Reagent composition, kit and extraction method for extracting single-stranded free DNA

By using a lysis binding solution and magnetic beads at room temperature, the problem of low extraction efficiency of ultrashort single-stranded free DNA in existing technologies has been solved, realizing a highly efficient and simple nucleic acid extraction process that is suitable for enzyme-free operation and liquid biopsy.

CN120944869APending Publication Date: 2025-11-14KUNPENG (XUZHOU) SCI INSTR CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510933434.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-07
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

The lack of effective methods in the current technology for enriching and extracting ultrashort single-stranded free DNA limits its application in nucleic acid detection, especially in non-invasive diagnosis and liquid biopsy, where it cannot achieve early diagnosis and repeated testing of samples.

Method used

A reagent composition comprising a lysis binding solution, including a flocculant, guanidine thiocyanate, Tris-HCl, EDTA, Triton X-100, trisodium citrate, Tween-20, and ethanol, is used to achieve efficient extraction of single-stranded free DNA by cleaving nucleic acids and binding them to magnetic beads at room temperature, combining hydrophobic interactions, hydrogen bonds, and electrostatic interactions.

Benefits of technology

It simplifies the operation process, shortens the extraction time, improves the enrichment rate of ultrashort single-stranded free DNA, ensures the quality of nucleic acid solutions and the accuracy of downstream detection, and is suitable for enzyme-free operation of biological samples such as plasma or urine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005490074330000071
    Figure BDA0005490074330000071
  • Figure BDA0005490074330000081
    Figure BDA0005490074330000081
  • Figure BDA0005490074330000101
    Figure BDA0005490074330000101
Patent Text Reader

Abstract

The invention provides a reagent composition, a kit and an extraction method for extracting single-stranded free DNA (deoxyribonucleic acid). The reagent composition comprises a cracking binding liquid reagent, wherein the cracking binding liquid reagent comprises a settling aid, guanidine thiocyanate, Tris-HCl, EDTA (Ethylene Diamine Tetraacetic Acid), Triton X-100, trisodium citrate, Tween-20 and ethanol. The kit comprises the reagent composition, can also comprise at least one of a magnetic bead suspension, a washing solution and an eluent, and can be used for enrichment and extraction of single-stranded free DNA in samples such as plasma. According to the method, the enrichment rate of the single-stranded free DNA can be greatly improved, and the method has a good application prospect in the fields of liquid biopsy and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a reagent composition, kit, and extraction method for extracting single-stranded cell-free DNA, belonging to the field of in vitro detection technology. Background Technology

[0002] Circulating free DNA (cfDNA) refers to DNA that exists outside cells in bodily fluids such as blood and urine. It contains double-stranded DNA fragments, the vast majority of which are short chains, and are usually present in very low concentrations. Studies have reported that under specific physiological conditions or during disease processes, a significant portion of cfDNA differs from that in healthy individuals. Based on this finding, cfDNA has been used for non-invasive diagnosis in recent years, particularly in prenatal screening, diagnosis and treatment of immune diseases, and cancer screening and treatment. In addition to containing relatively long double-stranded DNA (approximately 160 bp), cfDNA also contains a large amount of ultrashort single-stranded DNA (approximately 50 bp). Compared to longer cfDNA fragments, ultrashort cfDNA has several potential advantages, including better stability and greater tolerance to nuclease degradation. Enriching ultrashort single-stranded fragments is expected to improve the performance of cfDNA liquid biopsies. Furthermore, compared to commonly used invasive methods such as tissue biopsies, the analysis of cell-free nucleic acids can often achieve earlier diagnosis. Furthermore, the use of blood and urine as test samples makes it possible to collect and test samples repeatedly, which is beneficial for tracking and monitoring the development of the disease and the treatment process of tumors.

