Preparation process and application of gene stable knock-down cell line
By constructing a nasopharyngeal carcinoma cell line targeting the SMURF2 gene, the unknown impact of SMURF2 on nasopharyngeal carcinoma was solved, and stable knockdown of the SMURF2 gene was achieved, which significantly promoted apoptosis and inhibited invasion and migration of nasopharyngeal carcinoma cells, providing a potential target for the treatment of nasopharyngeal carcinoma.
Patent Information
- Application Number
- CN202511030938.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2025-11-14
AI Technical Summary
There are no reports on the effects of SMURF2 on nasopharyngeal carcinoma in the current technology, and the problems of high incidence, high mortality and poor prognosis of nasopharyngeal carcinoma have not been effectively solved.
By designing shRNAs targeting the human SMURF2 gene, a nasopharyngeal carcinoma cell line with stable SMURF2 knockdown was constructed. Using lentiviral packaging and puromycin screening, a nasopharyngeal carcinoma cell model with stable SMURF2 gene knockdown was established.
We successfully constructed a nasopharyngeal carcinoma cell line with stable SMURF2 gene knockdown, which significantly promoted apoptosis and inhibited cell invasion and migration, providing a potential target for the treatment of nasopharyngeal carcinoma and improving the current situation of high incidence and poor prognosis.
Smart Images

Figure BDA0005517301990000061 
Figure HDA0005517302000000011 
Figure HDA0005517302000000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, and particularly relates to the construction of gene knockdown cell lines, lentiviral packaging, and nasopharyngeal carcinoma mechanism research. Specifically, it relates to the construction and application of a nasopharyngeal carcinoma therapeutic cell model based on stable knockdown of the SMURF2 gene. Background Technology
[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the nasopharyngeal mucosal epithelium. It exhibits a distinct geographical distribution, with a high incidence in East Asia, Southeast Asia, and especially southern China. Nearly 80% of NPC patients are diagnosed at an advanced stage. Although local treatment can alleviate the burden of the primary tumor and slow metastasis, some patients still fail to achieve partial or complete remission after treatment. Therefore, exploring the mechanisms of NPC occurrence and metastasis, and identifying effective therapeutic targets, is of significant clinical importance for improving its high incidence, high mortality, and poor prognosis.
[0003] SMAD-specific E3 ubiquitin ligase 2 (SMURF2) is a member of the HECT E3 ubiquitin ligase family. It acts as a tumor promoter or inhibitor in various tumors by regulating ubiquitination-mediated protein degradation. Previous studies have shown that SMURF2 participates in regulating cell proliferation, migration, invasion, and apoptosis, and is dysregulated in various cancers, including breast cancer, pancreatic cancer, and esophageal cancer. Silencing SMURF2 can effectively inhibit the development of these tumors. However, the effects of SMURF2 on nasopharyngeal carcinoma have not yet been reported. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention proposes a process and application for preparing a gene-stable knockdown cell line. By silencing the SMURF2 gene, a nasopharyngeal carcinoma cell line with stable SMURF2 knockdown is constructed, providing an experimental basis for improving the high incidence, high mortality, and poor prognosis of nasopharyngeal carcinoma.
[0005] The technical problem to be solved by the present invention is achieved through the following technical solution:
[0006] A process for preparing a gene-stable knockdown cell line includes the following steps:
[0007] (1) Design a shRNA targeting the human SMURF2 gene, whose target sequence SEQ ID:1 is GCTGGATTTCTCGGTTGTGTT;
[0008] (2) Synthesize an oligonucleotide sequence of shRNA containing the sense strand of SEQ ID:2 and the antisense strand of SEQ ID:3, and clone it into the BamHI / EcoRI restriction site of the pLVX-shRNA2-copGFP-Puro vector.
[0009] (3) The recombinant vector and packaging plasmids pSPAX2 and pMD2.G were co-transfected into HEK293T cells to produce lentivirus. The transfection system contained 9 μg pSPAX2, 3 μg pMD2.G, 9 μg recombinant vector and 63 μg PEI transfection reagent. Viral supernatant was collected after 48 h of culture after transfection.
[0010] (4) Human nasopharyngeal carcinoma CNE2 cells were infected with the prepared lentivirus and stable cell lines were obtained by screening with 3 μg / ml puromycin. 2 μL polybrene was added when infecting the cells.
