figure 21 Genotype peak plot for marker JZGINDEL051 in Example 6 of the present application;

[0050] Figure 22 Genotype peak plot for marker JZGINDEL075 in Example 6 of the present application;

[0051] Figure 23 Genotype peak plot for marker JZGINDEL078 in Example 6 of the present application;

[0052] Figure 24 Genotype peak plot for marker JZGINDEL082 in Example 6 of the present application;

[0053] Figure 25 Genotype peak plot for marker JZGINDEL101 in Example 6 of the present application;

[0054] Figure 26 Genotype peak plot for marker JZGINDEL107 in Example 6 of the present application;

[0055] Figure 27 Genotype peak plot for marker JZGINDEL118 in Example 6 of the present application;

[0056] Figure 28 Genotype peak plot for marker JZGINDEL145 in Example 6 of the present application;

[0057] Figure 29 Genotype peak plot for marker JZGINDEL125 in Example 6 of the present application;

[0058] Figure 30 Genotype peak plot for marker JZGINDEL147 in Example 6 of the present application;

[0059] Figure 31 Genotype peak plot for marker JZGINDEL166 in Example 6 of the present application;

[0060] Figure 32Genotype peak chart of marker JZGINDEL169 in Example 6 of the present application;

[0061] Figure 33 Genotype peak chart of marker JZGINDEL170 in Example 6 of the present application;

[0062] Figure 34 Genotype peak chart of marker JZGINDEL174 in Example 6 of the present application;

[0063] Figure 35 Genotype peak chart of marker JZGINDEL177 in Example 6 of the present application;

[0064] Figure 36 Genotype peak chart of marker JZGINDEL188 in Example 6 of the present application;

[0065] Figure 37 Genotype peak chart of marker JZGINDEL191 in Example 6 of the present application;

[0066] Figure 38 UPGMA cluster tree of 48 strains of commercially available Flammulina velutipes and strain ZJJZG003 in Example 6 of the present application;

[0067] Figure 39 Figure of detection results of high and low temperature resistance of strain ZJJZG003 and parent F24 in Example 7 of the present application; a is a photograph of plate of parent F24 mycelial block after being cultured at 35℃ for 7d and then being cultured at 25℃ for 7d in dark; b is a photograph of plate of strain ZJJZG003 mycelial block after being cultured at 35℃ for 7d and then being cultured at 25℃ for 7d in dark; c is a photograph of plate of parent F24 mycelial block after being cultured at 5℃ for 7d and then being cultured at 25℃ for 7d in dark; d is a photograph of plate of strain ZJJZG003 mycelial block after being cultured at 5℃ for 7d and then being cultured at 25℃ for 7d in dark;

[0068] Figure 40 Figure of results of confrontation experiment of strain ZJJZG003 and parent F24 against miscellaneous bacteria in Example 8 of the present application; a is parent F24 against Trichoderma; b is strain ZJJZG003 against Trichoderma; c is parent F24 against Pseudomonas; d is strain ZJJZG003 against Pseudomonas;

[0069] Figure 41 Picture of fruiting body of strain ZJJZG003 cultivated in Example 5 of the present application;

[0070] Figure 42 Figure of results of bands amplified by marker JZGINDEL118 for parent F24 in Example 6 of the present application;

[0071] Figure 43 Figure of the result of amplification band marked with JZGINDEL118 for the parent W1 obtained in Example 6 of the present application;

[0072] Flammulina Figure of the result of amplification band marked with JZGINDEL118 for the strain ZJJZG003 obtained in Example 6 of the present application. DETAILED DESCRIPTION

[0073] The present application will be further described in conjunction with the accompanying drawings and examples, but in no way limits the present application, any transformation or improvement based on the teaching of the present application falls within the protection scope of the present application.

[0074] The specific experimental steps or conditions not mentioned in the examples can be carried out according to the operation or conditions of the conventional experimental steps described in the literature in the art. The reagents or instruments used are not specified by the manufacturer, but are conventional reagent products that can be obtained by purchase.

[0075] The culture medium used in the following examples is as follows:

[0076] 1. PDA culture medium: potato 200 g, glucose 20 g, agar 20 g, water 1 L.