[0003] In molecular biology experiments, nucleic acid extraction is a fundamental and crucial step, and its quality directly impacts the success or failure of downstream nucleic acid detection, biological research, or the development of other new products. Currently, commonly used nucleic acid extraction methods include silica gel membrane column extraction and magnetic bead extraction. Silica gel membrane column extraction yields high-purity nucleic acids, but its efficiency for extracting small DNA or RNA fragments is low. Magnetic bead extraction uses superparamagnetic silica nanospheres (magnetic beads) as carriers. Nucleic acids are adsorbed by the magnetic beads, and after magnetic separation and impurity washing, the nucleic acids are released from the surface of the magnetic beads. This method eliminates the need for centrifugation, is simple to operate, and is suitable for high-throughput and automated operations. However, there are currently almost no methods available for extracting ultrashort single-stranded free DNA fragments. Therefore, improving existing magnetic bead extraction methods and developing a nucleic acid extraction and purification method capable of enriching ultrashort single-stranded free DNA fragments has become an urgent technical problem to be solved. Summary of the Invention

[0004] One object of the present invention is to provide a reagent composition for extracting single-stranded free DNA.

[0005] Another object of the present invention is to provide a kit for extracting single-stranded free DNA.

[0006] Another object of the present invention is to provide a method for extracting single-stranded free DNA.

[0007] This invention provides a reagent composition, kit, and extraction method for extracting single-stranded cell-free DNA. The extraction process simultaneously involves nucleic acid lysis and the binding of single-stranded cell-free DNA to magnetic beads, making the operation simpler and faster, and enabling efficient and rapid separation of high-purity single-stranded cell-free DNA from biological samples.

[0008] Specifically, on one hand, the present invention provides a reagent composition for extracting single-stranded cell-free DNA, the reagent composition comprising a lysis binding buffer reagent, the lysis binding buffer reagent comprising a flocculant, guanidine thiocyanate, Tris-HCl, EDTA, Triton X-100, trisodium citrate, Tween-20 and ethanol.

[0009] In some specific embodiments of the present invention, the lysis binding solution reagent needs to be prepared into a working solution when used, that is, the flocculant, guanidine thiocyanate, Tris-HCl, EDTA, Triton X-100, trisodium citrate, Tween-20 and ethanol are dissolved in water to prepare the lysis binding solution.

[0010] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA of the present invention, the flocculant is glycogen.

[0011] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA of the present invention, the working concentration of glycogen in the lysis binding buffer is 10 ng / mL to 100 ng / mL.

[0012] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA of the present invention, the working concentration of guanidine thiocyanate in the lysis binding buffer is 1 mol / L to 4 mol / L.

[0013] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA of the present invention, the working concentration of Tris-HCl in the lysis binding buffer is 5 mmol / L to 20 mmol / L.

[0014] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA of the present invention, the working concentration of EDTA in the lysis binding buffer is 5 mmol / L to 50 mmol / L.

[0015] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded cell-free DNA, the working concentration of Triton X-100 in the lysis binding buffer is 1% to 5% (v / v). It should be noted that this working concentration of 1% to 5% (v / v) is based on a commonly available commercially available 45% volume percentage Triton X-100 reagent. When using other concentrations of Triton X-100 reagent, the working concentration in the lysis binding buffer of the present invention can be determined by calculating the specific concentration of each reagent.

[0016] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA, the working concentration of trisodium citrate in the lysis binding buffer is 10 mmol / L to 50 mmol / L. The trisodium citrate can be anhydrous trisodium citrate or its hydrate.

[0017] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded cell-free DNA, the working concentration of Tween-20 in the lysis binding buffer is 1% to 5% (v / v). It should be noted that this working concentration of 1% to 5% (v / v) is based on a commonly available commercially available 35% volume percentage of Tween-20 reagent. When using other concentrations of Tween-20 reagent, the working concentration in the lysis binding buffer of the present invention can be determined by calculating the specific concentration of the Tween-20 reagent.

[0018] According to a specific embodiment of the present invention, in the reagent composition for extracting single-stranded free DNA, the working concentration of ethanol in the lysis binding buffer is 20% to 60%. The ethanol is preferably anhydrous ethanol.