[0011] Specifically, the detailed plan for the above steps is as follows:
[0012] S1: Plasmid Construction
[0013] S1-1: Obtain the gene name, full-length mRNA, and sequence number of SMURF2 from the NCBI database.
[0014] S1-2: Designing shRNA: Using the GPP Web Portal tool, we searched by gene ID and official gene abbreviation and selected the target sequence as: GCTGGATTTCTCGGTTGTGTT (21bp). We verified the specificity of the target sequence and ensured that it would not target non-target genes in the same species by BLAST comparison.
[0015] S1-3: shRNA Synthesis: Using pLVX-shRNA2-copGFP-Puro (pHG-LVsh) as the knockdown vector, oligonucleotide sequences were designed based on the vector's restriction enzyme sites (EcoRI and BamHI). The forward sequence H-shSMURF2-F is SEQ ID:2.
[0016] GATCCGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTTG, the reverse sequence H-shSMURF2-R sequence SEQ ID:3 is AATTCCAAAAAGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGC G, the negative control shNC-F sequence SEQ ID:4 is GATCCGCGGGTTTCCAAAAGTTTCCGCTTCCTGTCAGAGGGTTTCCAAAAGTTTCCGTT TTTG, and the negative control shNC-R sequence SEQ ID:5 is AATTCAAAAACGGAAACTTTTGGAAACCCTCTGACAGGAAGCGGAAACTTTTGGAAAC CCGCG.
[0017] The shRNA oligonucleotide sequence includes: a BamHI sticky end added to the 5' end of the forward sequence, and an EcoRI sticky end added to the 5' end of the reverse complementary sequence, to ensure direct ligation to the restriction vector after annealing without destroying the restriction sites; if the first base of the target sequence is not G, a G is added before the forward sequence as the transcription start site for RNA polymerase III; when the target sequence is 21 bp, a short hairpin loop sequence CTCGAG is used, and when the target sequence is 19 bp, a long loop sequence TTCAAGAGA is used; 5-6 poly(T) and G are added to the 3' end of the reverse complementary sequence to ensure the integrity of the EcoRI and BamHI restriction sites. If an additional G is added to the forward sequence, the reverse sequence ends with CG.
[0018] S1-4: shRNA annealing: Mix shRNA forward and reverse oligonucleotides and buffer, then heat in a water bath at 99℃ / 95℃ for 4 min, and cool naturally to room temperature; or it can be performed in a PCR instrument, controlling the temperature sequentially at 95℃ for 1 min, 72℃ for 2 min, 37℃ for 2 min, and 25℃ for 2 min, and store the product at 4℃ or -20℃.
[0019] S1-5: Ligation reaction: The annealed shRNA was ligated with the double-digested pLVX vector. The reaction system included the digested vector, annealed shRNA, T4 ligase and buffer. The ligation was carried out overnight at 16°C, then inactivated at 65°C for 10 min and stored at 4°C.
[0020] S1-6: Transformation and Sequencing: Add 5 μL of the ligation product to DH5α competent cells, incubate on ice for 25-30 min, then heat shock at 42℃ for 60 s, followed by an ice incubation for 2 min; add 800 μL of LB liquid medium, and incubate at 37℃ and 180 rpm for 60 min with shaking; after centrifugation, spread the bacterial culture on plates, incubate overnight at 37℃, and pick single colonies for shaking; perform sequencing verification on the plasmids of positive colonies to ensure that the shRNA sequence is correctly inserted into the vector.
[0021] S2: Lentiviral Packaging
[0022] S2-1: Cell preparation: at 75cm 2 HEK293T cells were cultured in culture flasks using DMEM medium containing 10% FBS and 1% penicillin / streptomycin (P / S).
[0023] S2-2: Cell plating: After digesting 293T cells, they were seeded in 10cm culture dishes in DMEM containing 10% FBS and 1% P / S.
[0024] S2-3: Starvation treatment: After the cell fusion rate reaches 80-90%, switch to DMEM containing 10% FBS and no P / S, and starve for 2 hours.
[0025] S2-4: Preparation of the mixture: In a 10cm culture dish, add 9μg of the envelope plasmid pSPAX2, 3μg of the packaging plasmid pMD2.G, and 9μg of the carrier plasmid pLVX-shRNA2-copGFP-Puro containing the target sequence. Then add 63μL of PEI, and then add 500μL of DMEM without FBS and P / S to each of the two groups. Mix well and let stand at room temperature for 20-30min.
