Preparation method and application of universal CAR-T cell

Abstract

The invention provides a preparation method and application of a universal CAR-T cell. The universal CAR-T cell expresses a chimeric antigen receptor aiming at a cell surface antigen. And the universal CAR-T cell simultaneously expresses shRNA (short hairpin Ribonucleic Acid) of the targeted TCR alpha. And the chimeric antigen receptor and the shRNA of the targeted TCR alpha are started by different promoters for transcription. According to the shRNA of the targeted TCR alpha expressed by the universal CAR-T cell, the expression of TCR alpha mRNA can be greatly reduced, so that the formation of a CD3-TCR complex is inhibited, and the effect of inhibiting generation of allogeneic reactivity (GVHD effect) is achieved.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a method for preparing universal CAR-T cells and their application. Background Technology

[0002] T-cell adoptive immunotherapy is a promising approach for cancer treatment. This immunotherapy utilizes genetically modified isolated human T cells to enhance their specificity for specific tumor-associated antigens. Genetic modification can involve the expression of chimeric antigen receptors or exogenous T-cell receptors to specifically transplant antigens onto T cells. Compared to exogenous T-cell receptors, the specificity of chimeric antigen receptors derives from the variable domains of monoclonal antibodies. Therefore, T cells expressing chimeric antigen receptors (CAR T cells) induce tumor immune reactivity in a major histocompatibility complex-free manner. T-cell adoptive immunotherapy has been used clinically for many cancers, including B-cell malignancies, multiple myeloma, neuroblastoma, glioblastoma, advanced glioma, ovarian cancer, mesothelioma, melanoma, prostate cancer, and pancreatic cancer.

[0003] While CAR T cells hold potential use as a cancer treatment, adoptive immunotherapy with CAR T cells is partly limited by the expression of endogenous T cell receptors on the cell surface. CAR T cells expressing endogenous T cell receptors can recognize major and minor histocompatibility antigens after administration to allogeneic patients, which can lead to the development of graft-versus-host disease (GVHD). Therefore, clinical trials have primarily focused on using autologous CAR T cells, in which a patient's T cells are isolated, genetically modified to incorporate chimeric antigen receptors, and then re-infused into the same patient. The autologous approach provides immune tolerance to the administered CAR T cells; however, this approach is limited by both the time and cost required to generate patient-specific CAR T cells after the patient has been diagnosed with cancer.

[0004] Therefore, there is a need to develop universal T cells prepared using T cells from healthy third-party donors for T cell adoptive immunotherapy. Summary of the Invention

[0005] Currently, standard CAR-T therapy requires obtaining a sufficient quantity of autologous T cells from the patient for CAR-T transformation, which is time-consuming, labor-intensive, and expensive. For newborns, the elderly, and some patients with weakened immune systems, obtaining a sufficient quantity of qualified T cells for subsequent CAR-T transformation is even more challenging. To make CAR-T therapy more readily available, there is an urgent need to develop a universal human CAR-T, where the T cells used for transformation originate from healthy individuals, but the resulting CAR-T cells can be used for various patients. Healthy donors have a large number of peripheral blood T cells with high viability, making CAR-T preparation and cell expansion relatively easy. If this technology could replace autologous CAR-T cells in cancer patients, it would significantly reduce the CAR-T cell preparation cycle and treatment costs.

[0006] The main obstacle to using allogeneic CAR-T cells in cancer treatment lies in immune rejection, a process called host antigen graft rejection, which significantly limits the anti-tumor function of allogeneic CAR-T cells. Another issue is that allogeneic CAR-T cells may recognize host tissue as foreign, leading to graft-versus-host disease (GvHD), which can cause severe tissue damage and death. Currently, allogeneic CAR-T cell technology mainly relies on gene editing platforms to create site-specific double-strand breaks at specific locations in the genome (such as TCR and HLA), and then repair them through non-homologous end joining (NHEJ) or homologous directed recombination repair (HDR). This allows for targeted knockout of genes (TCR and HLA molecules, etc.) from T cells in healthy individuals' blood, thereby attenuating or eliminating the resulting graft-versus-host disease (GvHD). Currently, there are three mature gene editing technologies: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and regularly spaced short palindromic repeat clusters (CRISPR). However, all of these technologies require gene editing of T cells. Because the gene editing enzyme fragments required by these technologies are relatively large, they can only be used through electrotherapy transduction. Electrotherapy can damage T cells. Furthermore, gene editing modifies related genes at the gene level, which carries unknown risks and off-target risks. There are also other unavoidable problems such as gene editing efficiency. The inventors designed polynucleotide molecules that target or downregulate the expression of the TCRα gene and developed a non-gene-edited universal CAR-T cell, thus solving the problems of existing technologies.

[0007] In one aspect, a polynucleotide molecule is provided, comprising a nucleotide sequence as shown in SEQ ID NO:8 or SEQ ID NO:9, or a complement thereof. In one embodiment, the polynucleotide molecule targets or downregulates the expression of the TCRα gene.

[0008] In one implementation, the polynucleotide molecule is an shRNA molecule.

[0009] On one hand, an expression cassette is provided, which contains the polynucleotide molecule described herein and a first promoter operatively linked to the polynucleotide molecule.

[0010] In one embodiment, the first promoter is selected from the U6 promoter, U61 promoter, U69 promoter, and H1 promoter. In one embodiment, the U6 promoter comprises the nucleotide sequence shown in SEQ ID NO:7.

[0011] In one embodiment, the expression cassette further comprises a polynucleotide encoding a chimeric antigen receptor and a second promoter operatively linked to the polynucleotide.

[0012] In one implementation, the second promoter is selected from the CMV and EF1a promoters.

[0013] In one embodiment, the expression cassette comprises, from the 5' end to the 3' end, a first promoter, the polynucleotide molecule according to claim 1, a second promoter, and a polynucleotide encoding a chimeric antigen receptor.

[0014] In one embodiment, the chimeric antigen receptor includes a signal peptide, an antigen-binding domain, a transmembrane domain, a co-stimulatory domain, and a signal transduction domain.

[0015] In one embodiment, the signal peptide is a CD8 precursor.

[0016] In one embodiment, the expression cassette contains the CD8 precursor nucleotide sequence as shown in SEQ ID NO:1.

[0017] atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg

[0018] ccg(SEQ ID NO:1).

[0019] In one implementation, the transmembrane domain is CD8α.

[0020] In one embodiment, the expression cassette comprises a CD8α nucleotide sequence as shown in SEQ ID NO:3:

[0021] accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg

[0022] tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg

[0023] gacttcgcct gtgatatcta catctgggcg cccttggccg ggacttgtgg ggtccttctc

[0024] ctgtcactgg ttatcaccct ttactgc (SEQ ID NO: 3).

[0025] In one implementation, the co-stimulatory domain is CD28 or 4-1BB.

[0026] In one embodiment, the expression cassette comprises a CD28 nucleotide sequence as shown in SEQ ID NO:4:

[0027] aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc

[0028] gggcccaccc gcaagcatta ccagccctat gccccacccac gcgacttcgc agcctatcgc

[0029] tcc(SEQ ID NO:4).