[0019] On the other hand, the present invention also provides a kit for extracting single-stranded cell-free DNA, the kit comprising the reagent composition for extracting single-stranded cell-free DNA described in the present invention.

[0020] According to a specific embodiment of the present invention, the kit for extracting single-stranded free DNA of the present invention, in addition to including the lysis binding reagent described above, also includes at least one of magnetic bead suspension, washing solution and elution solution.

[0021] According to a specific embodiment of the present invention, in the kit for extracting single-stranded cell-free DNA, the magnetic bead suspension comprises silanol magnetic beads with an average particle size of 100–600 nm, a concentration of 400–600 mg / ml, and a pH of 5–8. Preferably, the solvent for the magnetic bead suspension is enzyme-free, sterile, and oxygen-free water.

[0022] According to a specific embodiment of the present invention, in the kit for extracting single-stranded cell-free DNA, the washing solution comprises Tris-HCl and ethanol. Preferably, the concentration of Tris-HCl in the washing solution is 1 mmol to 10 mmol, and the concentration of ethanol is 50% to 80%. Preferably, the solvent of the washing solution is enzyme-free sterile water.

[0023] According to a specific embodiment of the present invention, in the kit for extracting single-stranded cell-free DNA, the elution buffer comprises Tris-HCl and EDTA. Preferably, in the elution buffer, the concentration of Tris-HCl is 5 mmol / L to 15 mmol / L, and the concentration of EDTA is 1 mmol / L to 5 mmol / L. Preferably, the solvent of the elution buffer is enzyme-free sterile water.

[0024] On the other hand, the present invention also provides the application of the reagent composition for extracting single-stranded cell-free DNA or the kit for extracting single-stranded cell-free DNA in the extraction of single-stranded cell-free DNA from a sample. Preferably, the sample is a biological sample, such as any feasible sample containing cell-free DNA suitable for molecular in vitro diagnostic testing, including but not limited to blood, plasma, serum, or urine.

[0025] On the other hand, the present invention provides a method for extracting single-stranded cell-free DNA, the method comprising the steps of:

[0026] S1. Take a sample of ultrashort single-stranded free DNA to be extracted, add the lysis binding solution in the reagent composition for extracting single-stranded free DNA described in this invention, and add the magnetic bead suspension in the kit for extracting single-stranded free DNA described in this invention. Mix well and incubate.

[0027] S2. Place the system after incubation in step S1 on a magnetic rack and let it stand until the magnetic beads are completely adsorbed. Discard the liquid. Add washing solution, mix well, and let it stand until the magnetic beads are completely adsorbed. Discard the liquid.

[0028] S3. Add elution buffer to the magnetic bead system after the liquid was removed in step S2, mix well and incubate; place on a magnetic rack and let stand until the magnetic beads are completely adsorbed, then transfer the solution to a new container to obtain a nucleic acid solution containing extracted single-stranded free DNA.

[0029] According to a specific embodiment of the present invention, in step S1 of the method for extracting single-stranded cell-free DNA, preferably, the sample is a biological sample, including but not limited to blood, plasma, serum or urine, etc., which contain cells with cell-free DNA and are suitable for molecular in vitro diagnostic testing.

[0030] According to a specific embodiment of the present invention, in the method for extracting single-stranded free DNA of the present invention, in step S1, preferably, the magnetic bead suspension is the aforementioned magnetic bead suspension of the present invention.

[0031] According to a specific embodiment of the present invention, in step S1 of the method for extracting single-stranded free DNA, preferably, 0.2 mL to 3 mL of lysis binding buffer and 10 μL to 30 μL of magnetic bead suspension are added to every 0.1 mL to 1 mL of sample.

[0032] According to a specific embodiment of the present invention, in step S1 of the method for extracting single-stranded free DNA, preferably, the incubation temperature is room temperature and the incubation time is 5 min to 15 min.

[0033] According to a specific embodiment of the present invention, in the method for extracting single-stranded free DNA of the present invention, in step S2, the time for each settling until the magnetic beads are completely adsorbed is typically 30 to 60 seconds.

