Application of tomato slcpk3 gene in improving low temperature resistance of tomato and method for improving low temperature resistance of tomato

Abstract

This invention discloses a tomato SlCPK3 The application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes, by knocking out genes in tomatoes... SlCPK3 The gene enhances the resistance of tomatoes to low temperatures. SlCPK3 The coding sequence of the gene is shown in SEQ ID NO.1. This invention's method is disclosed for the first time. SlCPK3 The study investigated the regulatory role of a gene in tomato's low-temperature resistance. Knocking out this gene significantly improved tomato's low-temperature resistance, providing genetic resources for breeding new low-temperature resistant tomato varieties and laying a theoretical foundation for research on tomato's resistance to low-temperature stress. This study also has significant practical implications for energy conservation and emission reduction in the greenhouse vegetable industry during winter and spring, achieving stable, high-yield, and high-quality vegetable production goals, and ensuring a long-term, stable, and balanced supply of vegetable products in my country.

Description

Technical Field

[0001] This application relates to the technical fields of genetic engineering, molecular biology and plant physiology, and in particular to a tomato SlCPK3 Application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes. Background Technology

[0002] tomato( Solanum lycopersicum Tomato (L.) is an important vegetable crop in my country's greenhouse agriculture. As a warm-season plant, its optimal growth temperature range is 20-28℃, and low-temperature injury severely inhibits its growth and development. Therefore, in-depth analysis of the physiological and molecular mechanisms of tomato's response to low-temperature stress is of great significance. By revealing the mechanisms of plant cold tolerance and identifying key regulatory genes, it is hoped that the low-temperature resistance of tomatoes can be improved, thereby effectively reducing the economic losses caused by low-temperature injury.

[0003] Calcium-dependent protein kinases (CPKs, CDPKs) belong to the serine / threonine protein kinase family and consist of a protein kinase domain, a self-inhibition domain, and a CaM-like domain. Numerous studies have shown that CPKs play a crucial role in plant perception and response to stress. In Arabidopsis, AtCPK4 and AtCPK11 play important roles in the ABA signaling response (Zhu SY et al., Two calcium-dependent protein kinases, AtCPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis. Plant Cell. 2007, 19, 3019-36), while AtCPK32 affects the Arabidopsis response to temperature (Li Xidong, Research on the mechanism by which calcium-dependent protein kinase CPK32 regulates flowering time in Arabidopsis). AtCPK3 is rapidly activated by low-temperature stress, thereby triggering the CaM-like reaction. 2+ Influx (Ming Y et al., Coordinated control of calcium signaling by CPK3 and CaM2 via CNGCs in response to cold stress in Arabidopsis. Dev Cell. 2025, S1534-5807(25)00375-2). AtCPK28 positively regulates antifreeze (Ding Y et al., CPK28-NLP7 module integrates cold-induced Ca 2+signal and transcriptional reprogramming in Arabidopsis. Sci Adv.2022,8,eabn7901). Previous studies have shown that cold stress induces the expression of OsCPK7 and OsCPK24 (Saijo Y et al., Over-expression of a single Ca 2+ -dependent protein kinase confers both cold and salt / drought tolerance on rice plants. Plant J.2000,23,319-27; Liu Y et al., The calcium-dependent kinase OsCPK24 functions in cold stress responses in rice. J Integr Plant Biol.2018,60,173-188). In maize, knocking out ZmCPK17 significantly enhances cold tolerance of plants (Zeng R et al., A natural variant of COOL1 gene enhances cold tolerance for high-latitude adaptation in maize. Cell.2025,188,1315-1329). Cold stress significantly induces the expression of ZmCPK1 , and overexpression of ZmCPK1signaling. Plant Cell Environ. 2015, 38, 544-58). In tomato, SlCPK27 positively regulates cold tolerance and is involved in cold acclimation (Lin R et al., CPK27 enhances cold tolerance by promoting flavonoid biosynthesis through phosphorylating HY5 in tomato. New Phytol. 2025, 246, 2174-2191; Lv X et al., The role of calcium-dependent protein kinase in hydrogen peroxide, nitric oxide and ABA-dependent cold acclimation. J Exp Bot. 2018, 69, 4127-4139). A large number of studies have shown that the CBF pathway plays an important role in tomato resistance to low temperature stress, SlCBF1 / 2 / 3 is a key gene for tomato cold resistance (Wang F et al., Phytochrome A and B Function Antagonistically to Regulate Cold Tolerance via Abscisic Acid-Dependent Jasmonate Signaling. Plant Physiol. 2016, 170, 459-71; Song J et al., SlMPK1- and SlMPK2-mediated SlBBX17 phosphorylation positively regulates CBF-dependent cold tolerance in tomato. New Phytol. 2023, 239, 1887-1902). However, the function of SlBBX17 and its Arabidopsis homologous gene (AtBBX17) in low temperature stress has not been reported, and the function of SlBBX17 in tomato resistance to low temperature stress has not been reported. SlCPK3 AtCPK26 / 5 / 6 ) in low temperature stress has not been reported, and the function of SlBBX17 in tomato resistance to low temperature stress has not been reported. SlCPK3 The function of SlBBX17 in tomato resistance to low temperature stress has important significance for breeding tomato varieties resistant to low temperature. SUMMARY​