[0030] In one embodiment, the expression cassette comprises a 4-1BB nucleotide sequence as shown in SEQ ID NO:5:

[0031] aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa

[0032] actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggaggatgt

[0033] gaactg (SEQ ID NO:5).

[0034] In one implementation, the signal transduction domain is CD3ζ.

[0035] In one embodiment, the expression cassette comprises a signal transduction domain nucleotide sequence as shown in SEQ ID NO:6:

[0036] agagtgaagt tcagcaggag cgcagagccc cccgcgtacc agcagggcca gaaccagctc

[0037] tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc

[0038] cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat

[0039] gaactgcaga aagataagat ggcggaggcc tacagtgaga ttggggatgaa aggcgagcgc

[0040] cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc

[0041] tacgacgccc ttcacatgca ggccctgccc cctcgctaa (SEQ ID NO: 6).

[0042] In one embodiment, the chimeric antigen receptor targets a surface antigen selected from the group consisting of: Mesothelin, GD2, CD171, CD19, CD20, BCMA, GPC3, TERT, PTEN, PD-1, PD-L1, NKG2D ligand, CD44v6, FR, CD138, PSMA, NY-ESO, EGFR, CEA, HER2, CD22, CD30, CD123, CD5, CD7, CD33, CEA, EGFR, BRAF, HER-2, MUC1, PSCA, GPC3, or VEGF.

[0043] On one hand, a vector is provided that contains a polynucleotide molecule or an expression cassette as described herein.

[0044] In one implementation, the vector is a viral vector.

[0045] In one implementation, the vector is a lentiviral vector or an adeno-associated virus vector.

[0046] On the one hand, viruses are provided that contain the polynucleotide molecules, expression cassettes, or vectors described herein.

[0047] In one implementation, the virus is a lentivirus or an adeno-associated virus.

[0048] In one aspect, T cells are provided that comprise the polynucleotide molecules, expression cassettes, vectors, or viruses described herein. In one embodiment, the T cells are T cells for adoptive immunotherapy, universal T cells, or universal CAR-T cells.

[0049] In one aspect, compositions are provided comprising the polynucleotide molecules described herein, the expression cassettes described herein, the vectors described herein, the viruses described herein, or the T cells described herein.

[0050] In one embodiment, the composition is a pharmaceutical composition. In one embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient, or diluent. In one embodiment, the composition is a kit.

[0051] In one aspect, a method for preparing T cells as described herein is provided, comprising introducing the polynucleotide molecule, expression cassette, vector, or virus described herein into T cells to reduce TCRα gene expression or reduce T cell immune rejection.

[0052] In one implementation, the method includes one or more of the following steps: 1) viral vector construction; 2) lentiviral packaging using 293T cells; 3) PBMC isolation; 4) T cell activation; 5) lentiviral transfection of activated T cells; 6) CAR-T cell culture, sorting, and flow cytometry detection of CAR positivity and CD3 positivity before and after sorting; 7) cell killing assay of the universal CAR-T cells obtained after sorting; and 8) detection of the inhibitory effect of universal CAR-T cells on allogeneic reactivity in a mouse model.

[0053] In one aspect, the use of the T cells or compositions described herein in the preparation of medicaments for the treatment and / or prevention of cancer is provided. In one embodiment, the cancer is selected from liver cancer, bladder cancer, various types of leukemia, multiple myeloma and malignant lymphoma, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, head and neck cancer, multiple squamous cell tumors, esophageal cancer, colorectal cancer, melanoma, osteosarcoma, rectal cancer, anal cancer, bile duct cancer, uterine cancer, ovarian cancer, gastric cancer, prostate cancer, meningioma, pancreatic cancer, breast cancer, and medulloblastoma.

[0054] In one aspect, methods for treating and / or preventing cancer in a subject are provided, comprising administering the T cells or compositions described herein to the subject. In one embodiment, the cancer is selected from liver cancer, bladder cancer, various types of leukemia, multiple myeloma and malignant lymphoma, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, head and neck cancer, multiple squamous cell tumors, esophageal cancer, colorectal cancer, melanoma, osteosarcoma, rectal cancer, anal cancer, bile duct cancer, uterine cancer, ovarian cancer, gastric cancer, prostate cancer, meningioma, pancreatic cancer, breast cancer, and medulloblastoma. The subject may be a mammal, preferably a human.

[0055] The advantages of this invention include:

[0056] (1) It provides a polynucleotide molecule that can effectively target the TCRα gene or downregulate the expression of the TCRα gene;

[0057] (2) It provides expression cassettes, vectors and viruses containing the polynucleotide molecules described herein, which facilitate the development of universal T cells;

[0058] (3) This invention utilizes viral infection of T cells, followed by direct cell sorting to obtain pure, universal CAR-T cells, eliminating the need for gene editing; and

[0059] (4) The process of preparing universal CAR-T cells in this invention avoids the off-target effects of gene editing and the damage to cells caused by electric shock, simplifies the production process, saves production costs, and has great application value in the field of tumor immune cell therapy. Attached Figure Description

[0060] Figure 1 This is a schematic diagram of the universal CAR structure of the present invention and a regular CAR.

[0061] Figure 2 This is an agarose gel electrophoresis image of the double-enzyme digestion product of the universal CAR-T vector (containing the shRNA1 coding sequence) of the present invention. M: 1kb DNA marker; 1: recombinant plasmid digestion product; 2: pLenti-MCS-EF1-GFP lentiviral expression plasmid; 3: universal CAR structural target fragment.

[0062] Figure 3 This is a flow cytometry analysis image. Figure 3The results showed that before sorting, universal CAR-T cells (shRNA1) accounted for 56.81% of the total number of T cells, while after sorting, universal CAR-T cells (shRNA1) accounted for 96.72% of the total number of T cells; before sorting, universal CAR-T cells (shRNA2) accounted for 65.59% of the total number of T cells, while after sorting, universal CAR-T cells (shRNA2) accounted for 96.60% of the total number of T cells.

[0063] Figure 4 This is a flow cytometry graph showing the expression levels of TCRα / β. Compared to the TCRα / β expression in uninfected T cells (78.78%) and in conventional anti-MSLN CAR-T cells (79.29%), the expression rates of TCRα / β in universal anti-MSLN CAR-T cells (sorted universal CAR-T cells shRNA1 and shRNA2) were significantly reduced (41.68% and 45.19%, respectively). Both universal CAR-T cells with different shRNAs showed good inhibitory effects on TCR, and shRNA1 in sorted universal CAR-T cells was superior to shRNA2.

[0064] Figure 5 This is a flow cytometry analysis image. Figure 5 The study demonstrated that CAR-T cells specifically killed MSLN-targeting tumor cells (SKOV3), but had no killing effect on tumor cells that did not express MSLN targets (ES-2).

[0065] Figure 6 This is a kill efficiency curve obtained through RTCA detection. Figure 6 The image shows the killing effect of universal CAR-T cells on SKOV3 cells (bottom panel) but not on ES2 cells (top panel).

