A method for improving salt stress resistance of oysters

Abstract

The application discloses a method for improving salt stress resistance of oysters. CHK1 The application finds that, by silencing the oyster gene with siRNA targeting the gene, the expression of the oyster gene is inhibited, and the mortality of the oyster under salt stress conditions is reduced, that is, the expression of the oyster gene is inhibited, and the salt stress resistance of the oyster is improved. CHK1 The application finds that, by silencing the oyster gene with siRNA targeting the gene, the expression of the oyster gene is inhibited, and the mortality of the oyster under salt stress conditions is reduced, that is, the expression of the oyster gene is inhibited, and the salt stress resistance of the oyster is improved. CHK1 The application finds that, by silencing the oyster gene with siRNA targeting the gene, the expression of the oyster gene is inhibited, and the mortality of the oyster under salt stress conditions is reduced, that is, the expression of the oyster gene is inhibited, and the salt stress resistance of the oyster is improved. CHK1 CHK1 CHK1 CHK1 CHK1 CHK1 The application finds that, by silencing the oyster gene with siRNA targeting the gene, the expression of the oyster gene is inhibited, and the mortality of the oyster under salt stress conditions is reduced, that is, the expression of the oyster gene is inhibited, and the salt stress resistance of the oyster is improved. The application is favorable to the resistance breeding of oysters and reduces the influence of salt stress on the growth of oysters.

Description

Technical Field

[0001] This invention belongs to the field of aquatic seedling cultivation technology, and in particular relates to a method for improving the salt stress resistance of oysters. Background Technology

[0002] Hong Kong Oysters ( Crassostrea hongkongensis Oysters (Crassostrea gigas) are one of the most important farmed oyster species in my country, primarily inhabiting estuaries where fresh and salt water meet, and capable of surviving in salinity ranges from 5‰ to 30‰. However, salinity varies greatly in estuaries; high temperatures and droughts can cause a sharp increase in salinity, leading to large-scale oyster mortality in Hong Kong. Furthermore, Hong Kong oyster farming often employs a "low-salt seedling-high-salt fattening" strategy, and the sudden increase in salinity is an unavoidable challenge in the oyster's life cycle; high salt stress is a significant bottleneck in oyster farming. Developing oysters that are more tolerant of salt stress is key to solving this bottleneck.

[0003] Cell cycle checkpoints are rate-limiting steps controlling cell proliferation, ensuring DNA integrity and accuracy before cells enter DNA replication and mitosis. CHK1, or cell cycle checkpoint kinase 1, is a serine-threonine protein kinase. Studies in mammals have shown that when cells are damaged, CHK1 can induce cell cycle arrest and DNA repair to prevent erroneous DNA from entering the replication process, thus inhibiting tumor cell proliferation. Currently, there are no reports on CHK1 in mollusks, and it is unclear whether CHK1 in mollusks plays a role in salinity stress or whether it can be regulated... Chk1 Expression levels can be used to enhance the salt tolerance of oysters. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention provides a method for improving the salt stress resistance of oysters.

[0005] The first objective of this invention is to provide a method for improving the salt stress resistance of oysters.

[0006] The second objective of this invention is to provide a method for inhibiting oyster growth. CHK1 Application of gene expression reagents in enhancing salt stress resistance in oysters.

[0007] A third objective of this invention is to provide an inhibitory effect on oysters. CHK1 Application of gene expression reagents in the preparation of products for improving the salt stress resistance of oysters.

[0008] The fourth object of this invention is to provide an inhibitory effect on oysters. CHK1 Application of gene expression reagents in the breeding of salt-resistant oyster varieties.

[0009] The fifth objective of this invention is to provide an inhibitory effect on oysters. CHK1Application of gene expression reagents in the preparation of products for breeding salt-resistant oyster varieties.

[0010] The above-mentioned objective of this invention is achieved through the following technical solution:

[0011] This invention utilizes targeted oysters CHK1 Silenting of the gene with siRNA was found to suppress oysters. CHK1 Gene expression can reduce oyster mortality under salt stress conditions, i.e., inhibit oyster... CHK1 Gene expression can enhance the salt stress resistance of oysters. Therefore, this invention provides a method for improving the salt stress resistance of oysters.