[0004] In view of this, the purpose of the embodiments of the present application is to provide a tomato SlCPK3 gene in improving the low temperature resistance of tomato and a method for improving the low temperature resistance of tomato.

[0005] According to a first aspect of the embodiments of the present application, a tomato SlCPK3 gene in improving the low temperature resistance of tomato, the SlCPK3 gene in tomato is knocked out by a gene knockout technology, so that the tomato improves the resistance to low temperature, and the SlCPK3 coding sequence of the gene is shown as SEQ ID NO. 1. SlCPK3 The gene is numbered as Solyc01g112250 in the tomato genome database http: / / solgenomics.net / .

[0006] According to a second aspect of the embodiments of the present application, a method for improving the low temperature resistance of tomato is provided, and the method is:

[0007] the SlCPK3 gene in tomato is knocked out by a gene knockout technology, so that the tomato improves the resistance to low temperature, and the SlCPK3 coding sequence of the gene is shown as SEQ ID NO. 1.

[0008] The method for improving the low temperature resistance of tomato according to the present application has the following specific manifestations: the decrease of relative conductivity, the increase of PSII maximum photochemical quantum yield (Fv / Fm), the improvement of survival rate, and the increase of expression amount of cold resistance key genes. Fv / Fm SlCBF1 / SlCBF2 / SlCBF3

[0009] Optionally, the amino acid sequence of the protein encoded by the SlCPK3 gene is shown as SEQ ID NO. 2.

[0010] Optionally, the gene knockout technology is specifically as follows:

[0011] In the protein coding region of the SlCPK3 gene of tomato, a target fragment containing a protospacer adjacent motif (PAM) structure is selected, and a corresponding primer is designed based on the first 20 bases thereof, so as to construct a CRISPR / Cas9 vector.

[0012] The CRISPR / Cas9 vector is introduced into a host cell, and then the host cell is used to infect the cotyledon of the target tomato, so as to screen a positive gene editing plant, which is bred to be homozygous, so as to obtain a low-temperature-resistant gene editing plant.

[0013] Optionally, the nucleotide sequence of the first 20 bases is shown as SEQ ID NO. 3. ​​

[0014] Optionally, the host cell is an Agrobacterium cell.

[0015] Optionally, the host cell is a GV3101 Agrobacterium cell.

[0016] The technical scheme provided by the embodiments of the present application can include the following beneficial effects:

[0017] As can be seen from the above embodiments, the present application performs low temperature treatment on tomato SlCPK3 gene knockout plants, and as a result, the tomato SlCPK3 gene knockout plants exhibit a significant low temperature tolerance phenotype. The present application provides a gene resource for cultivating new tomato varieties with low temperature tolerance, has high potential application value, and lays a foundation for studying the mechanism of tomato plants resisting low temperature stress. The present application is the first to use tomato SlCPK3 gene knockout plants to perform low temperature treatment, and it is found that SlCPK3 the gene plays a negative regulatory role in the low temperature tolerance of tomato plants. Knocking out the gene can significantly increase the low temperature resistance of tomato plants. The biological function verification of the gene is of great significance for studying the molecular mechanism of improving the low temperature resistance of tomato and molecular design breeding.