[0066] Figure 7 This is a bar chart showing the IFNγ factor detected by ELISA 24 hours after ES2 or SKOV3 cell cytotoxicity. The universal CAR-T cells of this invention, when co-cultured with SKOV3 cells, secrete large amounts of IFNγ factor.

[0067] Figure 8 This diagram illustrates the inhibitory effect of allogeneic reactivity (GVHD) in a mouse model. Mice injected with uninfected T cells and ordinary anti-MSLN CAR-T cells exhibited significant GVHD effects, including severe facial hair loss, red and swollen eyes leading to blindness. Conversely, injection of universal anti-MSLN CAR-T cells did not produce a GVHD effect. Detailed Implementation

[0068] The following definitions are provided to enable those skilled in the art to understand the invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice of testing the invention, preferred materials and methods are described herein. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0069] As used herein, the term "polynucleotide molecule" is a chain-like compound composed of nucleotides. Nucleotide monomers can be nucleotides or deoxynucleotides. Polynucleotide molecules can encompass both DNA and RNA molecules. There is no particular limitation on the length of a polynucleotide molecule. Polynucleotide molecules can be 15–50 nucleotides long, for example, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, and 49 nucleotides. In this article, a polynucleotide molecule may refer to shRNA or a polynucleotide molecule encoding shRNA.

[0070] As used herein, the term "shRNA" or "short hairpin RNA" refers to an artificial RNA molecule containing a hairpin that can be used to silence gene expression via RNA interference. The term "hairpin" is also used herein to refer to a stem-loop structure. A "stem-loop structure" refers to a nucleic acid having a secondary structure comprising a nucleotide region known or predicted to form a double strand (stem portion) attached to one side of a predominantly single-stranded nucleotide region (loop portion). As is well known in the art, the secondary structure does not require precise base pairing. Therefore, the stem may contain one or more base mismatches. Alternatively, the base pairing may be precise (i.e., without any mismatches).

[0071] As used herein, “complementarity” refers to the ability of two nucleotides on one or two oligomeric strands to precisely pair. For example, if a nucleotide at a position in an antisense polynucleotide can hydrogen-bond with a nucleotide at a position in a target nucleic acid, which is a DNA, RNA, or oligonucleotide molecule, then the hydrogen-bonded position between the oligonucleotide and the target nucleic acid is considered a complementary position. Oligonucleotides and other DNA, RNA, or oligonucleotide molecules are complementary when a sufficient number of complementary positions in each molecule are occupied by nucleotides that can hydrogen-bond with each other. Therefore, “specific hybridization” and “complementarity” are terms used to indicate a sufficient degree of precise pairing or complementarity on a sufficient number of nucleotides that results in a stable and specific binding between the oligonucleotide and the target nucleic acid.

[0072] As used herein, a "chimeric antigen receptor" or "CAR" refers to a modified receptor that confers or transfers antigen specificity to immune effector cells (e.g., human T cells). A chimeric antigen receptor comprises at least an extracellular ligand-binding domain or portion, a transmembrane domain, and an intracellular domain comprising one or more signal transduction domains and / or co-stimulatory domains. The extracellular ligand-binding domain or portion may be an antibody or antibody fragment. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fv (sdFv), Fd fragments consisting of VH and CH1 domains, or linear antibodies. The extracellular ligand-binding domain or portion may be in the form of a single-chain variable fragment (scFv) derived from a monoclonal antibody, providing specificity for a particular epitope or antigen. The scFv may be attached via a linker sequence. The scFv may be murine, humanized, or fully human. Intracellular stimulatory domains may include one or more cytoplasmic signaling domains that activate the transmission of signals to T cells upon antigen binding. Intracellular stimulatory domains may also include one or more intracellular co-stimulatory domains that transmit proliferation and / or cell survival signals upon ligand binding. Intracellular co-stimulatory domains may be those known in the art, including but not limited to 4-1BB (CD137), CD27, CD28, CD8, OX40, CD30, CD40, etc. Chimeric antigen receptors also include additional structural elements, including transmembrane domains attached to extracellular ligand-binding domains via hinge or spacer sequences, such as subunits of T cell receptors, such as the CD8α domain. The hinge region refers to any polynucleotide or polypeptide that serves to connect the transmembrane domain to the extracellular ligand-binding domain. The hinge region may be derived entirely or partially from naturally occurring molecules, such as all or part of the extracellular region derived from CD8, CD4, or CD28.

[0073] As used herein, “exogenous T-cell receptor” or “exogenous TCR” refers to a TCR sequence introduced into the genome of an immune effector cell (e.g., human T cells) that may or may not express the TCR endogenously. Expression of an exogenous TCR on immune effector cells can confer specificity for a particular epitope or antigen (e.g., an epitope or antigen present on the surface of cancer cells). Exogenous T-cell receptors may contain both an α-chain and a β-chain.

[0074] As used herein, the term "T cell receptor α gene" or "TCRα gene" refers to the gene locus in T cells that encodes the T cell receptor α subunit. The sequence of the T cell receptor α gene is known in the art.

[0075] As used herein, the terms “expression cassette” and “chimeric construct,” “construct,” and “recombinant DNA fragment” are used interchangeably and refer to single-stranded or double-stranded polynucleotides. Such expression cassettes can be used alone or in conjunction with a vector.

[0076] As used herein, a “vector” or “recombinant DNA vector” can be a construct comprising a replication system and sequence capable of transcribing and translating polypeptide-coding sequences in a given host cell. If a vector is used, the choice of vector depends on the method to be used for transforming the host cell, as is well known to those skilled in the art. Vectors can include, but are not limited to, viral vectors, such as recombinant lentiviral vectors or AAV vectors. Those skilled in the art are well aware that a vector must contain genetic elements necessary for successful transformation, selection, and propagation.

[0077] As used herein, “human T cell” or “T cell” refers to a T cell isolated from a donor (especially a human donor). T cells and cells derived therefrom include isolated T cells that have not been passaged in culture, T cells that have been passaged and maintained under cell culture conditions without immortalization, and T cells that have been immortalized and can be maintained indefinitely under cell culture conditions.

[0078] The term "effective function" refers to a specific function of a cell. For example, the effector function of T cells can be cytolytic activity or helper activity, including the secretion of cytokines.

[0079] Polynucleotides

[0080] The polynucleotide molecules described herein can target or downregulate the TCRα gene in T cells. The T cells of this invention reduce TCRα gene expression, thereby reducing immune rejection and lowering the risk of graft-versus-host disease (GvHD) in allogeneic T cells.

[0081] The polynucleotide molecule can be an shRNA molecule with a nucleotide sequence as shown in SEQ ID NO:8 (named shRNA1)(cgaagagaggagtacgatgtt) or a nucleotide sequence as shown in SEQ ID NO:9 (named shRNA2)(cttgttcctgagagtgaagtt). shRNA molecules can target the TCRα gene, reduce the expression of TCRα mRNA, and thereby inhibit the formation of the CD3-TCR complex, thus achieving the effect of inhibiting allogeneic reactivity (GVHD effect).