[0012] Specifically, the method is to inhibit oysters CHK1 Gene expression.

[0013] Specifically, the oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.10.

[0014] Optionally, the inhibition of oysters CHK1 Gene expression is achieved through RNA interference, mutation, or knockout in oysters. CHK1 It is achieved through genes.

[0015] In a specific embodiment of the present invention, the reagent used for RNA interference is siRNA targeting the CHK1 gene of oysters.

[0016] Specifically, the sequence of the siRNA is shown in SEQ ID NO.20.

[0017] In a specific embodiment of the present invention, the oyster is a Hong Kong oyster.

[0018] Specifically, the salt stress is high salt stress, with a salinity greater than 30‰.

[0019] More specifically, the salinity of the high salt stress is 30‰ to 40‰.

[0020] This invention also seeks protection against oyster inhibition. CHK1 Application of gene expression reagents in enhancing salt stress resistance in oysters.

[0021] This invention also seeks protection against oyster inhibition. CHK1 Application of gene expression reagents in the preparation of products for improving the salt stress resistance of oysters.

[0022] Optionally, when used to improve the salt stress resistance of oysters, the inhibition of oysters CHK1 Gene expression reagents include those targeting oysters. CHK1 siRNA for genes, used to mutate or knock out oysters CHK1Recombinant plasmids of genes, etc. In a specific embodiment of the present invention, the targeted oyster... CHK1 The siRNA sequence of the gene is shown in SEQ ID NO.20.

[0023] This invention also seeks protection against oyster inhibition. CHK1 Application of gene expression reagents in the breeding of salt-resistant oyster varieties.

[0024] This invention also seeks protection against oyster inhibition. CHK1 Application of gene expression reagents in the preparation of products for breeding salt-resistant oyster varieties.

[0025] Optionally, when used for breeding salt-resistant oyster varieties, the oyster-inhibiting... CHK1 The gene expression reagent is used for mutating or knocking out oysters. CHK1 Recombinant plasmids of genes, etc.

[0026] Specifically, in the above application of the present invention, the oyster is a Hong Kong oyster.

[0027] Specifically, the salt stress is high salt stress, with a salinity greater than 30‰.

[0028] More specifically, the salinity of the high salt stress is 30‰ to 40‰.

[0029] Beneficial effects:

[0030] This invention utilizes targeted oysters CHK1 Silenting of the gene with siRNA was found to suppress oysters. CHK1 Gene expression can reduce oyster mortality under salt stress conditions, i.e., inhibit oyster... CHK1 Gene expression can enhance the salt stress resistance of oysters. Therefore, this invention provides a method for improving the salt stress resistance of oysters. Alternatively, gene mutation or knockout of oysters can also be used. CHK1 This invention relates to the development of salt-resistant oyster varieties. It facilitates resistance breeding of oysters and reduces the impact of salt stress on oyster growth. Attached Figure Description

[0031] Figure 1 Obtained by cloning ChCHK1 Full-length cDNA sequence of the gene and analysis results.

[0032] Figure 2 Different tissues of Hong Kong oysters before and after high salt stress ChCHK1 Relative expression levels; in the figure express P <0.05; express P <0.01; ns indicates no significant difference.

[0033] Figure 3 For silence ChCHK1 The effect of genes on the cell cycle of Hong Kong oysters under high salt stress; A in the figure represents the cell cycle detection results of the blank control group; B represents the cell cycle detection results of the high salt stress group (blank + high salt); C represents the cell cycle detection results of the negative control group (GFP-siRNA + high salt); D represents the cell cycle detection results of the CHK1 interference group (CHK1-siRNA + high salt); E represents the percentage of blood cells in each phase of each group; express P <0.05; express P <0.01; ns indicates no significant difference.

