A recombinant plasmid and recombinant cell for expressing glutamate decarboxylase 65, a construction method and application thereof

The pEE12.4-N-GAD65 recombinant plasmid was constructed using In-Fusion Cloning technology and screened in CHO cells, solving the problems of low GAD65 expression and insufficient activity, and achieving efficient and stable GAD65 production.

CN120944975BActive Publication Date: 2026-07-03NINGBO MEDICAL SYSTEM BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGBO MEDICAL SYSTEM BIOTECHNOLOGY CO LTD
Filing Date
2025-10-17
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing technologies for exogenous expression of glutamate decarboxylase 65 (GAD65) have low yields and insufficient post-translational modifications, resulting in insufficient activity and stability, making it difficult to meet clinical needs.

Method used

The pEE12.4-N-GAD65 recombinant plasmid was constructed using In-Fusion Cloning technology. Combined with the CHO cell expression system, the expression level of GAD65 was increased by a dual drug screening system. Stable cell lines with high expression were screened using a dual marker screening system of Neo and GS genes.

Benefits of technology

It significantly improved the expression level and stability of GAD65, bringing it closer to its natural conformation, thus solving the problems of low yield and insufficient activity in existing technologies and achieving efficient GAD65 production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944975B_ABST
    Figure CN120944975B_ABST
Patent Text Reader

Abstract

The application provides a kind of recombinant plasmid and recombinant cell for expressing glutamate decarboxylase 65, its construction method and application, belong to biotechnology field, the recombinant plasmid for expressing glutamate decarboxylase 65 provided by the application is named pEE12.4-N-GAD65, the recombinant plasmid includes the nucleic acid fragment shown in SEQ ID No.1 and pEE12.4-N vector, the targeted cell of the recombinant plasmid is CHO cell.Using the recombinant plasmid and recombinant cell provided by the application, the exogenous expression yield of GAD65 can be greatly improved, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a recombinant plasmid and recombinant cells for expressing glutamate decarboxylase 65, their construction method, and their applications. Background Technology

[0002] Diabetes mellitus is a chronic disease caused by absolute or relative insulin deficiency and impaired insulin utilization, mainly classified into three types: type 1, type 2, and gestational diabetes mellitus. Glutamate decarboxylase antibody (GADA) is an immunomarker in the early stages of type 1 diabetes and also serves as an indicator of treatment efficacy in patients with type 1 diabetes. Its antigen, glutamate decarboxylase (GAD), is a key antigen inducing type 1 diabetes and a key rate-limiting enzyme of the inhibitory neurotransmitter gamma-aminobutyric acid (GABA). It can be divided into two types: GAD65 and GAD67 (relative molecular masses of 65 kDa and 67 kDa, respectively), with only GAD65 present in the human body. With the development of in vitro diagnostic technology, the development of stable and high-yield GAD65 has become particularly important.

[0003] The earliest extraction method for GAD65 involved isolating pancreatic islet tissue from the pancreas of organ donors and purifying GAD65. Although GAD65 extracted through manufacturing methods has high enzyme activity and antigenicity, the protein yield of this extraction method is extremely low due to the difficulty in obtaining tissue samples, making it unsuitable for large-scale clinical use.

[0004] Currently, exogenous expression has become the main method for producing GAD65. Exogenous expression is mainly divided into E. coli expression, yeast expression, baculovirus expression, and mammalian cell expression. E. coli expression has low cost and extremely high yield, but because it uses a prokaryotic cell expression system, the GAD65 produced by this method lacks necessary post-translational modifications, resulting in unstable products and low native activity. Although the post-translational modification matrix of yeast expression is close to that of higher eukaryotes, the protein product has poor stability and expresses non-target proteins, which increases the subsequent isolation cost. Baculovirus expression technology has high requirements and high cost, making it unsuitable for industrial applications. The post-translational modification mechanism of mammalian cell expression is closest to the human conformation, but its expression level is relatively low. Summary of the Invention

[0005] The technical problem to be solved by this invention is: how to increase the yield of exogenously expressed GAD65.