[0077] 2. Liquid strain culture medium: white sugar 20 g, soybean protein powder 3.5 g, magnesium sulfate 0.66 g, potassium dihydrogen phosphate 0.66 g, water 1 L.

[0078] 3. Cultivation medium: corn cob 38%~40%, rice bran 32%~35%, cottonseed hull 5%~8%, bran 8%~10%, beer dregs 5%~8%, soybean hull 5%~8%, sugar beet residue 5%~8%, gypsum 1%~2%, beihua stone 1%~1.5%, moisture content 65%, pH value natural.

[0079] Example 1 Obtaining white strain ZJJZG003

[0080] 1. Experimental materials

[0081] In May 2021, yellow Flammulina velutipes F24 and white Flammulina velutipes W1 were purchased from Shui Mu Hua wild mushroom trading market as parent materials.

[0082] 2. Breeding

[0083] (1) Collecting spores

[0084] Take the mature fresh and disease-free fruiting bodies of yellow Tricholoma populinum F24 and white Tricholoma populinum W1 respectively, cut off the stipes under aseptic environment, and place the hymen side on a sterile culture dish. Place the dish in a sterile room at 18-20°C and keep the humidity. Collect the spores overnight. After white spore prints appear on the bottom of the plate, remove the fruiting bodies and seal the spores of yellow Tricholoma populinum F24 and white Tricholoma populinum W1 for standby.

[0085] (2) Spore isolation

[0086] The following operations are performed on the spores of yellow Tricholoma populinum F24 and white Tricholoma populinum W1 respectively:

[0087] Scrape an appropriate amount of spores and dissolve them in 10 mL of sterile water. Dilute the spore solution to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 concentration gradient by gradient dilution method to obtain multiple spore solutions. From 10 -2 , take 50 µL of spore solution from each concentration gradient solution, and coat each spore solution on 3 PDA plates, each containing 90 mm PDA medium.

[0088] Invert culture at 24°C in the dark. The best time for single spore picking is the 4th and 5th day. After 4 and 5 days of culture, inoculate the single colonies on PDA plates with a sterile needle. Try to pick the sparsely populated part of the colonies. Continue to culture for 4-5 days, then select the colonies and inoculate them on PDA plates again. After 2-3 times of purification, the yellow single spores are numbered Y1-Y81, and 81 yellow single spores are picked. The white single spores are numbered XB1-XB84, and 84 white single spores are picked.

[0089] Pick the purified strains and culture them on plates with sterile coverslips at 24°C in the dark until the mycelium crawls to the coverslips. Observe under a general optical microscope to see if there are any lock-like associations. Select the mycelium with good growth and no lock-like associations for storage at 4°C for standby.

[0090] (3) Single spore hybridization

[0091] In sterile conditions, inoculate the single-spore strain blocks to be hybridized on PDA plates, with a distance of 2 cm between the blocks of yellow Tricholoma populinum F24 and white Tricholoma populinum W1, and cultivate in a 24°C incubator for 3-7 days. When a protruding fusion line forms between the two fused single colonies, in a sterile environment, pick the hyphae at the fusion site to another PDA medium, and cultivate by obliquely inserting a sterile cover glass into the medium at the edge of the hyphal colony, and cultivate in a 24°C incubator for 2-7 days. After the hyphae climb onto the cover glass, remove the cover glass, and test the fusion success with the single-nucleus hypha test method. If there is a lock-like combination, it indicates that the fusion is successful, and the successfully fused strain is preserved for future use.

[0092] (4) Growth characteristics and mushroom production test of hybrid strains

[0093] Cultivate the obtained hybrid diploid strains under the same cultivation conditions (24°C incubator cultivation) on PDA plates, and compare the growth speed, robustness, density, and hyphal growth potential of each selected strain. Eliminate strains with weak and poor hyphae, and select hybrid strains with good hyphal growth potential. Perform initial screening, re-screening, small-scale test, pilot test, and demonstration mushroom production test on the hybrid strains, and observe the yellow water discharge of the hyphae in the bag, the yield, color, and degree of inner curling of the fruiting body, and select the strain with test number 114 (strain preservation number: ZJJZG003, hybrid combination: XB71 x Y21) that has a white fruiting body, a spherical cap, a high uniformity of the base color of the stipe, a high yield, a neat budding, and excellent commodity traits.