[0026] S2-5: Virus culture: After starvation treatment for 2 hours, remove the culture medium, add the mixture dropwise, and incubate in a CO2 incubator at 37°C for 8 hours. Then replace with DMEM containing 10% FBS and without P / S, and continue incubation for 48 hours.
[0027] S2-6: Virus collection: Collect the supernatant after 48 hours, centrifuge at 3000 rpm for 10 minutes at 4℃, and store the supernatant at -80℃.
[0028] S3: Construction of stable knockdown cell lines
[0029] S3-1: Determination of screening concentration: Human nasopharyngeal carcinoma CNE2 cells were seeded into 24-well plates at a rate of 40,000-60,000 cells / well. After the confluence rate reached 50-60%, puromycin was diluted to different concentrations with DMEM containing 10% FBS. Cell survival was observed after culturing for 48-72 hours to determine the minimum puromycin concentration that would kill all cells within 4-7 days.
[0030] S3-2: Viral infection: Digest CNE2 cells and adjust the density to 102 6 Cells were seeded at a density of approximately 70% in 6-well plates. The supernatant was discarded, the plates were washed with PBS, and then 1 mL of lentivirus and 1 mL of DMEM medium were added to each well. 2 μL of polybrene was added to assist infection. After incubation at 37°C for 8 hours, the plates were washed with PBS and replaced with DMEM maintenance medium.
[0031] S3-3: Positive cell screening: 48 hours after infection, the culture medium was replaced with the lowest screening concentration of puromycin for screening. The cell survival rate was observed after 48 hours. After the cells reached confluence, they were passaged and the screening was repeated twice until no negative cells remained.
[0032] In this invention, the shRNA obtained in step S1 can be used to prepare drugs for the treatment of nasopharyngeal carcinoma.
[0033] In this invention, the recombinant lentivirus obtained in step S2 can be used to prepare nasopharyngeal carcinoma treatment drugs.
[0034] In this invention, the SMURF2 gene stably knocked-down cell line constructed in step S3 can be used to study the mechanisms of nasopharyngeal carcinoma occurrence and metastasis.
[0035] In this invention, the SMURF2 gene stably knocked-down cell line constructed in step S3 can be used to screen for therapeutic targets in nasopharyngeal carcinoma.
[0036] In this invention, the SMURF2 gene stably knocked-down cell line constructed in step S3 can be used to screen anti-nasopharyngeal carcinoma drugs.
[0037] Furthermore, when the cell line is used to screen anti-nasopharyngeal carcinoma drugs, at least one of the following indicators needs to be detected: apoptosis rate, cell migration ability, and cell invasion ability. Specifically, the apoptosis rate can be obtained using the Annexin V / PI double staining method, cell migration ability can be obtained using a scratch assay, and cell invasion ability can be obtained using a Transwell matrix gel assay.
[0038] Compared with the prior art, the present invention has the following advantages:
[0039] (1) This application successfully established a nasopharyngeal carcinoma cell line with stable knockdown of the SMURF2 gene. Through steps such as shRNA design, lentiviral packaging and puromycin screening, long-term and stable silencing of the target gene was achieved, avoiding the problem of unstable instantaneous interference effect, and providing a reliable cell model for subsequent research.
[0040] (2) This application effectively demonstrates that SMURF2 knockdown can significantly promote apoptosis of nasopharyngeal carcinoma cells, while inhibiting cell invasion and migration, suggesting that SMURF2 may be a potential target for NPC treatment.
[0041] (3) This application demonstrates the effect of SMURF2 on NPC, which has important reference value for improving the current situation of high incidence, high mortality and poor prognosis of nasopharyngeal carcinoma;
[0042] (4) The process of this application is convenient to operate, highly reproducible, and easy to promote and apply. It has important reference value for the study of the mechanism of nasopharyngeal carcinoma and its clinical treatment. Attached Figure Description
[0043] Figure 1 This is an image of SMURF2 information retrieved from the NCBI database during the preparation process of this application.
[0044] Figure 2 This is a diagram of the restriction enzyme sites in the shRNA synthesis process of this application.
[0045] Figure 3This is an electrophoresis result of shRNA annealing verification in the preparation process of this application.