[0018] It should be understood that the above general description and the following detailed description are only exemplary and explanatory, and cannot limit the present application. BRIEF DESCRIPTION OF DRAWINGS

[0019] The accompanying drawings, which are incorporated into and form part of the specification, illustrate embodiments consistent with the present application and, together with the specification, serve to explain the principles of the present application.

[0020] Figure 1 The nucleic acid sequence of the tomato SlCPK3 gene knockout line T2 generation (homozygous, without foreign Cas9 fragment) is shown, the position and sequence of sgRNA on the genome are identified, and the PAM site is boxed.

[0021] Figure 2 The phenotype of the tomato SlCPK3 gene knockout line after low temperature treatment in Example 3 of the present application.

[0022] Figure 3 The relative electrical conductivity of the tomato SlCPK3 gene knockout line after low temperature treatment in Example 3 of the present application.

[0023] Figure 4 The PSII maximum photochemical quantum yield (Fv / Fm) of the tomato SlCPK3 gene knockout line after low temperature treatment in Example 3 of the present application. Fv / Fm

[0024] The PSII maximum photochemical quantum yield (Fv / Fm) of the tomato SlCPK3 gene knockout line after low temperature treatment in Example 3 of the present application. Fv / Fm

[0024] Figure 5 The tomato in Example 3 of this invention SlCPK3 Survival rate of gene knockout lines after low-temperature treatment.

[0025] Figure 6 Wild type and SlCPK3 Changes in the expression levels of key cold-resistance genes in gene knockout lines after 6 hours of low-temperature treatment, where A represents tomato. SlCBF1 The expression level of gene (Solyc03g026280), B represents tomato. SlCBF2 Expression level of gene (Solyc03g124110), C represents tomato SlCBF3 Expression level of gene (Solyc03g026270). Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. The present invention is intended to cover other modifications and variations within the scope and spirit of the present invention.

[0027] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, tissue culture, molecular biology, biological physiology and biochemistry, DNA recombination, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the literature.

[0028] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. The experimental material used was the tomato cultivar Ailsa Craig. Solanum lycopersicum L.cv).

[0029] Example 1: Construction of SlCPK3 CRISPR / Cas9 gene knockout vector;

[0030] Tomato SlCPK3 The full-length DNA sequence of the gene (Solyc01g112250) was analyzed (http: / / solgenomics.net / ). Using the CRISPR-P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the U6 promoter was selected for screening. SlCPK3 The specific sequence of the gene's sgRNA (single guide RNA) is shown in SEQ ID NO.3. SlCPK3 The CRISPR / Cas9 vector uses sgRNA from the exon of the gene itself. The sgRNA has one forward primer and one reverse primer for PCR to obtain fragments containing sgRNA. The forward primer of the sgRNA used in the vector is a universal forward primer. The PCR primer sequences are shown in Table 1.Figure 1 The location and sequence of the gRNA on the tomato SlCPK3 genome. The specific construction process is as follows: taking the tRNA vector as a template, using KOD high-fidelity enzyme to perform PCR of the target point, and purifying the PCR product, the fragment size is about 200 bp. The fragment recombination is completed using Golden Gate assembly kit (BsaI HFv2) (NEB, E1601). The recombination system contains Golden Gate Assembly Mix, PHEE401 vector, target PCR purified product and T4 DNA ligase buffer, and is supplemented to 20 μL with ddH2O. The PCR program is set according to the kit instructions. The recombination product is heat shock transformed into trans5α E. coli competent cells (TransGen, CD201). After 1 h of activation at 37°C on a shaker at 200 rpm, the supernatant is discarded after centrifugation, and the remaining 100-150 μL liquid is resuspended after the precipitate is resuspended, and is uniformly coated on solid LB medium containing 50 mg / L kanamycin and cultured at 37°C overnight. After single colony shaking, bacterial liquid PCR is performed using universal M13-F and M13-R primers to identify positive clones for sequencing. The positive plasmid with correct sequencing alignment is named PHEE401- SlCPK3 .