[0094] The above steps not detailed are performed according to the existing edible mushroom hybrid breeding operation, and the selection standard is to select the hyphae with the most optimal performance relative to other hyphae as the preferred strain.

[0095] The obtained white strain ZJJZG003 is a new strain of Tricholoma populinum that has early maturity, a white body, a non-easy opening umbrella, a crisp taste, and a rich mushroom aroma, and maintains the early maturity, a crisp taste, and a rich mushroom aroma of yellow Tricholoma populinum, and the white fruiting body of white Tricholoma populinum, effectively shortens the cultivation time, is suitable for various cultivation technology modes, and has a good development and application prospect.

[0096] The white Tricholoma populinum strain ZJJZG003 was preserved in the China General Microbiological Culture Collection Center (CGMCC) on March 5, 2024, with a preservation number of CGMCC NO. 41175, and a classification name of Tricholoma populinum. filiformis Figure 1 ).

[0097] Example 2: Variety traits of white Tricholoma populinum strain ZJJZG003

[0098] The colony surface of the white flammulina velutipes strain ZJJZG003 is not pigmented; the longitudinal section shape of the cap is semispherical, the edge is strongly involuted, and the surface color is white; the stem length is relatively long, and the color uniformity is high. Figure 1 a is the colony morphology of the white flammulina velutipes strain ZJJZG003 observed at 14 days after inoculation under the culture temperature (21±1) ℃ and light-avoiding culture.

[0099] Comparison of different traits with similar varieties: the colony morphology of the yellow flammulina velutipes F24 observed at 14 days after inoculation under the culture temperature (21±1) ℃ and light-avoiding culture is shown in Figure 2 b, the surface is pigmented with light yellow; the cap surface color is light yellow, and the edge is moderately involuted; the stem length is moderate, and the color uniformity is moderate.

[0100] Example 3: Distinctive identification of the white flammulina velutipes strain ZJJZG003

[0101] The ITS4 and ITS5 primer amplified sequence of the white flammulina velutipes strain ZJJZG003 strain was sent to Hunan Qianke Biotechnology Co., Ltd. for sequencing. The amplified ITS fragment was compared in the NCBI database, and the similar sequences were downloaded. The NJ (Neighbor-Joining) phylogenetic tree was constructed by using MEGA5.1 software as shown in F. filiformis , and it was determined that ZJJZG003 was flammulina velutipes ( Figure 3 ). The ITS sequence (SEQ ID: 1) of the mycelium of the ZJJZG003 strain is as follows:

[0102] Tgaggtcaatggtcaatagttgtcccacaagggggacggttagaagcggaatagcccgcg 60 cactcgcgccacaggtatctctcgtgagagagaaggcaaagggaagcaccaactaaggcg 120 aaaccacttcagagacgagacgagcgctacaacacagtcagcccagccatagccgtagat 180 Aattatcacagctgcagcgcgccaaaaggtaacggtttctgctaatgcatttcaggggag 240 ctgaacccaaagataaggtccagcaagcccccacgtccaatccgccagctcacaacaaag 300 tgagggaggttgagaagttactgacactcaaacaggcatgcccttcggagtaccaaaggg 360 cgcaaggtgcgttcaaagactcgatgattcactgaattctgcaattcacattagttatcg 420 catttcgctgcgttcttcatcgatgcgagagccaagagatccgttgttgaaagttgtatt 480 tagtttaaaggacagtgaagtccaataatcaatgacattcgttacatactatagtgtttg 540 taagacataggcctggaaggcaaagggagcgcaaaaagcgcacccttccaatggggtatc 600 cagacctacagagtgtgcacaggtggacgaagaaagctgcaaccccagacgtgcacgtac 660 gaagaacccgtgagggtcctccgtcagcaacagcccaagagccacaagcagttcaaagtt 720 cattaatgatccttccgcaggttca 745

[0103] According to the operation of the national industry standard "Edible Fungus Strain Differentiation Identification. Antagonistic Reaction" (NY / T 1845-2010). The ZJJZG003 strain and the control F24 strain and the W1 strain have antagonistic reaction, do not have affinity, and form "isolated type" antagonistic lines with each other, which indicates that the three are different strains (varieties) of Flammulina velutipes.