[0034] Figure 4 The figures show the changes in the number of surviving individuals and the mortality rate of Hong Kong oysters in each group during the high salt stress period; A in the figure represents the number of surviving individuals of Hong Kong oysters in each group after 10 days of high salt stress; B represents the survival rate of Hong Kong oysters in each group after 10 days of high salt stress. Detailed Implementation

[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0036] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0037] Example 1: Hong Kong Oyster CHK1 Cloning and analysis of the full-length cDNA sequence of the gene

[0038] To clone Hong Kong oysters CHK1 Gene( ChCHK1 Based on the full-length cDNA sequence of the gene, the present invention designed primers as shown in Table 1. Using the primers, the cDNA was cloned using the RevertAid first-strand cDNA synthesis kit (Thermo Fisher), the 5' RACE system for rapid amplification of cDNA ends (Thermo Fisher), and the SMART RACE cDNA amplification kit (Clontech). ChCHK1 The full-length cDNA sequence of the gene. Specific primers are included. ChCHK1 -outer-F and ChCHK1 -outer-R was designed based on a partial sequence of the Hong Kong oyster transcriptome. (Using...) ChCHK1 -inner-F and ChCHK1 Nested PCR was performed using inner-R primers to enrich specific DNA bands. ChCHK1-test-F and ChCHK1 -test-R is used for PCR verification to confirm the ligated nucleotide sequence.

[0039] Table 1 Cloning ChCHK1 Primers used for the full-length cDNA sequence of the gene

[0040]

[0041] For cloned products ChCHK1 The full-length cDNA sequence of the gene was analyzed in this invention. Specifically, open reading frames were identified using the ORF Finder program (https: / / www.ncbi.nlm.nih.gov / orffinder / ); transmembrane domains were predicted using the TMHMM program (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ); signal peptides were predicted using the SignalP program (https: / / services.healthtech.dtu.dk / services / SignalP-6.0 / ); and the amino acid sequence of the encoded protein was analyzed using the NCBI Conserved Domains Database (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi).

[0042] Cloned by this invention ChCHK1 The full-length cDNA sequence of the gene is shown in SEQ ID NO.9, the open reading frame (ORF) sequence is shown in SEQ ID NO.10, and the amino acid sequence of the protein encoded by the ORF is shown in SEQ ID NO.11.

[0043] Cloned by this invention ChCHK1 The full-length cDNA sequence of the gene and analysis results are as follows: Figure 1 As shown. By Figure 1 It can be seen that, ChCHK1 The full-length cDNA sequence of the gene is 1824 bp, containing a 1458 bp open reading frame (ORF), a 225 bp 5' untranslated region (UTR), and a 141 bp 3' untranslated region. Its polyadenylation signal sequence (attaaa) is located upstream of the poly(a) tail. The ORF encodes 485 amino acids and lacks a signal peptide and transmembrane domain. The predicted polypeptide sequence contains a conserved, leucine-rich STKc-Chk1 domain at the C-terminus. Comparison of the amino acid sequences of CHK1 among different species, including the Hong Kong oyster... CHK1 Genes and the long oyster ( Crassostrea gigas )of CHK1It has the highest gene homology, at 99.18%.

[0044] Example 2 ChCHK1 Tissue expression characterization analysis of gene responses to salt stress

[0045] Two groups were set up, divided into a high-salt group (40‰) and a control group (20‰) based on salinity. Eighty healthy Hong Kong oysters were selected and randomly divided into the two groups for a 48-hour salt stress test. After the salt stress test, hemolymph, mantle, adductor muscle, hepatopancreas, gonads, and gill tissues of the oysters were collected for later use.

[0046] Total RNA was extracted from various tissues of oysters using the Sangon UNlQ-10 column-based Trizol total RNA extraction kit and reverse transcribed into cDNA. qRT-PCR was then used to detect the levels of total RNA in different tissues of Hong Kong oysters before and after high salt stress. ChCHK1 The relative expression levels were determined. Specifically, qRT-PCR was performed using a LightCycler 96 RT-PCR system with dye-based quantitative PCR premix, using β-actin as an internal control, and employing 2... -ΔΔCt The relative expression level of the target gene is calculated using this method.