[0046] Figure 4 This is a photograph of a single-clone colony on a plate during the transformation process in the preparation process of this application.
[0047] Figure 5 This image shows the results of the sequencing step in the preparation process of this application, verifying the shRNA insertion vector.
[0048] Figure 6 This is a fluorescence image of the virus before sample collection during the virus packaging step in the preparation process of this application.
[0049] Figure 7 This is a fluorescence image of positive cells after screening, as shown in the preparation process of this application.
[0050] Figure 8 The image shows the effect of qRT-PCR detection of SMURF2 knockdown in the efficacy verification experiment of this application.
[0051] Figure 9 This is a comparison diagram of cell apoptosis detected by flow cytometry in the efficacy verification experiment of this application.
[0052] Figure 10 This is a statistical comparison chart of flow cytometry data on apoptosis detected in the efficacy verification experiment of this application.
[0053] Figure 11 This is a comparison diagram of the Transwell matrix gel assay used to detect cell invasion in the efficacy verification test of this application.
[0054] Figure 12 This is a statistical comparison chart of data from the Transwell matrix gel assay for detecting cell invasion in the efficacy verification test of this application.
[0055] Figure 13 The images show a comparison of 24-hour photographic results of the scratch assay for detecting cell migration in this application, used to verify the effectiveness of the experiment.
[0056] Figure 14 This is a statistical comparison chart of 24-hour cell migration rate data detected by scratch assay in the efficacy verification test of this application. Detailed Implementation
[0057] The present invention will be further described below with reference to the accompanying drawings and specific preferred embodiments, but this does not limit the scope of protection of the present invention.
[0058] A process for preparing a gene-stable knockdown cell line includes the following steps:
[0059] S1: Plasmid Construction
[0060] S1-1: Retrieve relevant information about SMURF2 from the NCBI database, such as... Figure 1 As shown.
[0061] S1-2: shRNA Design: shRNAs were designed using the GPP Web Portal - Search By Gene (www.broadinstitute.org). Searches were performed using gene IDs and official gene abbreviations, and target sequences were selected as follows:
[0062] GCTGGATTTCTCGGTTGTGTT verifies the specificity of the target sequence by using BLAST alignment to ensure that it does not target non-target genes in the same species.
[0063] S1-3: shRNA synthesis: using pLVX-shRNA2-copGFP-Puro (pHG-LVsh) as the knockdown vector, Figure 2 As a reference pattern, shRNA oligonucleotide sequences were designed based on the restriction enzyme sites of the vector, and they include the following parts:
[0064] (a) Add a BamHI sticky end to the 5' end of the forward sequence and an EcoRI sticky end to the 5' end of the reverse complementary sequence to ensure that it can be directly ligated to the enzyme digestion vector after annealing without destroying the enzyme digestion site.
[0065] (b) If the first base of the target sequence is not G, add a G before the forward sequence as the transcription start site of RNA polymerase III.
[0066] (c) When the target sequence is 21bp, it is paired with the CTCGAG short hair clasp sequence; when the target sequence is 19bp, it is paired with the TTCAAGAGA long clasp sequence. In this scheme, the target sequence is 21bp, so the CTCGAG short hair clasp sequence is selected.
[0067] (d) Add 5-6 poly(T) and G to the 3' end of the reverse complementary sequence to ensure the integrity of the EcoRI and BamHI restriction sites. If an additional G is added to the forward sequence, the reverse sequence ends with CG.
[0068] S1-4: shRNA Annealing: Construct the annealing reaction system: 10 μL each of forward and reverse oligonucleotides, 5 μL of 10×NEBBuffer 2, and 35 μL of nuclease-free water. Heat in a water bath at 99℃ / 95℃ for 4 min, then cool naturally to room temperature; or perform using a PCR instrument, controlling the temperature sequentially at 95℃ for 1 min, 72℃ for 2 min, 37℃ for 2 min, and 25℃ for 2 min. Store the products at 4℃ or -20℃. The electrophoresis results of the annealed shRNA are shown below. Figure 3 As shown, it displays bright short stripes.