[0006] To address the aforementioned technical problems, the first aspect of this invention provides a recombinant plasmid for expressing glutamate decarboxylase 65, the recombinant plasmid being named pEE12.4-N-GAD65, the recombinant plasmid comprising:

[0007] The nucleic acid fragment shown in SEQ ID No. 1 and the pEE12.4-N vector, wherein the target cell of the recombinant plasmid is CHO cells.

[0008] Preferably, the pEE12.4-N carrier comprises:

[0009] The SV40-Neo-polyA fragment and pEE12.4 plasmid shown in SEQ ID No.4.

[0010] A second aspect of the present invention provides a method for preparing the recombinant plasmid described in the first aspect, comprising the following steps:

[0011] S1: Synthesize the Neo-F primer shown in SEQ ID No. 2 and the Neo-R primer shown in SEQ ID No. 3;

[0012] S2: Amplify the SV40-Neo-polyA fragment shown in SEQ ID No. 4 using the Neo-F primers shown in SEQ ID No. 2 and the Neo-R primers shown in SEQ ID No. 3;

[0013] S3: Synthesize the pEE-F primer shown in SEQ ID No. 5 and the pEE-R primer shown in SEQ ID No. 6;

[0014] S4: Amplify the pEE12.4 plasmid using the pEE-F primers shown in SEQ ID No. 5 and the pEE-R primers shown in SEQ ID No. 6;

[0015] S5: Connect the pEE12.4 plasmid and the SV40-Neo-polyA fragment to obtain the pEE12.4-N vector;

[0016] S6: Using T4 DNA ligase, ligate the nucleic acid fragment shown in SEQ ID No.1 and the pEE12.4-N vector to obtain the pEE12.4-N-GAD65 plasmid.

[0017] Preferably, in step S5, the pEE12.4 plasmid and the SV40-Neo-polyA fragment are joined using In-Fusion Cloning.

[0018] In the technical solution of this invention, the template plasmid pEE12.4-N-GAD65 is based on the pEE12.4 plasmid, and the Neo gene is introduced through In-Fusion Cloning technology. This makes pEE12.4-N-GAD65 have both the GS gene and the Neo gene, and can be screened using G418 and methionine sulfoxide imine.

[0019] In the technical solution provided by this invention, stable cell line clones can be screened using the pEE12.4-N-GAD65 provided by this invention and a dual-marker gene screening system. Compared with the pEE12.4 of the GS single screening system, its positive rate is higher. At the same time, the expression level of recombinant proteins screened by pEE12.4-N-GAD65 provided by this invention is significantly improved compared with the GS single screening system.

[0020] The third aspect of this invention provides the application of the recombinant plasmid described in the first aspect in increasing the expression level of glutamate decarboxylase 65.

[0021] The fourth aspect of the present invention provides a recombinant cell that highly expresses glutamate decarboxylase 65, wherein the recombinant cell is a CHO cell and contains the aforementioned recombinant plasmid.

[0022] The fifth invention provides a method for constructing the recombinant cells described in the fourth aspect, comprising the following steps:

[0023] A1: Construct the pEE12.4-N-GAD65 plasmid;

[0024] A2: Transfect pEE12.4-N-GAD65 plasmid into CHO cells, culture CHO cells, and obtain successfully transfected positive CHO cells;

[0025] A3: Screening for monoclonal cell lines that highly express glutamate decarboxylase 65 from positive CHO cells.

[0026] Preferably, step A3 includes the following steps:

[0027] Dual drug screening was performed in CDP9 medium containing methionine sulfoxide and G418.

[0028] Preferably, the content of the methionine sulfoxide in the CDP9 medium is 20-30 μM, and the content of G418 in the CDP9 medium is 700-900 μM.