[0031] Table 1 PCR primer sequence for constructing CRISPR / Cas9 vector:

[0032]

[0033] Example 2: Tomato SlCPK3 Construction and detection of gene editing materials

[0034] The gene editing vector is transformed into Agrobacterium GV3101, and tomato cotyledon infection is performed. Through induction of callus, hygromycin resistance induction differentiation and rooting culture, tissue culture seedlings are obtained. PCR and second-generation sequencing technology are used to verify positive slcpk3 gene editing plants, and 2 generations are propagated until homozygous and Cas9 residual free. It is found that slcpk3 #21 lacks 1 base, slcpk3 #22 lacks 2 bases.

[0035] Example 3: SlCPK3 Detection of low temperature tolerance of gene editing materials

[0036] Wild-type tomato seedlings with five leaves and one heart and the SlCPK3 gene-edited line obtained in Example 2 were treated at 25℃ and 4℃ in an artificial climate incubator. After 7 days of low-temperature treatment, the low-temperature stress treatment group (4℃ treatment) was compared with the control group (25℃) under the same conditions without low-temperature treatment. The phenotype, electrical conductivity, and maximum photochemical quantum yield of PSII of the wild-type and gene-edited tomato plants were observed. Fv / Fm The changes in the PSII (photochemical quantum yield) were observed, and the survival rate was statistically analyzed after 3 days of recovery at 25℃ following 9 days of low-temperature treatment. Necrosis of the apical growing point was considered death. The method for determining the maximum photochemical quantum yield of PSII was as follows: tomato plants were dark-adapted for at least 30 minutes, and leaves from the same functional part were placed on a detection tray. The maximum photochemical quantum yield of PSII in tomatoes after 7 days of low-temperature treatment was measured using a chlorophyll fluorescence imaging spectrometer (IMAG-PAM, Germany). The relative conductivity was determined as follows: 0.2g of tomato leaves from the same functional part, avoiding the veins, was placed in a graduated centrifuge tube containing 20mL ddH2O and extracted in a shaker at 28℃ and 200rpm for 2 hours. The conductivity R1 of the extract was measured using a conductivity meter. The extract was then heated in a 95℃ hot water bath for 15 minutes, and the conductivity R2 was measured after cooling to room temperature. Relative conductivity = R1 / R2 × ​​100%.

[0037] The results showed that SlCPK3 Gene knockout tomato plants showed significantly less leaf wilting and were more upright than wild-type plants, indicating that... SlCPK3 Genes can significantly improve the low-temperature resistance of tomatoes. Figure 2 Secondly, SlCPK3 The relative electrical conductivity of gene knockout tomato plants was significantly lower than that of wild-type (WT) plants. Figure 3 This indicates that knocking out SlCPK3 Genetically modified tomato plants exhibit reduced cell membrane electrolyte permeability and enhanced low-temperature resistance. Furthermore, gene-edited plants... Fv / Fm ( Figure 4 The value was also higher than that of wild-type tomatoes (WT), indicating that the knockout... SlCPK3 After gene administration, the photoinhibition of photosystem II in tomato plants was significantly reduced at low temperatures. SlCPK3 The survival rate of gene knockout plants increased significantly. Figure 5 This indicates that knocking out SlCPK3 The gene significantly improved the low-temperature resistance of tomato plants. After 6 hours of treatment, RNA was extracted from leaves grown at 25℃ and 4℃, and reverse transcription was used for quantitative PCR. The results showed that, compared with the wild type, the key gene for cold resistance significantly improved the resistance of tomato plants. SlCBF1 ( Figure 6 A) SlCBF2 ( Figure 6 (B) SlCBF3 ( Figure 6transcriptional level of C) in the plants is higher than that in the wild type plants SlCPK3 The significant increase of the transcriptional level of the gene in the leaves of the knockout plants indicates that the knockout of the gene can improve the expression level of the cold resistance key gene SlCPK3 CBF in the tomato plants under low temperature stress, and further promote the SlCBF signal transduction and improve the low temperature resistance of the tomato. SlCBF1 / 2 / 3