[0104] Example 4 Mycelial growth rate test of the white Flammulina velutipes ZJJZG003 strain

[0105] After the white flammulina velutipes ZJJZG003 was cultivated to cover the PDA medium at 24℃, the puncher was used to quantitatively take the mycelium block with a diameter of 5mm. The PDA medium was filled in the culture dish, and the mycelium block was inoculated in the center of the culture dish with a diameter of 90mm. Each medium was placed in 5℃, 10℃, 15℃, 20℃, 25℃, 30℃ and 35℃ respectively, and cultivated in the dark. On the third day after inoculation (the first measurement) and the seventh day (the second measurement), the colony diameter was measured respectively. Each measurement was repeated 5 times at each culture temperature, and the average value was taken. The mycelium growth rate was calculated according to the following formula:

[0106] S= (D2-D1) / 〔(d2-d1) x 2〕

[0107] In the formula, S is the mycelium growth rate (mm / d); D1 is the colony diameter of the first measurement of the inner diameter of the colony (mm); D2 is the colony diameter of the second measurement of the outer diameter of the colony (mm); d1 is the mycelium growth time of the first measurement (d); and d2 is the mycelium growth time of the second measurement (d). The inner diameter and the outer diameter of the colony are shown in Figure 4 .

[0108] The mycelium growth of ZJJZG003 at different temperatures on the seventh day after inoculation is shown in Figure 4 a. The measured mycelium growth rate at different temperatures is shown in the table below.

[0109] According to the above operation, the fastest growth rate of the parent F24 is 4.13mm / d, the culture temperature is 25℃, and the second fastest growth rate is 3.81mm / d at 30℃. The mycelium growth of the parent F24 at different temperatures is shown in Figure 41 b.

[0110] As can be seen from the above, the growth rate of the strain ZJJZG003 provided by the application is faster than that of the parent F24 with the fastest growth rate, and the fastest growth temperature is also different, which indicates that the growth characteristics of the strain have changed.

[0111] Example 5: Determination of the fruiting body growth time of the strain ZJJZG003

[0112] 1. Inoculation cultivation operation: first, a culture medium is prepared, the formula of which is as follows: corn cob 35 parts by weight, rice bran 36 parts by weight, bran 8 parts by weight, cottonseed hull 5 parts by weight, beet residue 4 parts by weight, soybean hull 4 parts by weight, beer residue 4 parts by weight, calcium bicarbonate 1.3 parts by weight, lime 0.7 parts by weight. After mixing, water is added to make the moisture content 65-68%, and then the culture medium is put into plastic bags, which are sterilized by steam at 121℃ for 2 hours. After cooling to 25℃, the strain ZJJZG003 fermentation liquor is inoculated into the plastic bags at 25ml / bag. The preparation of the strain ZJJZG003 fermentation liquor is as follows: (1) 5mm-diameter activated strain blocks are inoculated into culture solution (bean powder 5g, corn powder 3g, peptone 3g, glucose 18g, magnesium sulfate 0.7g, potassium phosphate dibasic 1g, water 1L) at 5 blocks / bottle. After 8 days of culture at 20℃, the shake flask strain is obtained. (2) The shake flask strain obtained in (1) is inoculated into a fermentation tank at a volume ratio of 1% (the formula of each liter of fermentation liquor: white granulated sugar 20g, soybean protein powder 3.5g, magnesium sulfate 0.66g, potassium dihydrogen phosphate 0.66g). After 4 days of culture, the ZJJZG003 fermentation liquor is obtained.

[0113] After inoculation, the culture is carried out in the dark at 18-20℃ and air humidity of 50-60% for 20-30 days, and then the fruiting management is carried out.

[0114] 2. Comparison: the parent F24 and the parent W1 are subjected to the above inoculation cultivation operation respectively, and the inoculated fungus bags are cultured and fruiting is carried out on the adjacent shelves of the strain ZJJZG003 to obtain similar cultivation environment.