[0034] According to a specific embodiment of the present invention, in step S2 of the method for extracting single-stranded free DNA, the washing solution is preferably the washing solution of the present invention described above.

[0035] According to a specific embodiment of the present invention, in step S3 of the method for extracting single-stranded free DNA, the elution buffer is preferably the aforementioned elution buffer of the present invention.

[0036] According to a specific embodiment of the present invention, in step S3 of the method for extracting single-stranded cell-free DNA, preferably, 30 μL to 100 μL of elution buffer is added to every 0.1 mL to 1 mL of starting sample, and the mixture is shaken to mix for 10 to 30 seconds.

[0037] According to a specific embodiment of the present invention, in step S3 of the method for extracting single-stranded free DNA, the incubation temperature is preferably room temperature and the incubation time is 5 min to 10 min.

[0038] According to a specific embodiment of the present invention, in the method for extracting single-stranded free DNA of the present invention, the time for standing until the magnetic beads are completely adsorbed in step S3 can be 1 min to 2 min.

[0039] In this invention, unless otherwise specified, the room temperature usually refers to the range of 15°C to 25°C.

[0040] In this invention, unless otherwise specified, the solvent for each solution is enzyme-free sterile water.

[0041] The present invention provides a reagent composition, kit, and extraction method for extracting single-stranded cell-free DNA. The extraction process is enzyme-free, simultaneously performing nucleic acid lysis and binding of single-stranded cell-free DNA to magnetic beads. This effectively promotes the binding of single-stranded cell-free DNA, especially ultra-short single-stranded cell-free DNA, in samples (such as plasma or urine) to the magnetic beads. In the extraction system of this invention, nucleic acids specifically bind to the magnetic beads through hydrophobic interactions, hydrogen bonding, and electrostatic interactions, without binding to other impurities. Further washing removes impurities from the sample, ensuring the quality of the extracted nucleic acid solution to better meet downstream detection requirements. Furthermore, the extraction method of this invention is simple to operate and requires no heating; nucleic acids in the sample can be rapidly and completely separated from nucleic acid-binding proteins at room temperature, releasing the nucleic acids. In addition, the extraction method of this invention has simple operating steps, with the overall extraction time typically not exceeding half an hour, greatly shortening the extraction time and simplifying operating conditions. This invention can significantly improve the enrichment rate of single-stranded cell-free DNA and has good application prospects in fields such as liquid biopsy. Attached Figure Description

[0042] Figure 1 This shows the amplification results of the single-stranded products extracted using the kit for extracting single-stranded cell-free DNA of the present invention.

[0043] Figure 2 The display shows the amplification results of the single-stranded product extracted using reference kit 1.

[0044] Figure 3 The results show the amplification of the single-stranded product extracted using reference kit 2.

[0045] Figure 4 The results show the amplification of the single-stranded product extracted using reference kit 3.

[0046] Figure 5 The display shows the amplification results of the single-stranded product extracted using the lysis binding solution ① of the present invention.

[0047] Figure 6 The results show the amplification of the single-chain product extracted using the reference lysis binding buffer ②.

[0048] Figure 7 The results show the amplification of the single-chain product extracted using the reference lysis binding buffer ③.

[0049] Figure 8 The display shows the amplification results of the single-stranded product extracted using the reference lysis binding buffer ④.

[0050] Figure 9 The display shows the amplification results of the single-chain product extracted using the reference lysis binding buffer ⑤. Detailed Implementation

[0051] The technical solutions in the embodiments of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.

[0052] In the examples, all original reagents and materials were commercially available. Experimental methods not specifically described were conventional methods and conditions well-known in the field, or as recommended by the instrument manufacturer. The structural formula of the glycogen used in the examples is (C6H). 10 O5)n, molecular weight 666.5777.

[0053] Unless otherwise specifically defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art in the relevant field.