[0047] The sequences of the primers used for qRT-PCR are shown below:

[0048] ChCHK1 -F: CACACGAAAGGAGTACCCACAGAG (SEQ ID NO.12);

[0049] ChCHK1 -R: TCGAAACACAGTAGCCAGTCCAAAG (SEQ ID NO. 13).

[0050] β-actin-F: CTAAACACCGTCCAGTCACTCTTG (SEQ ID NO. 14);

[0051] β-actin-R:CAGTTAAAGCATTTGAAGCCTCCTC (SEQ ID NO. 15).

[0052] The qRT-PCR reaction system is shown in Table 2. The qRT-PCR reaction conditions are: 95℃ pre-denaturation for 5 min, then 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 72℃ extension for 15 s, 45 cycles, and finally 37℃ cooling for 30 s; each sample was technically replicated three times.

[0053] Table 2. Fluorescence quantitative reaction system

[0054]

[0055] qRT-PCR analysis revealed differences in salinity in different tissues of Hong Kong oysters before and after high salt stress. ChCHK1 Relative expression levels, such as Figure 2 As shown. By Figure 2 It can be seen that, ChCHK1 It is constitutively expressed in all tissues. After 48 hours of high salt stress, ChCHK1 The relative expression levels in gonads, gills, adductor muscle, hepatopancreas, and mantle were all significantly upregulated. Specifically, the upregulation in gonads was 1.97-fold (…). P <0.05%, upregulated 2.96 times in the gills ( P <0.01), upregulated 3.15 times in the adductor muscle ( P <0.01%, and upregulated 7.22-fold in the liver and pancreas ( P <0.01%, upregulated 2.41 times in the mantle ( P <0.05).

[0056] The above results indicate that high salt stress can induce ChCHK1 It is expressed in large quantities in the gonads, gills, adductor muscle, hepatopancreas, and mantle of the Hong Kong oyster.

[0057] Example 3: Silence ChCHK1 Effects of genes on the cell cycle of Hong Kong oysters under high salt stress

[0058] This invention is based on the clone obtained in Example 1. ChCHK1 Specific primers were designed for the full-length cDNA sequence of the gene and its conserved domains. ChCHK1 -siRNA-F / R, using gill / mantle cDNA from Hong Kong oysters as a template, was obtained by PCR amplification. ChCHK1 DNA fragments, which are then synthesized ChCHK1 -siRNA. Using pEGFP-N3 plasmid as a template, the GFP sequence was amplified using GFP-siRNA-F / R primers to synthesize GFP-siRNA as a negative control.

[0059] The sequences of the primers used to prepare siRNA are shown below:

[0060] ChCHK1 -siRNA-F: CAGACTTTGGACTGGCTAC (SEQ ID NO. 16);

[0061] ChCHK1 -siRNA-R: AGATTCGTTTTGAAGGGAC (SEQ ID NO. 17).

[0062] GFP-siRNA-F: ATGGTGAGCAAGGGCGAGGA (SEQ ID NO. 18);

[0063] GFP-siRNA-R: TTACTTGTACAGCTCGTCCA (SEQ ID NO.19).

[0064] Synthetic ChCHK1 - The sequences of the siRNA are as follows (SEQ ID NO.20):

[0065] cagacuuuggacuggcuacuguguuucgauaucaaggaaauacacggcaguuagaaaaguguuguggaacagucccuuauauagcuccagaaguguugucaaggaaacccuaugaugcagaaccagcugauauuugguccugugcagugauauuaguagcucucuuagcaggagagcugccaugggaugagccaacguaugguugucaggaguacugugauuggaaggacuguaaaaucaccaaaacucccuggaacaaaauugacaaucuggcauugucauuacugagaaaacuguugguagagaacagguccaaaagguacaccaucagacagaucagggaucaucagugguucaacaaaaacuucaacaggacagccuuaggucagcugaaccgccuccccuccucacccaccagcucucccucaaguacgggucccuucaaacgaaucu;

[0066] The sequences of the synthetic GFP-siRNA are as follows (SEQ ID NO.21):

[0067] .