[0115] 3. Results: the time required from primordium appearance to harvesting of the parent F24 and the strain ZJJZG003 is observed and recorded, which is the time of the fruiting body growth. The days from inoculation to primordium appearance are also recorded. It is found that the primordium appearance time of ZJJZG003 is 4 days, which is 1 day earlier than that of the parent F24 and 2 days earlier than that of W1. The fruiting body growth time is 20 days, which is 2 days shorter than that of the parent F24 and 4 days shorter than that of W1, effectively shortening the production cycle. The fruiting body of the strain ZJJZG003 obtained is shown in Figure 5~37

[0116] Example 6: construction of InDel marker fingerprint of the strain ZJJZG003

[0117] By developing the insertion-deletion fingerprint, the strain ZJJZG003 of Flammulina velutipes is accurately and quickly distinguished from other Flammulina velutipes strains, and the genetic relationship analysis and variety definition are carried out.

[0118] ​1, Select one of each of the commercially available white and yellow strains of Flammulina velutipes to resequence, and use the obtained control resequenced genome as the reference genome for sequence analysis to design InDel primers, from which 192 pairs of primers are obtained for experiments. The primers are synthesized using the adapter method, that is, a 21 bp adapter sequence (GAAGGTGACCAAGTTCATGCT) is added to the upstream primer during synthesis. When using the adapter method for PCR amplification, the first step is to combine the adapter-labeled upstream primer with the downstream primer and the template to obtain a PCR product with an adapter sequence; the second step is to combine the adapter primer with a fluorescent group, the downstream primer, and the PCR product from the first step to obtain a PCR product with a fluorescent group and a 21 bp adapter sequence (the above steps are completed in one PCR system and program, and the PCR amplification program is set as: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 62~52℃ gradient annealing for 30 s, 72℃ extension for 30 s, running for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, running for 25 cycles; 72℃ extension for 20 min, and finally 4℃ storage. Commissioned to Wuhan Tianyi Huayu Gene Technology Co., Ltd.).

[0119] 2, Fluorescent PCR amplification

[0120] (1) 192 pairs of primers are screened from 8 samples

[0121] Select 8 commercially available Flammulina velutipes strain samples, amplify 192 pairs of primers, and perform the reaction on a Veriti 384 PCR instrument. The PCR amplification program is set as: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 52~62℃ gradient annealing for 30 s, 72℃ extension for 30 s, running for 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, running for 25 cycles; 72℃ extension for 20 min, and finally 4℃ storage. After the PCR reaction is completed, the amplification product is detected by fluorescent capillary electrophoresis.

[0122] Use GeneMarker software to analyze the results and obtain 33 pairs of primers with suitable polymorphism and stability.

[0123] (2) 33 pairs of primers are rescreened from 8 samples

[0124] The 33 pairs of primers screened in the previous step were re-screened, and the reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 62-52°C gradient annealing for 30 s, 72°C extension for 30 s, 10 cycles; 95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, 25 cycles; 72°C extension for 20 min, and finally 4°C storage. After the PCR reaction was completed, the amplification product was detected by fluorescence capillary electrophoresis. The results were analyzed using GeneMarker software, and 33 pairs of polymorphic primers were obtained.

[0125] (3) Strain identification:

[0126] The reaction was performed on a Veriti 384 PCR instrument. The PCR amplification program was set as: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 62-52°C gradient annealing for 30 s, 72°C extension for 30 s, 10 cycles; 95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, 25 cycles; 72°C extension for 20 min, and finally 4°C storage. After the PCR reaction was completed, the amplification product was detected by fluorescence capillary electrophoresis. The results were analyzed using GeneMarker software, and the allele number, peak map and genotype of each sample were obtained. The.fsa format raw data from the ABI3730xl instrument was classified and archived according to the detection sites, then imported into the GeneMarker analysis software, the genotype data was read, and the Excel genotype raw data and PDF typing peak map files were exported according to the site name.

[0127] The genotype peak map of the obtained strain ZJJZG003 with 33 pairs of InDel primers is shown in Figure 5~37 The horizontal coordinate of the fluorescence detection peak value map of capillary electrophoresis represents the fragment size, and the vertical coordinate represents the fluorescence signal strength. The peaks with numbers are the amplification products, and the numbers represent the band size. The remaining peaks are internal standards.