[0038] The 0.2 g of the leaf sample is used for RNA extraction by using the Trizol lysis method according to the instructions of the total RNA extraction kit (Tiangen, DP419), the RNA is reversely transcribed into cDNA by using the HiScript II QRT SuperMix (Vazyme Biotech, China), and then the qRTPCR experiment is performed, the real-time fluorescent quantitative PCR (qRTPCR) is performed by using the 480II Real-Time PCR detection system (Roche, Swiss), and the AceQ qPCR SYBR Green Master Mix kits (Vazyme Biotech, China) are used. The qRTPCR reaction conditions are as follows: 95℃, 3 min; 95℃, denaturation for 15 s, 58℃, annealing for 15 s, 72℃, extension for 30 s, 40 cycles. The fluorescence data is collected at the end of each cycle. The relative expression level of the target gene is calculated by using the 2-△△Ct method, and the expression level of the target gene is normalized by using the expression level of the SlACTIN2 and SlUBI3 as the internal reference gene. According to the gene sequence of the tomato SlCBF1 / 2 / 3 The specific primers are designed according to the gene sequence of the tomato

[0039] SlCBF1 The forward primer of the gene is 5’GTCATCGTCGTTTTCTGAAG (SEQ ID NO. 4);

[0040] SlCBF1 The reverse primer of the gene is 5’AACGGCCTCTTAATGCTAAA (SEQ ID NO. 5);

[0041] SlCBF2 The forward primer of the gene is 5’TTCGATCGGAAGAAGTTTCA (SEQ ID NO. 6);

[0042] SlCBF2 The reverse primer of the gene is 5’CAAGTAATCCTGGCATGGAA (SEQ ID NO. 7);

[0043] SlCBF3 The forward primer of the gene is 5’CGCCGAAATCTTCCGACCT (SEQ ID NO. 8);

[0044] SlCBF3 ​Post-gene primer: 5'CGGCATGCAGAATAACGCTT (SEQ ID NO.9);

[0045] Each experiment was repeated at least three times, and each biological replicate contained an independent sample consisting of a mixture of leaves from two different plants. All statistical analyses were performed using IBM SPSS Statistics 27 software. Figure 3-Figure 6 The lowercase letters a, b, and c indicate that the differences between different plants are significant at the 5% level. The statistical method used is Turkey's test.

[0046] The above results show that tomatoes SlCPK3 Genes negatively regulate the cold tolerance of plants. Knockout. SlCPK3 Genes can significantly enhance the low-temperature resistance of tomatoes.

[0047] Based on the above embodiments, the nucleotide sequence shown in SEQ ID NO.1 is mutated by gene editing technology by substituting, deleting and / or adding one or more nucleotides without changing the function of the original nucleotide sequence. Then, it is transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0048] Based on the above embodiments, the nucleotide sequence with the same function obtained by hybridization with the sequence shown in SEQ ID NO.1 under strict conditions is mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0049] Based on the above embodiments, nucleotide sequences that have more than 90% homology with nucleotide sequences of 1), 2), or 3) and encode the same functional protein are mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0050] Although the present invention has been described in detail above with general descriptions and specific embodiments, the present invention is not limited to the above embodiments, and many modifications or improvements are possible, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. Tomato SlCPK3 The application of genes in improving the low-temperature resistance of tomatoes is characterized by, Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlCPK3 The gene enhances the resistance of tomatoes to low temperatures. SlCPK3 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The SlCPK3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The gene knockout technology is as follows: In tomatoes SlCPK3 The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into the host cell, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened, and the plants were propagated to homozygosity to obtain low-temperature resistant gene-edited plants.

4. The application according to claim 3, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO.

3.

5. A method for improving the low-temperature resistance of tomatoes, characterized in that, The method is as follows: Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlCPK3 The gene enhances the resistance of tomatoes to low temperatures. SlCPK3 The coding sequence of the gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that, The SlCPK3 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

7. The method according to claim 5, characterized in that, The gene knockout technology is as follows: In tomatoes SlCPK3 The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into host cells, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened to obtain gene-edited plants with relatively high low-temperature resistance.

8. The method according to claim 7, characterized in that, The gene-edited plants with relatively high low-temperature resistance enhance the key genes for cold resistance. SlCBF1 / SlCBF2 / SlCBF3 The level of gene expression can be increased, thereby enhancing the plant's resistance to low temperatures.

9. The method according to claim 7, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO. 3.

Images