[0054] Example 1:

[0055] This embodiment provides a kit for extracting single-stranded free DNA, comprising:

[0056] (1) Lysis binding solution: The lysis binding solution consists of: 3 mol / L guanidine thiocyanate, 15 mmol / L Tris-HCl, 5 mmol / L EDTA, 50 ng / mL glycogen; 45% Triton X-100 at 2.92% (v / v) volume percentage, 35% Tween-20 at 2.92% (v / v) volume percentage, 20 mmol / L trisodium citrate dihydrate, 50% anhydrous ethanol, and enzyme-free sterile water as the solvent.

[0057] (2) Washing solution: 6 mmol / L Tris-HCl, 80% anhydrous ethanol, and enzyme-free sterile water as solvent.

[0058] (3) Magnetic bead suspension: The magnetic beads are selected from silanol magnetic beads with an average particle size of about 350 nm, a concentration of 400 mg / ml, pH 7.5, and the solvent is enzyme-free, sterile, oxygen-free water.

[0059] (4) Eluent: 10mM Tris-HCl, 1mM EDTA, with enzyme-free sterile water as the solvent.

[0060] The kit provided in this embodiment is used to extract ultrashort single-stranded cell-free DNA for the detection of J and K subgroup avian leukosis virus, including the following steps:

[0061] S1. Take 0.5 mL of plasma or urine sample and add it to a centrifuge tube. Add 1 mL of lysis binding buffer and 20 μL of magnetic bead suspension (the ratio of sample to lysis binding buffer is 1:2). Mix well and incubate at room temperature for 10 min.

[0062] S2. Impurity removal and washing steps: Place the centrifuge tube from step S1 on a magnetic rack, invert it to rinse the cap and tube wall to remove any remaining magnetic beads, then let it stand for 45 seconds until the magnetic beads are completely adsorbed, and discard the liquid; place the centrifuge tube on a magnetic rack, add 1 mL of washing solution, invert it to mix 8 to 10 times, let it stand for 45 seconds until the magnetic beads are completely adsorbed, and discard the liquid.

[0063] S3. Nucleic acid elution: Remove the centrifuge tube from the magnetic rack, add 60 μL of elution buffer to the centrifuge tube, vortex to mix for 20 seconds, and incubate at room temperature for 8 minutes, vortexing once during the incubation period; place the centrifuge tube on the magnetic rack and let it stand for 1.5 minutes until the magnetic beads are completely adsorbed, then transfer the nucleic acid solution to a new nuclease-free centrifuge tube to obtain the nucleic acid solution, which can be used for downstream detection or stored for later use.

[0064] Example 2: Comparison of the extraction effect of the extraction kit and extraction method of the present invention with other commercially available extraction kits.

[0065] The extraction kit and extraction method of Example 1 of this invention were used, and the VAHTS Serum / PlasmaCirculating DNA Kit (catalog number N913), CWE9600 cfDNA Kit (catalog number CW2533s), and Magnetic Bead Free DNA Extraction Kit (catalog number: NMG2611-100) were used as reference kits to extract ultra-short single-stranded cfDNA from the same amount of sample (using four single-stranded gene fragments of 40-70 bp in length to simulate single-stranded cfDNA). The extraction method of the reference kits is as shown in their instructions.

[0066] 2 μL of cell-free DNA extracted from the kit in Example 1 and the reference kit (the amount of sample to be extracted and the total amount of extracted product were the same for both methods, for comparison) were used as templates for qPCR experiments. Each sample was set up in 4 replicates, and the average Ct value was taken. The PCR amplification program shown in Table 1 was used.

[0067] Table 1 Amplification Procedure

[0068]

[0069] The upstream and downstream primer and probe sequences for the four genes RUN / KIA / SEP / TFP are shown in Table 2.

[0070] Table 2 Primer and probe sequences for four target genes.