[0082] The polynucleotide molecule can be a nucleic acid molecule encoding a shRNA molecule (such as a complement of the nucleotide sequence shown in SEQ ID NO:8 or SEQ ID NO:9). The nucleic acid molecule may have a sequence complementary to SEQ ID NO:8 or SEQ ID NO:9. The amino acid sequence of the nucleic acid molecule from the 5' end to the 3' end may be anticomplementary to SEQ ID NO:8 or SEQ ID NO:9.

[0083] The polynucleotide molecules described herein may comprise a nucleotide sequence of SEQ ID NO:8 or SEQ ID NO:9 after one or more nucleotides (e.g., 1-8, such as 2, 3, 4, 5, 6, or 7) have been added, deleted, substituted, and / or inserted, or a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, or 95% sequence identity with SEQ ID NO:8 or SEQ ID NO:9, provided that the obtained polynucleotide molecule retains the function of targeting the TCRα gene or reducing the expression of TCRα mRNA.

[0084] Expression Box

[0085] An expression cassette may contain a polynucleotide molecule and a promoter that directs the polynucleotide molecule. The polynucleotide molecule and the promoter are operatively linked, allowing the promoter to effectively direct the expression of the polynucleotide molecule. The type of promoter can be determined by those skilled in the art based on the polynucleotide molecule being directed. For example, the polynucleotide molecule may encode an shRNA molecule. In this case, the promoter may be selected from the U6 promoter, U61 promoter, U69 promoter, and H1 promoter. For example, the U6 promoter may contain the nucleotide sequence shown in SEQ ID NO:7. The polynucleotide molecule may also encode a chimeric antigen receptor. In this case, the promoter may be selected from the CMV and EF1a promoters. The expression cassette may contain a first promoter, a polynucleotide molecule encoding shRNA, a second promoter, and a polynucleotide molecule encoding a chimeric antigen receptor from the 5' end to the 3' end. The expression cassette may contain a first expression cassette and a second expression cassette. The first and second expression cassettes may be linked or separate. The first expression cassette may contain a first promoter and a polynucleotide molecule encoding shRNA. The second expression cassette may contain a second promoter and a polynucleotide molecule encoding a chimeric antigen receptor. The expression box may also contain other adjustment elements, such as terminators.

[0086] SEQ ID NO:7:

[0087] Gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagag

[0088] Ataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtaga

[0089] Aagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcat

[0090] Atgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggac.

[0091] Chimeric antigen receptor

[0092] Chimeric Antigen Receptor T-Cell Immunotherapy (CAR-T immunotherapy) is a novel cellular immunotherapy technology that has rapidly developed in recent years. Based on the theory of immune system recognition and activation, it uses genetic engineering to artificially overexpress single-chain antibody variable region gene fragments on the surface of T cells that recognize specific tumor surface antigens. This allows T cells to recognize specific antigens and kill target cells expressing those antigens. The core theoretical basis of CAR-T immunotherapy is the recognition and activation of T lymphocytes. It primarily involves different scFvs recognizing different specific antigens on tumor cells, and then transmitting signals through the hinge and transmembrane region of the CD8 molecule to the CD28 or 4-1BB and TCR co-stimulatory activation region within the T lymphocyte membrane. This activates the body's own T lymphocytes, allowing them to specifically attack and kill the recognized tumor cells. Furthermore, because CAR-T cells use an antibody-based antigen recognition model, they are not subject to MHC restrictions.

[0093] CAR-T immunotherapy has achieved unprecedented success in the treatment of hematologic malignancies. Since the first CAR-T drug for hematologic malignancies was approved for marketing in 2017, five CAR-T drugs for hematologic malignancies have been approved by the FDA, and one has been introduced and marketed in China.

[0094] The chimeric antigen receptor described herein comprises at least an extracellular ligand-binding domain or portion, a transmembrane domain, and an intracellular domain comprising one or more signal transduction domains and / or co-stimulatory domains. The extracellular ligand-binding domain or portion may be an antibody or an antibody fragment. In this paper, the antibody fragment may be an scFv antibody fragment targeting MSLN. However, it should be understood that the extracellular ligand-binding domain or portion may be a binding moiety targeting any suitable antigen. The chimeric antigen receptor may target surface antigens selected from the group consisting of: Mesothelin, GD2, CD171, CD19, CD20, BCMA, GPC3, TERT, PTEN, PD-1, PD-L1, NKG2D ligand, CD44v6, FR, CD138, PSMA, NY-ESO, EGFR, CEA, HER2, CD22, CD30, CD123, CD5, CD7, CD33, CEA, EGFR, BRAF, HER-2, MUC1, PSCA, GPC3, or VEGF. The chimeric antigen receptor described herein may further include a CD8 precursor as a signal peptide; preferably, the CD8 precursor nucleotide sequence shown in SEQ ID NO:1. The chimeric antigen receptor described herein may further include CD8α as a transmembrane domain; preferably, it includes the CD8α nucleotide sequence shown in SEQ ID NO:3. The chimeric antigen receptor described herein may further include a CD28 or 4-1BB co-stimulatory domain; preferably, the CD28 nucleotide sequence shown in SEQ ID NO:4 or the 4-1BB nucleotide sequence shown in SEQ ID NO:5. The chimeric antigen receptor described herein may further include a CD3ζ signal transduction domain; preferably, the signal transduction domain nucleotide sequence shown in SEQ ID NO:6.

[0095] carrier

[0096] Constructs or expression cassettes can be delivered using known transfection and / or transduction vectors, including but not limited to lentiviral vectors, adeno-associated viruses, etc. Lentiviral vectors are a preferred vector type, capable of delivering large amounts of viral nucleic acid into host cells. Lentivirals are characterized by their unique ability to infect / transduce non-dividing cells, and after transduction, they integrate their nucleic acid into the host cell's chromosome, but are not themselves replicable. Lentivirals have three major genes encoding packaging proteins: gag, pol, and vsv-g, as well as two regulatory genes, tat and rev.

[0097] Lentiviral vector systems or lentivirus particles

[0098] Lentiviral virions (particles) are expressed by a vector system encoding essential viral proteins to produce non-replicating lentiviral virions (viral particles). At least one vector exists containing a nucleic acid sequence encoding a lentiviral pol protein essential for reverse transcription and integration, operatively linked to a promoter. For example, the pol protein is expressed by multiple vectors. Vectors containing a nucleic acid sequence encoding a lentiviral gag protein, essential for forming a viral capsid operatively linked to a promoter, may also exist. This gag nucleic acid sequence may be located on a vector different from at least some of the pol nucleic acid sequences. The gag nucleic acid may be located on a vector separate from all the pol nucleic acid sequences encoding the pol protein.

[0099] The gag-pol, rev, and vsv-g vectors contain nucleotides of the lentiviral genome that package lentiviral RNA, called the lentiviral packaging sequence. As described above, lentiviral vector systems typically include at least two to three helper plasmids containing at least one of the gag, pol, or rev genes. Each of the gag, pol, and rev genes can be provided on a separate plasmid, or one or more genes can be provided together on the same plasmid. The gag, pol, and rev genes are provided on the same or separate plasmids, while vsv-g is provided on a single plasmid.