[0128] Strain ZJJZG003 amplification results: the results of amplifying strain ZJJZG003 with 33 pairs of InDel primers (primer information is shown in Table 1) are shown in Figure 42~44 As can be seen from the figure, the amplification results of strain ZJJZG003 with 33 pairs of InDel primers have significant specific bands;

[0129] Strain identification results: the JZGINDEL118 marker was used to amplify the parent white Tricholoma mongolicum W1, and the band was 280 bp. The band obtained by amplifying the yellow parent F24 was 280 bp, while the band obtained by amplifying strain ZJJZG003 was 280 bp and 285 bp, and the characteristic bands were different. The results are shown in Figure 5~37Therefore, it can be seen that when the strain to be tested is amplified using any one of the 33 primers listed in Table 1, the resulting amplification peak diagram is similar to... Figure 39 If the amplification peaks of the corresponding primers are inconsistent, the strain to be tested is not strain ZJJZG003. This allows for reliable identification of strain ZJJZG003.

[0130] Table 1. Amplification information of 33 InDel molecular markers for identifying strain ZJJZG003.

[0131]

[0132] Continued from Table 1

[0133]

[0134] 4. Cluster analysis

[0135] Genetic diversity analysis was performed on 49 *Flammulina velutipes* strains (S1~S60+ strain ZJJZG003) based on 33 polymorphic fragments amplified from InDel. A UPGMA clustering tree of the 49 *Flammulina velutipes* strains was constructed based on Nei genetic distance. Figure 39 ).from Figure 39 It can be seen that the 33 primer pairs provided by this invention clustered the *Flammulina velutipes* strain ZJJZG003 into a separate group. Therefore, the 33 InDel primer pairs provided by this invention can be used to differentiate the aforementioned 49 different *Flammulina velutipes* strains.

[0136] Example 7: Resistance identification of strain ZJJZG003 and parental F24

[0137] Using a punch, quantitatively measure 5mm diameter mycelial blocks (strain ZJJZG003 and parent F24) and inoculate them into the center of a 90mm diameter petri dish. PDA medium is added to the petri dish. The inoculated plates of strain ZJJZG003 and parent F24 are incubated at 5℃ and 35℃ respectively in the dark for 7 days. Then, the plates are incubated at 25℃ in the dark to observe the mycelial growth.

[0138] Result: From Figure 40 As can be seen from a to d, after plates cultured at 35℃ and 5℃ for 7 days were placed at 25℃ in the dark, both strain ZJJZG003 and parent F24 could resume normal growth. The mycelial growth rate of ZJJZG003 after treatment at 5℃ and 35℃ was faster than that of parent F24. This indicates that strain ZJJZG003 has better resistance to high and low temperatures than parent F24.

[0139] Example 8: Determination of disease resistance of strain ZJJZG003

[0140] Liu Chunli in February 2022 from China typical culture collection, purchased from the main diseases in the cultivation of golden needle mushroom: Trichoderma and Pseudomonas. With Trichoderma and Pseudomonas as indicator, confrontation culture was carried out, and the ability of ZJJZG003 to resist disease was judged by observing the growth of colonies and the width of antagonistic zone.

[0141] 1. Strain activation: the parent F24, strain ZJJZG003, Trichoderma and Pseudomonas strains were inoculated in PDA medium and cultured at 25°C, and the culture dishes were used after they were full. Before using the strains, a puncher with a diameter of 5mm was used to prepare a bacterial cake.

[0142] 2. Determination of resistance to Trichoderma and Pseudomonas: take the activated ZJJZG003 and parent F24 with a diameter of 5mm, inoculate 15mm from the center of the culture dish (diameter 90mm), cultivate at 25°C for 3 days, then inoculate Trichoderma and Pseudomonas at a distance of 30mm from the center of the golden needle mushroom, cultivate at 25°C for 3 days, then observe and measure the width of the antagonistic zone (R1) and the growth width of the colonies (RCK), and continuously observe the color and size changes of the inhibition zone. Each resistance experiment was set up with 3 repeats, and the growth was observed after 7d of cultivation as shown in a-d, and the results are shown in Tables 2-3: ​

[0143] Table 2 Inhibition rate of Trichoderma by ZJJZG003 and parent F24

[0144]

[0145] Table 3 Inhibition rate of Pseudomonas by ZJJZG003 and parent F24

[0146]

[0147] The results show that the inhibition rate of ZJJZG003 to Pseudomonas and Trichoderma is higher than that of parent F24, indicating that ZJJZG003 has stronger resistance to miscellaneous bacteria. And in the artificial cultivation test of multiple batches, the disease incidence is less than 5%. During the spore production period, the strain has fast eating speed and is not easy to be infected by miscellaneous bacteria, and has strong resistance to miscellaneous bacteria. Therefore, ZJJZG003 has strong disease resistance.