[0069] S1-5: Ligation reaction: The annealed shRNA was ligated with the double-digested pLVX vector. The reaction system included: 1.5 μL of digested pLVX-shRNA vector DNA (50 ng), 1 μL of annealed oligonucleotides diluted (1 μM), 2 μL of DNA ligase reaction buffer (10×T4), 14.5 μL of nuclease-free water (H2O), and 1 μL of DNA ligase (T4), for a total of 20 μL. Ligation was carried out overnight at 16°C, followed by inactivation at 65°C for 10 min and storage at 4°C.
[0070] The volume of the ligation product used for subsequent transformation should not exceed 1 / 10 of the volume of competent cells. The sizes of empty plasmids and recombinant plasmids after ligation of the target gene are shown in the table below.
[0071]
[0072] S1-6: Transformation and Sequencing: Add 5 μL of the ligation product to DH5α competent cells, incubate on ice for 25-30 min, then heat shock at 42℃ for 60 s, followed by an ice incubation for 2 min; add 800 μL of LB liquid medium, and incubate at 37℃ with shaking at 180 rpm for 60 min; centrifuge at 4000 rpm for 1 min at room temperature, spread the bacterial solution on plates, incubate overnight at 37℃, and pick single colonies for shaking culture. Figure 4 Single-clonal colonies are visible on the plate. Plasmids containing positive colonies are sequenced to verify that the shRNA sequence is correctly inserted into the vector. Figure 5 Sequencing results for verification.
[0073] S2: Lentiviral Packaging
[0074] S2-1: Cell preparation: In two 75cm... 2 Two flasks of HEK293T cells were cultured in DMEM medium containing 10% FBS and 1% P / S.
[0075] S2-2: Cell plating: After digesting 293T cells, they were seeded into four 10cm culture dishes in DMEM containing 10% FBS and 1% P / S.
[0076] S2-3: Starvation treatment: After the cell fusion rate reaches 80-90%, switch to DMEM containing 10% FBS and no P / S, and starve for 2 hours.
[0077] S2-4: Preparation of the mixture: In a 10cm culture dish, add 9μg of the envelope plasmid pSPAX2, 3μg of the packaging plasmid pMD2.G, and 9μg of the carrier plasmid pLVX-shRNA2-copGFP-Puro containing the target sequence. Then add 63μL of PEI, and then add 500μL of DMEM without FBS and P / S to each of the two groups. Mix well and let stand at room temperature for 20-30min.
[0078] S2-5: Virus culture: After starvation treatment for 2 hours, remove the culture medium, add the mixture dropwise, and incubate in a CO2 incubator at 37°C for 8 hours. Then replace with DMEM containing 10% FBS and without P / S, and continue incubation for 48 hours.
[0079] S2-6: Virus Collection: After 48 hours of culture, HEK293T cells were photographed using fluorescence imaging. (See attached image) Figure 6 The fluorescence intensity shown indicates successful plasmid transfection and normal virus packaging. Collect the supernatant, centrifuge at 3000 rpm for 10 min at 4°C, and store the supernatant at -80°C.
[0080] S3: Construction of stable knockdown cell lines
[0081] S3-1: Determination of screening concentration: Human nasopharyngeal carcinoma CNE2 cells were seeded into 24-well plates at a rate of 40,000-60,000 cells / well. After the confluence rate reached 50-60%, puromycin was diluted with DMEM containing 10% FBS to different concentrations such as 1 μg / mL, 2 μg / mL, and 3 μg / mL. After culturing for 48-72 hours, cell viability was observed to determine the lowest puromycin concentration that would cause all cells to die within 4-7 days. 3 μg / mL was the screening concentration.
[0082] S3-2: Viral infection: Digest CNE2 cells and adjust the density to 102 6 Cells were seeded at a density of approximately 70% in 6-well plates. The supernatant was discarded, and the cells were washed twice with PBS. Then, 1 mL of lentivirus and 1 mL of DMEM medium were added to each well, along with 2 μL of polybrene for adjuvant infection. The cells were incubated at 37°C for 8 hours, washed twice with PBS, and then replaced with DMEM maintenance medium.
[0083] S3-3: Positive cell selection: 48 hours after infection, the medium was replaced with one containing 3 μg / mL puromycin for selection. Cell survival rate was observed after 48 hours. Cells were passaged after reaching confluence, and selection was repeated twice until no negative cells remained. The fluorescence image of positive cells after selection is shown below. Figure 7 As shown.