[0100] T cells

[0101] The T cells of this invention are infused with a polynucleotide molecule targeting the TCRα gene and exhibit reduced TCRα expression. Compared to control T cells without the infused polynucleotide molecule, the TCRα expression of the T cells of this invention can be reduced by at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, or 70%. The T cells of this invention are particularly suitable for adoptive immunotherapy and can be used as universal T cells or universal CAR-T cells.

[0102] The T cells of the present invention can be prepared by the following method, which includes introducing the polynucleotide molecules, expression cassettes, vectors, or viral particles described herein into the T cells, thereby reducing TCRα gene expression or reducing T cell immune rejection. Specifically, the method includes one or more of the following steps: 1) viral vector construction; 2) lentiviral packaging using 293T cells; 3) PBMC isolation; 4) T cell activation; 5) lentiviral transfection of activated T cells; 6) CAR-T cell culture, sorting, and flow cytometry detection of CAR positivity and CD3 positivity before and after sorting; 7) cell killing assay of the universal CAR-T cells obtained after sorting; and 8) detection of the inhibitory effect of universal CAR-T cells on allogeneic reactivity in a mouse model.

[0103] Methods and uses

[0104] The T cells of this invention can be used to treat various cancers. Those skilled in the art can readily determine the type of cancer for CAT-T cell therapy based on the chimeric antigen receptor expressed by the T cells. Cancers include, but are not limited to, liver cancer, bladder cancer, various types of leukemia, multiple myeloma, malignant lymphoma, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, head and neck cancer, multiple squamous cell tumors, esophageal cancer, colorectal cancer, melanoma, osteosarcoma, rectal cancer, anal cancer, bile duct cancer, uterine cancer, ovarian cancer, gastric cancer, prostate cancer, meningioma, pancreatic cancer, breast cancer, and medulloblastoma. The treatment methods of this invention may include administering CAT-T cells to cancer patients. This invention also provides the use of CAT-T cells in the preparation of pharmaceuticals or kits for treating cancers, such as one or more of the cancers listed above.

[0105] Example

[0106] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. The content mentioned in the embodiments is not intended to limit the present invention.

[0107] This invention provides a gene-edit-free universal CAR-T cell, its preparation method, and its application. The specific scheme is as follows: It includes the separate preparation of a chimeric antigen receptor and a TCRα knockdown element. Gene synthesis and sequencing were performed by Shanghai Sangon Biotech Co., Ltd. The synthesized insertion sequences were inserted into the pLenti-MCS-EF1-GFP plasmid. This expression vector includes: an EF1a promoter; the insertion site of the foreign gene; a WPRE element; an SV40 polyA sequence; regulatory elements such as promoters and enhancers; and key elements such as lentiviral packaging elements. This lentiviral expression vector can serve as the most effective vector for expressing the target gene in almost all mammalian cells, including both non-dividing and dividing cells. It can accommodate a large foreign gene fragment, has high transfection efficiency, and achieves satisfactory transfection results even in T cells.

[0108] Example 1: Preparation method and application of universal CAR-T cells targeting MSLN

[0109] The full-length chimeric antigen receptor nucleotide sequence (SEQ ID NO:10) is as follows:

[0110]

[0111]

[0112] The full-length chimeric antigen receptor amino acid sequence (SEQ ID NO:11) is as follows:

[0113] MALPVTALLL PLALLLHAAR PMAQVQLQQS GPELVRPGVS VKISCKGSGY

[0114] TFTDYAMHWV KQSHARSLEW IGVISTYNGN INYNQKFKGK ATMTVDKSSS

[0115] TAYMELARLT SEDSAIYYCA RGGYDGTGFD YWGQGTTVTV SSGGGGSGGG

[0116] GSGGGGSDIE LTQSPAIMSA SPGEKVTMTC SASSSISYMH WYQQKPGTPP

[0117] KRWIYDTSKL ASGVPARFSG SGSGTSYSLT LSSMEAEDVA TYYCQQWSSP

[0118] PTFGVGTKLE LKRTTTPAPR PPTPAPTIAS QPLSLLRPEAC RPAAGGAVHT

[0119] RGLDFACDIY IWAPLAGTCG VLLLSLVITL YRSKRSRLLH SDYMNMTPRR

[0120] PGPTRKHYQP YAPPRDFAAY RSKRGRKKLL YIFKQPFMRP VQTTQEEDGC

[0121] SCRFPEEEEG GCELRVKFSR SAEPPAYQQG QNQLYNELNL GRREEYDVLD

[0122] KRRGRDPEMG GKPRRKNPQE GLYNELQKDK MAEAYSEIGM KGERRRGKGH

[0123] DGLYQGLSTA TKDTYDALHM QALPPR

[0124] The promoter 2 nucleotide sequence (SEQ ID NO:12) is as follows:

[0125] gggcagagcg cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgat

[0126] ccggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc

[0127] gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc

[0128] tttttcgcaa cgggtttgcc gccagaacac ag

[0129] The synthesis and sequencing of the chimeric antigen receptor targeting MSLN and the polynucleotides targeting the TCRα gene (SEQ ID NO:8 or SEQ ID NO:9) were performed by Shanghai Sangon Biotech Co., Ltd. A schematic diagram of the inserted sequence is shown below. Figure 1The sequence is shown in SEQ ID NO:2. Two insert sequences were constructed: one containing promoter 1, a polynucleotide encoding TCRαshRNA (shRNA1 or shRNA2), promoter 2, and a polynucleotide encoding CAR (universal CAR); the other containing a promoter and a polynucleotide encoding CAR, used as a control (ordinary CAR). The sequence of the MSLN single-chain antibody is shown in SEQ ID NO:1. The polynucleotide encoding the chimeric antigen receptor includes the signal peptide sequence shown in SEQ ID NO:1, an antigen-binding domain, a membrane domain shown in SEQ ID NO:3, co-stimulatory domains shown in SEQ ID NO:4 and SEQ ID NO:5, and a signal transduction domain shown in SEQ ID NO:6. The first promoter is the U6 promoter, used to initiate the expression of eukaryotic TCRαshRNA, and its nucleotide sequence is shown in SEQ ID NO:7.

[0130] The sequence of MSLN single-chain antibody

[0131]

[0132] The synthesized insert sequence was inserted into the pLenti-MCS-EF1-GFP plasmid (purchased from ALSTEM, catalog number: LV010), transformed into competent DH5α cells, and plated on agar plates containing ampicillin. Multiple clones were picked from the agar plates and inoculated into 5 ml of liquid LB medium (containing ampicillin) and cultured on a shaker at 37°C and 250 rpm for 12-16 h.

[0133] Plasmid extraction was performed according to the instructions of the plasmid mini-prep kit (catalog number: DP103-03) purchased from Tiangen Biotech Co., Ltd. Each cloned plasmid (pLenti-MCS-EF1-GFP plasmid with a universal CAR or ordinary CAR polynucleotide sequence inserted) was sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing to verify the accuracy of the inserted sequence. Based on the sequencing data provided by Shanghai Sangon Biotech Co., Ltd., the bacterial culture with the correct sequence was selected for mass inoculation in shake flasks. Expression vector plasmids were extracted using the endotoxin-free plasmid large-scale extraction kit from MN. Concentration and purity were measured using a spectrophotometer. The extracted expression vector plasmids were then double-digested with AgeI-HF (purchased from NEB, catalog number: R3552S) and BsrGI (purchased from NEB, catalog number: R3575S) and verified by agarose gel electrophoresis. Figure 2 Finally, the expression vector plasmid was sent to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing to verify the accuracy of the inserted sequence.