[0071] KIA-F CGTTGCGTTTCGCGTCGC(SEQ ID No.1) KIA-R GCGCCTCTACCGATCCTCCT(SEQ ID No.2) KIA-P AAATCCCGCCCTACCTA(SEQ ID No.3) SEP-F TTTTCGTTGAGAGCGTCGC(SEQ ID No.4) SEP-R CCCCACGTAAACGACGCG(SEQ ID No.5) SEP-P CACGAAACCGAAAAC(SEQ ID No.6) TFP-F GTTGGCGTTGTTTTCGTAGTTTCC(SEQ ID No.7) TFP-R CCGTTACTACTACGACAAAT(SEQ ID No.8) TFP-P CTACCGCCAATTCCTA(SEQ ID No.9) RUN-F CGTTGTTTTAAAAGGTTCGCGC(SEQ ID No.10) RUN-R GAATCCAATCGCGACACCAAA(SEQ ID No.11) RUN-P AAAAACGAAACCGACC(SEQ ID No.12)

[0072] The Ct values ​​for the detection of simulated single-stranded cfDNA in 200 μL plasma samples using four sets of extraction reagents are shown in Table 3. For a detailed comparison of amplification curves, see [link to table]. Figures 1 to 4 (The fluorescence detection channels corresponding to the four genes KIA, SEP, TFP, and RUN are FAM, CY5, ATTO, and ROX channels, respectively). The results show that, compared to the recovery rate of the reference kit, the ultrashort single-stranded cfDNA extracted by the kit and method in Example 1 of this invention has a significantly higher content of ultrashort single-stranded cfDNA.

[0073] Table 3. Results (Ct values) of ultrashort single-stranded cfDNA extracted using different kits.

[0074]

[0075] Note: The single-stranded plasmid concentration in the sample column of Table 3 is the copy number of each gene in a 50 μL plasmid sample.

[0076] The above experimental results show that the average Ct values ​​of ultrashort cell-free DNA extracted using the kit and method of Example 1 of this invention were 27.33, 30.09, 29.99, and 29.87, respectively. In contrast, the average Ct values ​​for reference kit 1 were 37.26, 34.32, none, and 39.01; for reference kit 2, 35.15, 34.04, none, and 38.02; and for reference kit 3, 33.82, 34.05, 35.57, and 36.49. Compared with conventional cfDNA extraction methods in the prior art, the method of this invention for extracting single-stranded cell-free DNA can achieve an extraction rate approximately 5 Ct values ​​earlier, with a significantly higher recovery rate than the reference kit. Furthermore, the method demonstrates superior stability and uniformity compared to the reference kit, highlighting the superiority of this invention in the extraction of nucleic acids from ultrashort single-stranded cell-free DNA.

[0077] Example 3: Comparison of extraction effects of different lysis binding solutions

[0078] The kit and method for extracting single-stranded free DNA according to the present invention, wherein the kit comprises:

[0079] (1) The lysis binding solution ① consists of: 3 mol / L guanidine thiocyanate, 15 mmol / L Tris-HCl, 5 mmol / L EDTA, 50 ng / mL glycogen; 2.92% (v / v) of Triton X-100 with a volume percentage of 45%, 2.92% (v / v) of Tween-20 with a volume percentage of 35%, 20 mmol / L of trisodium citrate dihydrate, and 50% anhydrous ethanol, with enzyme-free sterile water as the solvent.

[0080] (2) Washing solution: 6 mmol Tris-HCl, 80% anhydrous ethanol, and enzyme-free sterile water as the solvent.

[0081] (3) Magnetic bead suspension: selected from silanol magnetic beads with an average particle size of 350 nm, a concentration of 400 mg / ml, pH 5-8, and enzyme-free, sterile, oxygen-free water as the solvent.

[0082] (4) Eluent: 10mM Tris-HCl, 1mM EDTA, with enzyme-free sterile water as the solvent.

[0083] In the kit for reference lysis binding solutions, the washing buffer, magnetic bead suspension, and elution buffer have the same components as those in the kit for extracting single-stranded free DNA of the present invention. The components of each reference lysis binding solution are as follows:

[0084] The lysis binding buffer ② consisted of: 5 mol / L guanidine thiocyanate, 10 mmol / L Tris-HCl, 5 mmol / L EDTA, 100 μmol / L glycogen, 150 mmol / L sodium iodide; 45% Triton X-100 (2.92% v / v), 35% Tween-20 (2.92% v / v), 15 mmol / L trisodium citrate dihydrate, and 40% anhydrous ethanol, with enzyme-free sterile water as the solvent.