[0148] Example 9 Nutritional component analysis of strain ZJJZG003

[0149] According to the method in Example 5, the parent F24 and strain ZJJZG003 were cultured under the same conditions to harvest the fruiting bodies, and the obtained fruiting bodies were sent for nutrient component detection, and the results are shown in Tables 4-6.

[0150] Table 4 Amino acid content table of strain ZJJZG003 and parent F24 (unit: g / 100g) ​

[0151]

[0152] Table 5 Strain ZJJZG003 and parent F24 taste amino acid content table

[0153]

[0154] From the above table: the total amount of amino acid of strain ZJJZG003 is 8.55 g / 100 g, higher than the parent F24 of 8.10 g / 100 g. Among them, the total amount of taste amino acid of ZJJZG003 is higher, which is 6.21 g / 100 g, and the bitter amino acid content of strain ZJJZG003 is lower than the parent, which has the effect of improving the taste and increasing the fresh and sweet taste.

[0155] Table 6 Strain ZJJZG003 and parent F24 metal element and vitamin content table

[0156]

[0157] From the above table: the potassium, selenium and vitamin B1 of ZJJZG003 are higher than the parent F24, among which the selenium is 2.76 times of the parent.

[0158] Example 10 Strain ZJJZG003 and parent F24 stem texture structure analysis nutritional component analysis

[0159] Because the stem of the golden needle mushroom gradually thickens from top to bottom, and because the stems are pressed and deformed by each other, the stems of different varieties vary in thickening degree. When measuring the stem texture, the error is smaller and the influencing factors are fewer when measuring 1 / 5 place from the top of the stem. The measurement object and measurement index are shown in Table 7, and the test equipment is a texture analyzer (model: TA.TXExpress), and the software is Exponent Lite Express.

[0160] Table 7

[0161]

[0162] From the above table, it can be seen that the hardness of ZJJZG003 is higher than that of the parent and is also much higher than that of the commercially available white golden needle mushroom. The crispness of ZJJZG003 is 327.79, and the crispness of the other two subunit samples cannot be measured. The instrument measures the crispness only for samples with a crispy shell, and the software will automatically hide the measurement results for samples without this structure. The results in Table 7 are automatically displayed by the instrument. The elasticity of the commercially available white golden needle is the highest, the masticity is the energy required for chewing solid food, and the energy required for ZJJZG003 is the smallest, which is the easiest to chew. From the texture analysis results, it can be seen that ZJJZG003 is more brittle than the parent and commercially available white golden needle, requires less energy for chewing, and has a better hard and brittle taste.