[0084] S4: Effect Verification
[0085] The following experiments were conducted to verify the effect of SMURF2 knockdown on CNE2 cells:
[0086] (1) Real-time quantitative PCR (qRT-PCR): Total RNA was extracted from cells, reverse transcribed into cDNA and amplified to detect the mRNA expression level of SMURF2. The internal reference gene was Gaphd to verify the knockdown efficiency.
[0087] qRT-PCR reaction system: 2×SYBR Premix Ex Taq 5μL, forward and reverse primers 0.2μL each (0.2μmol / L), cDNA template 1μL, ddH2O 3.6μL, total volume 10μL.
[0088] Reaction conditions: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing extension for 30s, for a total of 40 cycles, and the relative ratio of gene expression was calculated according to the 2-ΔΔCt method.
[0089] The results are as follows Figure 8 As shown, the mRNA expression of SMURF2 was significantly reduced.
[0090] (2) Apoptosis detection by loss of cells: Logarithmic growth phase cells were collected, stained with Annexin V-FITC and Propidium Iodide, and the apoptosis rate was detected by flow cytometry.
[0091] The specific steps are as follows: Cells in the logarithmic growth phase are digested with 0.25% trypsin (without EDTA), cells are collected, centrifuged at 1500 rpm for 5 min, and the supernatant is discarded; cells are resuspended in pre-cooled 1×PBS (4℃), counted, and 1×10⁻⁶ cells are collected. 5 Cells were centrifuged in 1.5 mL EP tubes at 1500 rpm for 5 min; resuspended in 1×PBS (4℃) and centrifuged again at 1500 rpm for 5 min; resuspended in 200 μL of 1×Binding Buffer; protected from light, 5 μL of Annexin V-FITC and 5 μL of Propidium Iodide were added, mixed, and incubated at room temperature for 15 min; centrifuged, and resuspended in 500 μL of 1×Binding Buffer; analyzed by flow cytometry, and the data were analyzed using software.
[0092] The results are as follows Figure 9 As shown, the apoptosis rate of sh-SMURF2 cells was higher than that of the blank control group. Specifically, the early apoptosis rate in the sh-NC group was 7.62%, the late apoptosis rate was 2.39%, and the total apoptosis rate was 2.39% + 7.62% = 10.01%; while the early apoptosis rate in the sh-SMURF2 group was 9.11%, the late apoptosis rate was 9.81%, and the total apoptosis rate was 9.81% + 9.11% = 18.92%. Figure 10 As shown.
[0093] (3) Transwell assay to detect invasive ability: low temperature gel casting, cell seeding, detection of cells that have passed through the gel membrane to determine the invasive ability of cells.
[0094] The specific steps are as follows: Dilute Matrigel with serum-free cell culture medium or PBS buffer at a ratio of 1:8 at 4℃. Add 100 μL to the center of the chamber and gently shake to evenly distribute the Matrigel on the polycarbonate membrane surface of the upper chamber. Place the 24-well plate flat in a 4℃ refrigerator for 10 min, then incubate at 37℃ for 3 h to form the basement membrane. Take cells in the logarithmic growth phase, digest and passage them, centrifuge, wash with PBS, and suspend the cells in serum-free culture medium, adjusting the cell density to 1-10 × 10⁻⁶ cells / well. 5 Take 100 μL of serum-free cell suspension and seed it into the upper chamber. Add 600 μL of complete culture medium supplemented with 10% FBS to the lower chamber. Carefully place the Transwell chamber into the 24-well plate using forceps. Incubate the 24-well plate at 37°C with 5% CO2 for 12–48 h. Remove the chamber, aspirate the culture medium, and gently wipe the cells in the Matrigel and upper chambers with a cotton swab. Add 600 μL of 4% paraformaldehyde to the remaining wells of the plate. After placing the chambers in the plate, fix them for 30 minutes; discard the fixative and rinse the chambers twice with PBS; add 600 μL of 0.1% crystal violet staining solution to the remaining wells of the plate, place the chambers in the plate, stain for 5-10 minutes, rinse the chambers three times with PBS, gently wipe the upper side of the chambers with a cotton swab to remove the dye that is not specifically bound to the upper surface of the chambers for subsequent microscopic examination; place the chambers upside down on absorbent paper and allow them to air dry naturally, then observe the cells and take pictures under a 200x microscope by selecting an appropriate field of view.