[0134] Three packaging plasmids (pPACKH1-GAG, pPACKH1-REV, and pVSV-G) were extracted using the MN endotoxin-free plasmid extraction kit (purchased from SBI, catalog number: LV550A-1). Concentration and purity were measured using a spectrophotometer. Lentiviral packaging was performed using a four-plasmid packaging system. The four plasmids were a lentiviral expression plasmid containing a universal CAR structure, and the lentiviral packaging plasmids pPACKH1-GAG, pPACKH1-REV, and pVSV-G (purchased from SBI, catalog number: LV550A-1). 293T cells were used.

[0135] The specific implementation steps are as follows:

[0136] (1) Plating within 24 hours before transfection: Generally, cells with a passage number of no more than 3 times are selected. The cell density is adjusted according to the cell growth density and state. 293T cells with a growth density of 80% are then plated.

[0137] (2) Once the growth density reaches 60-90% and the cells are in good condition, virus packaging can be carried out;

[0138] (3) Use lentiviral packaging plasmids pPACKH1-GAG, pPACKH1-REV and pVSV-G, as well as the lentiviral plasmids constructed in this paper, and perform lentiviral plasmid preparation according to the plasmid instructions.

[0139] (4) The transfection reagent used is lipofectamine 2000 (stored at 4℃), and the amount added is 2μL / μg plasmid;

[0140] (5) Mix the plasmid mixture in (3) and the transfection reagent mixture in (4) into one tube, let it stand at room temperature for 20 min, then add it to the cells in the medium and continue culturing;

[0141] (6) Collect the culture supernatant after 48h and 72h respectively, and filter it through a 0.45μm filter membrane;

[0142] (7) The collected viral fluid was concentrated using the PEG8000 concentration method, and the viral titer was determined by infecting 293T cells and by subsequent flow cytometry detection of the CAR positivity of infected 293T cells. The virus was stored at -80℃ for later use.

[0143] Example 2: PBMC isolation, T cell activation, lentiviral infection and cell sorting

[0144] 1. PBMC separation

[0145] 1) Collect 6ml of human peripheral blood (for research purposes);

[0146] 2) Dilution: Add an equal volume of PBS at room temperature and gently mix by pipetting.

[0147] 3) Sample addition: Take a 50mL centrifuge tube, add 6mL of Ficoll (lymphocyte separation solution) into the centrifuge tube (the volume ratio of Ficoll to the blood before dilution is 1:1), tilt the centrifuge tube at 45°, and slowly add the diluted blood about 1cm above the Ficoll liquid surface along the tube wall.

[0148] 4) Centrifugation: 18-20℃, 2000rpm, 30min. After centrifugation, the liquid will separate into four layers from the bottom of the tube to the surface: red blood cells and granulocytes, layered liquid, mononuclear cells, and plasma.

[0149] 5) Recovery: Insert the pipette directly into the cloud layer (or first aspirate the upper layer of plasma), gently aspirate the cloud layer, and place it into a new centrifuge tube;

[0150] 6) Washing: Add at least 3 times the volume of PBMCs (peripheral blood mononuclear cells) in PBS, 18-20℃, 2000 rpm, 10 min, twice;

[0151] 7) Cell Counting: Discard the supernatant, add 1 mL of lymphocyte culture medium, mix well by pipetting, and prepare a PBMC cell suspension. Count using a hemocytometer: Mix one drop of PBMC suspension with one drop of 2% trypan blue staining solution and add to a hemocytometer. Count the total number of cells within 4 large squares under a microscope. Cell count / mL = Total number of cells in 4 large squares / 4 × 10⁻⁶ 4 ×2 (dilution factor).

[0152] 2. T cell activation, lentiviral infection, and cell sorting

[0153] Day -1: 24-well plate coating: Take a Corning 24-well plate. Taking 2 wells as an example, add 175 μL of CD3 monoclonal antibody (concentration: 5 μg / ml, purchased from Tongli Haiyuan, catalog number: GMP-TL101) and 175 μL of CD28 monoclonal antibody (concentration: 5 μg / ml, purchased from Tongli Haiyuan, catalog number: GMP-TL102) to each well. After adding, gently vortex to mix, seal the plate with sealing film, and place it in a 4°C refrigerator overnight. Cell resuscitation: Take PBMC cells from liquid nitrogen and resuscitate them.

[0154] Day 0: Cleaning the coated plate: Remove the 24-well plate coated on Day -1, discard the supernatant, wash twice with PBS, and then add PBS for later use;

[0155] PBMC plating: Collect PBMC cells, count them, and finally adjust the concentration to 5 × 10⁻⁶. 6 Add 400 μL of cell suspension to each well, i.e., add 2 × 10⁶ cells / mL.6 One cell;

[0156] Viral infection: Infection was performed with MOI=5. 1 mL of virus culture medium suspension was prepared, added to a 24-well plate, and centrifuged at 1000g for 30 min. The centrifuge temperature was adjusted to 32℃.

[0157] Days 1-2: Observe cell status;

[0158] Day 3: Transfer all cells from the 24-well plate to a 75cm² culture flask containing 20mL of culture medium and observe the cell status;

[0159] Day 9: Cell status and number were observed. Cells were centrifuged and resuspended, and CAR-T cells were incubated with biotin-labeled MSLN CAR antibody (Biotinylated Human Mesothelin; purchased from ACRO, catalog number: MSN-H82E9). Biotin-positive cells, i.e., MSLN CAR-positive cells, were then sorted using anti-biotin beads and a magnetic sorting column. The MSLN CAR and CD3 positivity rates before and after sorting were detected by flow cytometry. Figure 3 The sorted cells are then universal CAR-T cells targeting MSLN, which can be used for subsequent experiments such as cell killing detection or cell cryopreservation.

[0160] Example 3: Identification and detection of CAR-T cells obtained before and after sorting

[0161] 1. Detect the positive expression rate of CAR structures and the TCRα / β expression rates of shRNA1 and shRNA2 in two types of universal CAR-T cells after sorting.

[0162] 1) The obtained negative control (NC) group cells (not infected with the virus) and sample group cells (infected with the virus prepared in Example 1, as prepared in Example 2) were gently washed twice with PBS + 2% BSA at 1500 rpm / 6 min, and the waste liquid was discarded.