[0163] Although the present application has been described in detail with reference to the foregoing embodiments, the technical solutions recorded in the foregoing embodiments can be modified, or some of the technical features can be replaced by equivalent features, by those skilled in the art, any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An InDel marker primer combination for identifying a white tricholoma strain ZJJZG003 with early maturity, high amino acid content and high brittleness, characterized in that, The preservation number of the strain ZJJZG003 is CGMCC NO.41175; the taxonomic name is Tricholoma populinum (Bond. et Sing.) Sing. Flammulina filiformis ) The sequence of the InDel marker primer combination is as follows: the sequence of INDEL004-F is shown as SEQ ID NO:2; the sequence of INDEL004-R is shown as SEQ ID NO:35; the sequence of INDEL012-F is shown as SEQ ID NO:3; the sequence of INDEL012-R is shown as SEQ ID NO:36; the sequence of INDEL013-F is shown as SEQ ID NO:4; the sequence of INDEL013-R is shown as SEQ ID NO:37; the sequence of INDEL016-F is shown as SEQ ID NO:5; the sequence of INDEL016-R is shown as SEQ ID NO:38; the sequence of INDEL018-F is shown as SEQ ID NO:6; the sequence of INDEL018-R is shown as SEQ ID NO:39; the sequence of INDEL025-F is shown as SEQ ID NO:7; the sequence of INDEL025-R is shown as SEQ ID NO:40; the sequence of INDEL026-F is shown as SEQ ID NO:8; the sequence of INDEL026-R is shown as SEQ ID NO:41; the sequence of INDEL027-F is shown as SEQ ID NO:9; the sequence of INDEL027-R is shown as SEQ ID NO:42; the sequence of INDEL028-F is shown as SEQ ID NO:10; the sequence of INDEL028-R is shown as SEQ ID NO:43; the sequence of INDEL029-F is shown as SEQ ID NO:11; the sequence of INDEL029-R is shown as SEQ ID NO:44; the sequence of INDEL031-F is shown as SEQ ID NO:12; the sequence of INDEL031-R is shown as SEQ ID NO:45; the sequence of INDEL034-F is shown as SEQ ID NO:13; the sequence of INDEL034-R is shown as SEQ ID NO:46; the sequence of INDEL038-F is shown as SEQ ID NO:14; the sequence of INDEL038-R is shown as SEQ ID NO:47; the sequence of INDEL042-F is shown as SEQ ID NO:15; the sequence of INDEL042-R is shown as SEQ ID NO:48; the sequence of INDEL043-F is shown as SEQ ID NO:16; the sequence of INDEL043-R is shown as SEQ ID NO:49; the sequence of INDEL050-F is shown as SEQ ID NO:17; the sequence of INDEL050-R is shown as SEQ ID NO:50;The sequence of INDEL051-F is set forth in SEQ ID NO: 18; the sequence of INDEL051-R is set forth in SEQ ID NO: 51; the sequence of INDEL075-F is set forth in SEQ ID NO: 19; the sequence of INDEL075-R is set forth in SEQ ID NO: 52; the sequence of INDEL078-F is set forth in SEQ ID NO: 20; the sequence of INDEL078-R is set forth in SEQ ID NO: 53; the sequence of INDEL082-F is set forth in SEQ ID NO: 21; the sequence of INDEL082-R is set forth in SEQ ID NO: 54; the sequence of INDEL101-F is set forth in SEQ ID NO: 22; the sequence of INDEL101-R is set forth in SEQ ID NO: 55; the sequence of INDEL107-F is set forth in SEQ ID NO: 23; the sequence of INDEL107-R is set forth in SEQ ID NO: 56; the sequence of INDEL118-F is set forth in SEQ ID NO: 24; the sequence of INDEL118-R is set forth in SEQ ID NO: 57; the sequence of INDEL125-F is set forth in SEQ ID NO: 25; the sequence of INDEL125-R is set forth in SEQ ID NO: 58; the sequence of INDEL145-F is set forth in SEQ ID NO: 26; the sequence of INDEL145-R is set forth in SEQ ID NO: 59; the sequence of INDEL147-F is set forth in SEQ ID NO: 27; the sequence of INDEL147-R is set forth in SEQ ID NO: 60; the sequence of INDEL166-F is set forth in SEQ ID NO: 28; the sequence of INDEL166-R is set forth in SEQ ID NO: 61; the sequence of INDEL169-F is set forth in SEQ ID NO: 29; the sequence of INDEL169-R is set forth in SEQ ID NO: 62; the sequence of INDEL170-F is set forth in SEQ ID NO: 30; the sequence of INDEL170-R is set forth in SEQ ID NO: 63; the sequence of INDEL174-F is set forth in SEQ ID NO: 31; the sequence of INDEL174-R is set forth in SEQ ID NO: 64; the sequence of INDEL177-F is set forth in SEQ ID NO: 32; the sequence of INDEL177-R is set forth in SEQ ID NO: 65; the sequence of INDEL188-F is set forth in SEQ ID NO: 33; the sequence of INDEL188-R is set forth in SEQ ID NO: 66; the sequence of INDEL191-F is set forth in SEQ ID NO: 34;The sequence of INDEL191-R is set forth in SEQ ID NO: 67.

Citation Information

Patent Citations

  • White needle mushroom JK01 strain and application thereof

    CN107227263A

  • Trichoderma-resistant white flammulina velutipes strain, method for screening same and cultivation material formula

    CN108330073A

  • High-brittleness white flammulina velutipes HJ120 and application thereof

    CN120230646A