[0085] The lysis binding solution ③ consists of: 2 mol / L guanidine thiocyanate, 200 mmol / L sodium iodide, and 60% anhydrous ethanol, with enzyme-free sterile water as the solvent.

[0086] The lysis binding buffer ④ consists of: 2.5 mol / L guanidine thiocyanate, 5 mmol / L Tris-HCl, 2.5 mmol / L EDTA, 50 μmol / L glycogen, 150 mmol / L sodium iodide; 2.92% (v / v) Triton X-100 (volume percentage of 20%), 2.92% (v / v) Tween-20 (volume percentage of 15%), 5 mmol / L trisodium citrate dihydrate, 40% anhydrous ethanol, 35 mmol / L sodium hydroxide, and enzyme-free sterile water as the solvent.

[0087] The lysis binding solution ⑤ consists of: 1.5 mol / L guanidine thiocyanate, 150 mmol / L sodium iodide, 60 mmol / L sodium hydroxide, and 40% anhydrous ethanol, with enzyme-free sterile water as the solvent.

[0088] Two mL of single-stranded cell-free DNA extracts obtained using the kits with the five different lysis and binding buffers described above (the samples to be extracted consisted of two single-stranded gene fragments simulating single-stranded cfDNA, and the extraction method was the same as in Example 1) were used as templates for qPCR experiments. Four replicates were set for each sample, and the average Ct value was taken. The PCR amplification program shown in Table 1 was used.

[0089] The upstream and downstream primer and probe sequences for the two genes RUN and REF (both related to cancer screening and treatment) are shown in Table 4.

[0090] Table 4 Primer and probe sequences for two target genes

[0091] REF-M-F AATGAAGATTAAGGTGGG(SEQ ID No.13) REF-M-R CAACTCCCCACACACCACAAA(SEQ ID No.14) REF-M-P CCTACCCAAATCAACTCAA(SEQ ID No.15) RUN-F CGTTGTTTTAAAAGGTTCGCGC(SEQ ID No.10) RUN-R GAATCCAATCGCGACACCAAA(SEQ ID No.11) RUN-P AAAAACGAAACCGACC(SEQ ID No.12)

[0092] The Ct values ​​for the detection of simulated single-stranded cfDNA in 200 μL plasma samples using five different lysis binding buffers are shown in Table 5. A detailed comparison of amplification curves is provided below. Figures 5 to 9 (The fluorescence detection channels corresponding to the REF and RUN genes are the FAM channel and the ROX channel, respectively). The results show that, compared with the recovery rates of the other four lysis binding solutions, the ultrashort single-stranded cfDNA extracted with lysis binding solution ① in Example 3 of this invention has a significantly higher content of ultrashort single-stranded cfDNA than that extracted with the other four lysis binding solutions.

[0093] Table 5. Results of extraction of ultrashort single-stranded cfDNA using different lysis binding solutions (Ct values)

[0094]

[0095] Note: The single-stranded plasmid concentration in the sample column of Table 5 is the copy number of each gene in a 40 μL plasmid sample.

[0096] The above experimental results show that the average Ct values ​​for REF / RUN gene extraction using the kit with lysis binding buffer ① in Example 3 were 31.64 and 32.33, respectively; the average Ct values ​​for extraction using lysis binding buffer ② were 33.93 and 33.17; the average Ct values ​​for extraction using lysis binding buffer ③ were 35.67 and 33.05; the average Ct values ​​for extraction using lysis binding buffer ④ were 33.25 and 33.87; and the average Ct values ​​for extraction using lysis binding buffer ⑤ were 33.3 and 32.53. Compared with the other four lysis binding buffers of different concentrations, the kit and extraction method using lysis binding buffer ① of the present invention extract cfDNA approximately 2-4 Ct values ​​earlier, exhibiting the best extraction recovery rate, stability, and uniformity, highlighting the superiority of the present invention in the extraction of nucleic acids from ultrashort single-stranded cell-free DNA.