[0029] The sixth aspect of this invention provides the application of the recombinant cells described in the fourth aspect in increasing the expression level of glutamate decarboxylase 65.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. This invention constructs a dual expression vector pEE12.4-N-GAD65 by combining the Neo gene screening system and the GS gene amplification system, and then uses dual drug screening in CHO cells to significantly increase the expression level of GAD65 antigen;

[0032] 2. This invention employs seamless cloning technology, avoiding the limitations of multiple cloning sites and the introduction of additional sequences in traditional enzyme digestion methods, significantly shortening the vector construction cycle and improving the insertion success rate;

[0033] 3. This invention uses the CHO expression system, combined with the aforementioned pEE12.4-N-GAD65, to enable the exogenously expressed GAD65 to have post-translational modifications close to the natural conformation, thus solving the defects of insufficient activity and poor stability of existing GAD65. Attached Figure Description

[0034] Figure 1 The results of agarose gel electrophoresis of the amplification products in steps S2 and S4 in Example 1 of this invention;

[0035] Figure 2 This is the experimental result of bacterial culture PCR verification after pEE12.4-N was transformed into Top10 competent cells in Example 1 of the present invention;

[0036] Figure 3 This is the plasmid map of pEE12.4-N in Example 1 of the present invention;

[0037] Figure 4 This is an electrophoresis image of the nucleic acid after enzyme digestion in Example 2 of the present invention;

[0038] Figure 5 This is an electrophoresis image used to verify the double enzyme digestion in Example 2 of the present invention;

[0039] Figure 6 This is the plasmid map of pEE12.4-GAD65 in Example 2 of the present invention;

[0040] Figure 7 This is the plasmid map of pEE12.4-N-GAD65 in Example 2 of the present invention;

[0041] Figure 8 This refers to the standard curve in Embodiment 4 of the present invention;

[0042] Figure 9 The images show the SDS-PAG and western blot results from Example 6 of this invention. Detailed Implementation

[0043] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation methods and typical parameters of the present invention, and are not intended to limit the parameter range described in the present invention. Reasonable variations derived therefrom are still within the protection scope of the claims of the present invention.

[0044] It should be noted that the endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0045] To obtain glutamate decarboxylase 65 (GAD65) with a structure close to the human conformation and high exogenous expression level, a specific embodiment of the present invention provides a recombinant plasmid for expressing glutamate decarboxylase 65, named pEE12.4-N-GAD65, which includes:

[0046] The nucleic acid fragment shown in SEQ ID No. 1 and the pEE12.4-N vector, wherein the target cell of the recombinant plasmid is CHO cells.

[0047] In the above embodiments, the pEE12.4-N carrier includes:

[0048] The SV40-Neo-polyA fragment and pEE12.4 plasmid shown in SEQ ID No.4.

[0049] More specifically, in the above embodiments, the pEE12.4-N vector is obtained by inserting the SV40-Neo-polyA fragment shown in SEQ ID No. 4 into the pEE12.4 vector, and the pEE12.4-N vector is a Neo and GS dual-marker gene screening system.

[0050] More specifically, in the above embodiments, pEE12.4-N-GAD65 is obtained by inserting the nucleic acid fragment shown in SEQ ID No. 1 between the SmaⅠ restriction site and the EcoRⅠ restriction site on the basis of the aforementioned pEE12.4-N vector. In this embodiment, pEE12.4-N-GAD65 can be used to express GAD65, and the promoter in pEE12.4-N-GAD65 is CMV.

[0051] In the above embodiments, the preparation method of pEE12.4-N-GAD65 includes the following steps:

[0052] S1: Synthesize the Neo-F primer shown in SEQ ID No. 2 and the Neo-R primer shown in SEQ ID No. 3;

[0053] S2: Amplify the SV40-Neo-polyA fragment shown in SEQ ID No. 4 using the Neo-F primers shown in SEQ ID No. 2 and the Neo-R primers shown in SEQ ID No. 3;

[0054] S3: Synthesize the pEE-F primer shown in SEQ ID No. 5 and the pEE-R primer shown in SEQ ID No. 6;

[0055] S4: Amplify the pEE12.4 plasmid using the pEE-F primers shown in SEQ ID No. 5 and the pEE-R primers shown in SEQ ID No. 6;

[0056] S5: Connect the pEE12.4 plasmid and the SV40-Neo-polyA fragment to obtain the pEE12.4-N vector;

[0057] S6: Using T4 DNA ligase, ligate the nucleic acid fragment shown in SEQ ID No.1 and the pEE12.4-N vector to obtain the pEE12.4-N-GAD65 plasmid.