[0095] The results are as follows Figure 11 As shown, the invasive ability of sh-SMURF2 cells was lower than that of the blank control group. Specifically, the number of invasive cells in the sh-NC group was approximately 280, while the number of invasive cells in the sh-SMURF2 group was approximately 110. Figure 12 As shown.
[0096] (4) Scratch test to detect migration ability: Cells were seeded in well plates, and after they were filled, they were scratched with a pipette tip. After washing with PBS, the cells were replaced with serum-free culture dishes. Photos were taken at regular intervals to observe the closure of the scratches and to assess the cell migration ability.
[0097] The specific steps are as follows: Take the test cells in the logarithmic growth phase, digest, centrifuge, and resuspend in serum-free culture medium, count, and then perform the test at a rate of 2 × 10⁻⁶ cells / year. 5To determine the cell quantity, seed cells into 6-well plates with 2 mL of culture medium per well. After 24 or 48 hours, once the cells have confluenced, use a 200 μL pipette tip to draw vertical lines perpendicular to the horizontal line on the back of the plate, making 1-3 vertical lines per well to create cell scratches. The pipette tip must be vertical and not tilted. Gently wash three times with PBS to remove the scratched cells, replace with serum-free culture medium, and then photograph the scratches. The day of the cell scratches is considered 0h; photograph the scratches in bright field. Incubate the 6-well plates at 37°C in a 5% CO2 incubator. Observe the closure of the scratches under a microscope and photograph them after 24 or 48 hours, according to experimental requirements.
[0098] The results are as follows Figure 13 As shown, the migration ability of sh-SMURF2 cells at 24 h was lower than that of the blank control group. Specifically, the migration rate of the sh-NC group was approximately 55%, while the migration rate of the sh-SMURF2 group was approximately 21%. Figure 14 As shown.
[0099] Therefore, it can be seen that shRNA can knock down SMURF2 expression in human nasopharyngeal carcinoma CNE2 cells, while increasing apoptosis rate and inhibiting invasion and migration.
Claims
1. A shRNA that specifically targets the human SMURF2 gene, characterized in that: It contains a justice chain and an antisense chain. The justice chain sequence SEQ ID:2 is GATCCGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCTTTTTG; the antisense chain sequence SEQ ID:3 is AATTCCAAAAAGCTGGATTTCTCGGTTGTGTTCTCGAGAACACAACCGAGAAATCCAGCG.
2. A recombinant lentivirus, characterized in that: The lentivirus comprises the shRNA of claim 1, and is obtained by packaging the pLVX-shRNA2-copGFP-Puro vector.
3. A method for preparing a gene-stable knockdown cell line, characterized in that: Includes the following steps: (1) Synthesize the shRNA according to claim 1; (2) The shRNA was cloned into the EcoRI / BamHI site of the pLVX-shRNA2-copGFP-Puro vector; (3) The recombinant vector and packaging plasmids pSPAX2 and pMD2.G were co-transfected into HEK293T cells to produce lentivirus; (4) Human nasopharyngeal carcinoma CNE2 cells were infected with the prepared lentivirus and stable cell lines were obtained by screening with 3 μg / ml puromycin.
4. The preparation method according to claim 3, characterized in that: The target sequence of the shRNA, SEQ ID:1, is GCTGGATTTCTCGGTTGTGTT.
5. The preparation method according to claim 3, characterized in that: The transfection system used in step (3) contains 9 μg pSPAX2, 3 μg pMD2.G, 9 μg recombinant vector and 63 μg PEI transfection reagent.
6. The preparation method according to claim 3, characterized in that: In step (4), 2 μL of polybrene is added when the lentivirus infects the cells.
7. A stable SMURF2 gene knockdown cell line constructed by the preparation method according to any one of claims 3-6, characterized in that: The cell line described is human nasopharyngeal carcinoma CNE2 cells.
8. The use of the shRNA of claim 1 or the recombinant lentivirus of claim 2 in the preparation of nasopharyngeal carcinoma therapeutic drugs.
9. The application of the SMURF2 gene stably knocked-down cell line as described in claim 7 in the study of the mechanisms of nasopharyngeal carcinoma occurrence and metastasis.
10. The use of the SMURF2 gene stably knocked-down cell line as described in claim 7 in screening for therapeutic targets of nasopharyngeal carcinoma or screening for anti-nasopharyngeal carcinoma drugs.