[0163] 2) Add 200 μL of PBS to the NC tube and resuspend; add 100 μL of PBS to the sample tube, resuspend, and then add 100 μL of primary antibody (i.e., Biotinylated Human Mesothelin; purchased from ACRO, catalog number: MSN-H82E9) working solution (3 μg / mL) and mix well;

[0164] 3) Incubate at room temperature for 1 hour, 1500 rpm / 3 min, then discard the waste liquid;

[0165] 4) Add 200 μL PBS, mix gently and resuspend, 1500 rpm / 3 min, then discard the waste liquid;

[0166] 5) Add 200 μL of PBS to the NC tube and resuspend; add 200 μL of PBS to the sample tube, resuspend, then add 5 μL of secondary antibody (i.e., APC-conjugated streptavidin, purchased from Biolegend, catalog number: 405207) working solution and mix well;

[0167] 6) After incubating at room temperature in the dark for 1 hour, centrifuge at 1500 rpm for 3 min, discard the waste liquid, wash gently 3 times with PBS + 2% BSA, centrifuge at 1500 rpm for 3 min, and discard the waste liquid.

[0168] 7) Add 100 μL of PBS, mix gently, resuspend, and then perform detection on the instrument (purchased from ACEA, model: NovoCyte D3000).

[0169] like Figure 3 As shown, before sorting, universal CAR-T cells (shRNA1) accounted for 56.81% of the total T cells, and after sorting, universal CAR-T cells (shRNA1) accounted for 96.72% of the total T cells; before sorting, universal CAR-T cells (shRNA2) accounted for 65.59% of the total T cells, and after sorting, universal CAR-T cells (shRNA2) accounted for 96.60% of the total T cells.

[0170] like Figure 4 As shown, compared to the TCRα / β expression in uninfected T cells (78.78%) and conventional anti-MSLN CAR-T cells (79.29%), the TCRα / β expression rates in universal anti-MSLN CAR-T cells (sorted universal CAR-T cell shRNA1 and shRNA2) were significantly reduced (41.68% and 45.19%, respectively). Both universal CAR-T cells with different shRNAs showed good inhibitory effects on TCR, and shRNA1 from sorted universal CAR-T cells was superior to shRNA2. Therefore, shRNA1 from sorted universal CAR-T cells was selected for further experimental validation.

[0171] Example 4: Real-time Cell Killing Detection Using RTCA

[0172] 1) Taking human ovarian cancer cell line SKOV3 as an example (SKOV3 is an MSLN-targeted positive cell, while MSLN-targeted negative cell line ES-2 was used as a control, see...) Figure 5 After digestion, the cells were prepared into a cell suspension, mixed by pipetting, and then counted.

[0173] 2) Dilute the cell suspension to 5×10⁻⁶. 4Cells / mL concentration, keep on ice for later use;

[0174] 3) Remove the RTCA assay plate and add 50 μL of culture medium;

[0175] 4) Compile the built-in test program of the RTCA detector for this test in the RTCA detector program;

[0176] 5) Place the RTCA test plate into the tester (purchased from ACEA, model: RTCA SP(W380)), observe whether the Message item in the program is normal, and start the experimental program after it is normal;

[0177] 6) After program 1 is completed, remove the detection plate and add 100 μL of tumor cell suspension to the corresponding well. Mix the cell suspension in each tube before adding.

[0178] 7) After adding the cell suspension, place the detection plate in the incubator and let it stand for 30 minutes to allow the cells to settle naturally;

[0179] 8) After 30 minutes, place the detection plate into the detector and run program 2;

[0180] 9) Observe the cell growth curve after 24 hours. When the cells are in the logarithmic growth phase, prepare to add effector T cells.

[0181] 10) Remove effector T cells from the culture flask, centrifuge, wash, count, and prepare effector group cell concentrations according to different effector-target ratios;

[0182] 11) Pause the program, remove the detection plate, add 50 μL of effector cells to the corresponding position, put it back into the detector, continue the program, and observe daily.

[0183] Figure 5 The results, obtained after the RTCA procedure was completed, showed that CAR-T cells specifically killed MSLN-target positive tumor cells (SKOV3), but had no killing effect on tumor cells that did not express MSLN targets (ES-2).

[0184] Figure 6 The killing efficiency of universal CAR-T cells targeting MSLN against ES-2 (top) or SKOV3 tumor cells (bottom) was determined by RTCA. Figure 6 In this context, 0.5:1 indicates an effector cell:target cell ratio of 0.5:1; "culture medium" indicates no effector cells were added, only tumor target cells were present; "uninfected T" indicates that the effector cells are uninfected T cells; "standard anti-MSLN CAR-T" indicates that the effector cells are T cells infected with a standard CAR structure virus; and "universal anti-MSLN CAR-T" indicates that the effector cells are T cells infected with a universal CAR structure virus. Figure 6As shown, universal anti-MSLN CAR-T cells have a significant killing effect on SKOV3 tumor target cells.

[0185] Example 5: ELISA detection of cytokine secretion

[0186] 1) Dilute 1x coating buffer (Coolaber, catalog number: PM5090-50x2L) with ddH2O, and prepare 250x coated protein (purchased from Sino, catalog number: SEKA11725) according to the ratio, for example, add 8μL of 250x coated protein to 2mL of coating buffer;

[0187] 2) Add 100 μL / well of the coating solution prepared in step 1) to the Corning 9018 ELISA high affinity 96-well plate, seal and place in a 4°C refrigerator overnight;

[0188] 3) Clean the coated 96-well plate three times with PBST (0.05% Tween 20);

[0189] 4) Prepare 1× blocking buffer using ddH2O: First, prepare 1× buffer solution (Coolaber, catalog number: PM5090-50x2L) using ddH2O; then, prepare 1× buffer solution (i.e., 1× blocking buffer) containing 1% BSA using BSA (Yisheng Biotechnology, catalog number: 36101ES60), add 200μL / well, and block at room temperature for 1h;

[0190] 5) Prepare the standard by adding 1× blocking solution according to the requirements of the bottled standard (purchased from Sino, catalog number: RTCASP(W380)), and perform 7 serial dilutions. At the same time, dilute the sample (the supernatant of CAR-T cells co-cultured with SKOV3 or ES-2 for 24 hours in the RTCA detection experiment) 5 times.

[0191] 6) Wash the blocked plate 5 times with PBST, add the standard and diluted sample solution, and incubate at room temperature for 2 hours or at 4°C overnight;

[0192] 7) Wash with PBST 4 times;

[0193] 8) Dilute 250× detection antibody (purchased from Sino, catalog number: RTCA SP(W380)) with 1× blocking buffer, add 100 μL / well, and incubate at room temperature for 1 h;

[0194] 9) Wash 4 times with PBST, dilute 250×HRP with 1× blocking buffer, add 100μL / well, and incubate at room temperature for 30min;

[0195] 10) Wash 5 times with PBST, add 100 μL of 1×TMB reagent to each well, and incubate at room temperature for 15 min;

[0196] 11) Add 50 μL / well of stop solution (purchased from Sangon Biotech, catalog number: E661006-0200) to stop the color development;

[0197] 12) Detect OD value using an enzyme-linked immunosorbent assay (ELISA) reader at 450nm.

[0198] Figure 7 ELISA detection of IFNγ factor in ES-2 or SKOV3 tumor cells after 24 h of co-culture of universal anti-MSLN CAR-T cells. Figure 7 The study showed that CAR-T cells co-cultured with SKOV3 cells (but not ES-2 cells) for 24 h resulted in significant release of the cytokine IFNγ.