[0068] *According to the WIPO Sequence software editing rules, nucleotide sequences must contain only the symbols listed in "WIPO ST.26 Annex I, Part 1". The base "t" is equivalent to "u" in an RNA sequence. Therefore, the present invention... ChCHK1 In both the -siRNA and GFP-siRNA sequences, the base "u" is changed to "t" in the sequence listing.

[0069] The PCR reaction system is shown in Table 3. The reaction conditions were: 95℃ pre-denaturation for 5 min, followed by 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, and a final extension at 72℃ for 10 min. The obtained PCR products were subjected to agarose gel electrophoresis, and the target bands were recovered using an OMEGA gel extraction kit. ChCHK1 Using PCR products of GFP as templates, unpurified siRNA was obtained using the Full Gold T7 high-efficiency transcription kit. Finally, EasyPure was used to... ® An RNA purification kit was used to purify unpurified siRNA to obtain... ChCHK1 -siRNA and GFP-siRNA were used, and the concentration of the obtained siRNA was adjusted to 1 μg / μL using NanoDrop.

[0070] Table 3 PCR reaction system

[0071]

[0072] In the siRNA interference experiment, four groups were set up: a blank control group, a high-salt stress group (blank + high salt), a negative control group (GFP-siRNA + high salt), and a CHK1 interference group (CHK1-siRNA + high salt). Forty healthy oysters were randomly divided into four groups and temporarily housed in seawater at 25℃ and 20‰ for 72 h. On the fourth day, 50 μL of GFP-siRNA at a concentration of 1 μg / μL was injected into the adductor muscle of each oyster in the negative control group and the CHK1 interference group, respectively. ChCHK1 siRNA; 48 h after injection, the salinity of the culture seawater in the high salt stress group, negative control group and CHK1 interference group was adjusted to 40‰ with sea salt crystals. After 48 h of high salt stress, blood cells were collected from Hong Kong oysters. The blood from 3 oysters was combined into 1 tube, and a total of 3 tubes were collected for use.

[0073] Cell cycle and apoptosis detection kit (Beyotime) was used to detect the cell cycle of blood cells by flow cytometry. The specific procedure was as follows: collected blood cells were washed with 70% ice-cold ethanol at 4°C with PBS, and then incubated with 25 μL propidium iodide (PI) and 10 μL RNase A for 30 min. The fluorescence of PI was detected using Attune CytPix (Thermo Fisher Scientific), and the data were analyzed using Modfit LT 5.0 software.

[0074] silence ChCHK1 The effects of genes on the cell cycle of Hong Kong oysters under high salt stress, such as Figure 3 As shown; Figure 3 In the figure, A represents the cell cycle detection result of the blank control group; Figure 3In the figure, B represents the cell cycle detection results of the high salt stress group (blank + high salt); Figure 3 C in the figure represents the cell cycle detection results of the negative control group (GFP-siRNA + high salt); Figure 3 In the figure, D represents the cell cycle detection result of the CHK1 interference group (CHK1-siRNA + high salt); Figure 3 In this context, E represents the percentage of blood cells in each group and at each stage. Figure 3 As shown in A-D, in the blank control group, the percentages of blood cells in the G0 / G1, S, and G2 / M phases were 89.44%, 7.65%, and 2.9%, respectively. Figure 3 In group A), the rates were 92.94%, 4.4%, and 2.67% in the high-salt stress group. Figure 3 In the negative control group, the percentages of blood cells in the G0 / G1, S, and G2 / M phases were 93.19%, 4.41%, and 2.4%, respectively. Figure 3 In the C group, the CHK1 interference group had 86.44%, 8.56%, and 4.99% respectively. Figure 3 (D in the middle).

[0075] Statistical analysis of the proportion of blood cells in the G0 / G1, S, and G2 / M phases, from Figure 3 As shown in E, compared with the blank control group, high salt stress significantly increased the percentage of blood cells in the G0 / G1 phase by 5.58%. P <0.05), the significance level in the S phase decreased by 48.32% ( P <0.05, suggesting that high salt stress activates the cell cycle arrest pathway, causing cell cycle arrest at the G0 / G1 phase. Compared with the negative control group, the percentage of blood cells in the G0 / G1 phase was significantly reduced by 4.99% in the CHK1 interference group. P <0.05), while the percentage of blood cells in the S phase significantly increased to 80.45% ( P <0.01), with no significant change in the G2 / M phase. The proportions of cells in the G0 / G1, S, and G2 / M phases in the CHK1 interference group were not significantly different from those in the blank control group. P >0.05).