[0097] Therefore, it can be seen that the reagent composition, kit, and extraction method for extracting single-stranded cell-free DNA described in this invention can achieve high efficiency and uniformity in the extraction of ultrashort single-stranded cell-free DNA, thereby ensuring the accuracy and reliability of subsequent detection results.

[0098] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A reagent composition for extracting single-stranded cell-free DNA, the reagent composition comprising a lysis binding buffer reagent, the lysis binding buffer reagent comprising a flocculant, guanidine thiocyanate, Tris-HCl, EDTA, Triton X-100, trisodium citrate, Tween-20, and ethanol.

2. The reagent composition for extracting single-stranded free DNA according to claim 1, wherein, The settling aid is glycogen.

3. The reagent composition for extracting single-stranded free DNA according to claim 2, wherein, The working concentration of the glycogen in the lysis binding solution is 10 ng / mL to 100 ng / mL.

4. The reagent composition for extracting single-stranded free DNA according to any one of claims 1 to 3, wherein, The working concentrations of each component in the lysis binding solution reagent in the lysis binding solution are as follows: The concentration of guanidine thiocyanate is 1 mol / L to 4 mol / L. The concentration of Tris-HCl is 5 mol / L to 20 mmol / L. The concentration of EDTA is 5 mmol / L to 50 mmol / L. The concentration of Triton X-100 is 1% to 5% (v / v). The concentration of trisodium citrate is 10 mmol / L to 50 mmol / L. The concentration of Tween-20 is 1% to 5% (v / v). The concentration of ethanol is 20% to 60%.

5. A kit for extracting single-stranded cell-free DNA, the kit comprising the reagent composition for extracting single-stranded cell-free DNA according to any one of claims 1 to 4, and further comprising at least one of a magnetic bead suspension, a washing solution, and an elution solution.

6. The kit for extracting single-stranded cell-free DNA according to claim 5, wherein, The magnetic bead suspension includes silanol magnetic beads with a particle size of 100–600 nm, a concentration of 400–600 mg / ml, and a pH of 5–8.

7. The kit for extracting single-stranded free DNA according to claim 5, wherein, The washing solution includes Tris-HCl and ethanol; Preferably, in the washing solution, the concentration of Tris-HCl is 1 mmol / L to 10 mmol / L, and the concentration of ethanol is 50% to 80%.

8. The kit for extracting single-stranded free DNA according to claim 5, wherein, The eluent comprises Tris-HCl and EDTA; Preferably, in the eluent, the concentration of Tris-HCl is 5 mmol / L to 15 mmol / L, and the concentration of EDTA is 1 mmol / L to 5 mmol / L.

9. The use of the reagent composition for extracting single-stranded cell-free DNA according to any one of claims 1 to 4 or the kit for extracting single-stranded cell-free DNA according to any one of claims 5 to 8 in extracting single-stranded cell-free DNA from a sample.

10. A method for extracting single-stranded cell-free DNA, the method comprising the steps of: S1. Take a sample of single-stranded free DNA to be extracted, add the lysis binding solution in the reagent composition for extracting single-stranded free DNA according to any one of claims 1 to 4, and add the magnetic bead suspension in the kit for extracting single-stranded free DNA according to any one of claims 5 to 8, mix well and incubate. S2. Place the system after incubation in step S1 on a magnetic rack and let it stand until the magnetic beads are completely adsorbed. Discard the liquid. Add washing solution, mix well, and let it stand until the magnetic beads are completely adsorbed. Discard the liquid. S3. Add elution buffer to the magnetic bead system after the liquid was removed in step S2, mix well and incubate; place on a magnetic rack and let stand until the magnetic beads are completely adsorbed, then transfer the solution to a new container to obtain a nucleic acid solution containing extracted single-stranded free DNA.