[0199] Example 6: Inhibitory effect of universal anti-MSLN CAR-T cells on allogeneic reactivity (GVHD effect)

[0200] 1) Purchase NCG mice (purchased from Jiangsu Jicui Yaokang, product number: T001475), and after one week of temporary rearing, divide them into three groups: uninfected T cell group, ordinary anti-MSLN CAR-T cell group and universal anti-MSLN CAR-T cell group.

[0201] 2) T cells were injected via tail vein, with a dose of 5 × 10⁻⁶ cells. 7 One cell per animal, where uninfected T cells were injected into the uninfected T cell group, sorted ordinary anti-MSLN CAR-T cells were injected into the ordinary anti-MSLN CAR-T cell group, and sorted universal anti-MSLN CAR-T cells were injected into the universal anti-MSLN CAR-T cell group.

[0202] Forty days after T cell injection, mice were observed according to the clinical GVHD grading reference standard and mouse GVHD grading. Figure 8 This study investigated the inhibitory effect of universal anti-MSLN CAR-T cells on allogeneic reactivity (GVHD effect) in a mouse model.

[0203] Mice injected with uninfected T cells and ordinary anti-MSLN CAR-T cells exhibited significant GVHD effects, including severe facial hair loss, red and swollen eyes leading to blindness. Conversely, injection of universal anti-MSLN CAR-T cells did not produce a GVHD effect.

[0204] The grading criteria and grading of the GVHD effect are shown in Tables 1 and 2 below.

[0205] Table 1: Reference Criteria for Clinical GVHD Grading in Mice

[0206]

[0207] Table 2 GVHD grading in mice

[0208]

[0209] In summary, this invention provides a method for preparing universal CAR-T cells and its application. This universal CAR-T does not require gene editing, thus avoiding the off-target effects of gene editing and cell damage caused by gene editing electroporation experiments. It can not only inhibit or even eliminate allogeneic reactivity (GVHD effect), but also greatly simplify the production process of universal CAR-T.

[0210] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. The present invention is not limited to the examples described above. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the present invention should also fall within the protection scope of the present invention.

Claims

1. A polynucleotide molecule comprising a nucleotide sequence as shown in SEQ ID NO:8 or SEQ ID NO:9 or a complement thereof.

2. The polynucleotide molecule according to claim 1, wherein it encodes an shRNA molecule that targets or downregulates the expression of the TCRα gene.

3. An expression cassette comprising a polynucleotide molecule according to claim 1 or 2 and a first promoter operatively linked to the polynucleotide molecule; Preferably, the first promoter is selected from the U6 promoter, U61 promoter, U69 promoter, and H1 promoter; preferably, the U6 promoter comprises the nucleotide sequence shown in SEQ ID NO:7; Preferably, the expression cassette further comprises a polynucleotide encoding a chimeric antigen receptor and a second promoter operatively linked to the polynucleotide; Preferably, the second promoter is selected from CMV and EF1a promoters; Preferably, the polynucleotide encoding the chimeric antigen receptor comprises the polynucleotide sequence shown in SEQ ID NO:10; Preferably, the second promoter comprises the polynucleotide sequence shown in SEQ ID NO:12; Preferably, the expression cassette comprises, from the 5' end to the 3' end, a first promoter, the polynucleotide molecule according to claim 1, a second promoter, and a polynucleotide encoding a chimeric antigen receptor; Preferably, the chimeric antigen receptor comprises a signal peptide, an antigen-binding domain, a transmembrane domain, a co-stimulatory domain, and a signal transduction domain. Preferably, the signal peptide is a CD8 precursor; Preferably, the expression cassette comprises the CD8 precursor nucleotide sequence as shown in SEQ ID NO:1; Preferably, the transmembrane domain is CD8α; Preferably, the expression cassette comprises a CD8α nucleotide sequence as shown in SEQ ID NO:3; Preferably, the co-stimulatory domain is CD28 or 4-1BB; Preferably, the expression cassette comprises a CD28 nucleotide sequence as shown in SEQ ID NO:4; Preferably, the expression cassette contains a 4-1BB nucleotide sequence as shown in SEQ ID NO:5; Preferably, the signal conduction structure domain is CD3ζ; Preferably, the expression cassette comprises a signal transduction domain nucleotide sequence as shown in SEQ ID NO:6; Preferably, the chimeric antigen receptor targets a surface antigen selected from the group consisting of: Mesothelin, GD2, CD171, CD19, CD20, BCMA, GPC3, TERT, PTEN, PD-1, PD-L1, NKG2D ligand, CD44v6, FR, CD138, PSMA, NY-ESO, EGFR, CEA, HER2, CD22, CD30, CD123, CD5, CD7, CD33, CEA, EGFR, BRAF, HER-2, MUC1, PSCA, GPC3, or VEGF.

4. A vector comprising the polynucleotide molecule according to claim 1 or 2 or the expression cassette according to claim 3; Preferably, the vector is a viral vector; Preferably, the vector is a lentiviral vector or an adeno-associated virus vector.

5. A virus comprising a polynucleotide molecule according to claim 1 or 2, an expression cassette according to claim 3, or a vector according to claim 4; preferably, wherein the virus is a lentivirus or an adeno-associated virus.

6. T cells comprising the polynucleotide molecule of claim 1 or 2, the expression cassette of claim 3, the vector of claim 4, or the viral particles of claim 5; preferably, the T cells are T cells for adoptive immunotherapy, universal T cells, or universal CAR-T cells.

7. A composition comprising the polynucleotide molecule of claim 1 or 2, the expression cassette of claim 3, the vector of claim 4, the virus of claim 5, or the T cell of claim 6; Preferably, the composition is a pharmaceutical composition, and preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient, or diluent; Preferably, the composition is a kit.

8. A method for preparing T cells according to claim 6, comprising introducing the polynucleotide molecule according to claim 1 or 2, the expression cassette according to claim 3, the vector according to claim 4, or the virus according to claim 5 into T cells, thereby reducing TCRα gene expression or reducing T cell immune rejection.

9. The method according to claim 8, comprising one or more of the following steps: 1) viral vector construction; 2) lentiviral packaging using 293T cells; 3) PBMC isolation; 4) T cell activation; 5) lentiviral transfection of activated T cells; 6) CAR-T cell culture, sorting, and flow cytometry detection of CAR positivity and CD3 positivity before and after sorting; 7) cell killing detection of universal CAR-T cells obtained after sorting; and 8) detection of the inhibitory effect of universal CAR-T cells on allogeneic reactivity in a mouse model.

10. Use of the T cells according to claim 6 or the composition according to claim 7 in the preparation of a medicament for treating and / or preventing cancer. Preferably, the cancer is selected from liver cancer, bladder cancer, various types of leukemia, multiple myeloma, malignant lymphoma, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, head and neck cancer, multiple squamous cell tumors, esophageal cancer, colorectal cancer, melanoma, osteosarcoma, rectal cancer, anal cancer, bile duct cancer, uterine cancer, ovarian cancer, gastric cancer, prostate cancer, meningioma, pancreatic cancer, breast cancer, and medulloblastoma.

Images