[0076] The above results indicate that ChCHK1 The silencing of cells restored the cell cycle, allowing a large number of cells to progress from the G0 / G1 phase to the S phase.

[0077] Example 4: Silence ChCHK1 The Influence of Genes on the Survival Rate of Oysters in Hong Kong under High Salt Stress

[0078] Referring to Example 3, blank control group, high salt stress group, negative control group, and CHK1 interference group were set up respectively. Healthy Hong Kong oysters were selected for salt stress experiments. Ten oysters were placed in each of the blank control group, high salt stress group, negative control group, and CHK1 interference group. Each group of oysters was stressed in 40‰ seawater for 10 days at a culture temperature of 25±0.5℃, and fed with *Isochrysis galbana* twice daily. The condition of the oysters was observed. If the shell was open, and there was no closure reaction when the soft body was touched with a finger, and a putrid odor was present, it was considered dead. The dead oysters were promptly removed, and the number of dead oysters was recorded. The oyster survival rate (SR) was calculated using the following formula:

[0079] SR(%)=(n1-n2) / n1×100%;

[0080] In the formula, n1 is the initial number of oysters (individuals), and n2 is the number of dead oysters (individuals).

[0081] Changes in the survival rate and mortality rate of Hong Kong oysters during periods of high salinity stress are as follows: Figure 4 As shown; Figure 4 In this context, A represents the number of Hong Kong oysters that survived 10 days of high salt stress. Figure 4 B in the figure represents the survival rate of Hong Kong oysters under high salt stress for 10 days.

[0082] Depend on Figure 4 The results showed that in the blank control group, no individual Hong Kong oysters died during the cultivation period, with a survival rate of 100%. In the high-salt stress group and the negative control group, large-scale mortality occurred, with survival rates decreasing to 10‰ and 20%, respectively. The CHK1 interference group experienced small-scale mortality, but the survival rate recovered to 80%. These results indicate that high-salt stress induced mortality in Hong Kong oysters, while the silencing agent... ChCHK1 The gene significantly improved survival rates to near-control levels. This is known as the silent oyster. CHK1 Genes can enhance oysters' resistance to salt stress and reduce oyster mortality under salt stress conditions.

[0083] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for improving the salt stress resistance of oysters, characterized in that, Inhibiting oysters through RNA interference CHK1 Gene expression; the oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.9; the reagent used for RNA interference is siRNA targeting the CHK1 gene of oyster.

2. The method according to claim 1, characterized in that, The oysters mentioned are Hong Kong oysters.

3. The method according to claim 1, characterized in that, The salt stress is high salt stress, with a salinity greater than 30‰.

4. The method according to claim 1, characterized in that, The sequence of the siRNA is shown in SEQ ID NO.

20.

5. The application of siRNA targeting the CHK1 gene in oysters in improving oyster salt stress resistance, characterized in that... The oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.

9.

6. The application of siRNA targeting the CHK1 gene in oysters in the preparation of products for improving the salt stress resistance of oysters, characterized in that, The oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.

9.

7. The application of siRNA targeting the CHK1 gene in oysters in the breeding of salt-resistant oyster varieties, characterized in that, The oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.

9.

8. The application of siRNA targeting the CHK1 gene of oysters in the preparation of products for breeding salt-stress-resistant oyster varieties, characterized in that, The oyster CHK1 The cDNA sequence of the gene is shown in SEQ ID NO.

9.

9. The application according to any one of claims 5 to 8, characterized in that, The oysters mentioned are Hong Kong oysters.

10. The application according to any one of claims 5 to 8, characterized in that, The sequence of the siRNA is shown in SEQ ID NO.20.

Images