[0058] In step S5 of the above embodiment, the pEE12.4 plasmid and the SV40-Neo-polyA fragment are ligated using in-fusion cloning. This invention employs seamless cloning technology to integrate the Neo gene into pEE12.4. Compared to traditional molecular cloning, seamless cloning has advantages such as being unrestricted by restriction enzyme sites, having a shorter experimental cycle, and a higher success rate.

[0059] A specific embodiment of the present invention also provides an application of the aforementioned recombinant plasmid for expressing glutamate decarboxylase 65 in increasing the expression level of glutamate decarboxylase 65.

[0060] Specifically, the application includes transfecting pEE12.4-N-GAD65 into CHO cells to obtain recombinant cells that highly express glutamate decarboxylase 65 for the production of GAD65.

[0061] More specifically, the method for constructing recombinant cells that highly express glutamate decarboxylase 65 includes the following steps:

[0062] A1: Construct the pEE12.4-N-GAD65 plasmid;

[0063] A2: Transfect pEE12.4-N-GAD65 plasmid into CHO cells, culture CHO cells, and obtain successfully transfected positive CHO cells;

[0064] A3: Screening for monoclonal cell lines that highly express glutamate decarboxylase 65 from positive CHO cells.

[0065] In step S3 of the above embodiment, the dual drug screening is performed using CDP9 medium containing methionine sulfoxide and G418.

[0066] In the above embodiments, the content of methionine sulfoxide imine in CDP9 medium is 20~30 μM, and the content of G418 in CDP9 medium is 700~900 μM.

[0067] The technical solutions of the present invention are further described below through specific embodiments. Unless otherwise defined, all terms, symbols, and other scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. In some cases, terms with conventional meanings are limited herein for clarification or ease of reference, and such limitations should not be construed as indicating a significant difference from conventional understanding in the art. The technical methods described or referenced herein are generally well understood by those skilled in the art and have been employed by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents, and instruments shall be performed according to the manufacturer's instructions and parameters.

[0068] Example 1

[0069] Construction of pEE12.4-N

[0070] S1: Synthesize the Neo-F primer shown in SEQ ID No. 2 and the Neo-R primer shown in SEQ ID No. 3, wherein,

[0071] SEQ ID No.2: GCGATTCTGTCTGAGGCGGAAAGAACCAGC;

[0072] SEQ ID No.3: ATATTTGCGACACCACACAAAAAACCAACACACAGATG;

[0073] S2: The SV40-Neo-polyA fragment shown in SEQ ID No. 4 was amplified using the Neo-F primers shown in SEQ ID No. 2 and the Neo-R primers shown in SEQ ID No. 3. The amplification system is shown in Table 1.

[0074] Table 1

[0075]

[0076] The amplification procedure is shown in Table 2:

[0077] Table 2

[0078]

[0079] S3: Synthesize the pEE-F primer shown in SEQ ID No. 5 and the pEE-R primer shown in SEQ ID No. 6, wherein,

[0080] SEQ ID No.5: GGTTTTTGTGTGGTGTCGCAAATATCGCAGTTTCGATA;

[0081] SEQ ID No.6: TTCCGCCTCAGACAGAATCGCCCAAGTCAC;

[0082] S4: The pEE12.4 plasmid was amplified using the pEE-F primer shown in SEQ ID No. 5 and the pEE-R primer shown in SEQ ID No. 6, and the amplification system is shown in Table 3:

[0083] Table 3

[0084]

[0085] The amplification procedure is shown in Table 4:

[0086] Table 4

[0087]

[0088] The amplification products from steps S2 and S4 were subjected to agarose gel electrophoresis for detection. The results are as follows: Figure 1 As shown, Figure 1 In the image, lane 1 shows the amplification results of the pEE12.4 plasmid, lane 2 shows the amplification results of SV40-Neo-polyA, and lane M is the marker. The molecular weights from top to bottom are 10000bp, 7000bp, 4000bp, 2000bp, 1000bp, 500bp, and 250bp.

[0089] S5: The amplification product from step S4 was digested with DMT restriction endonuclease to obtain the linearized vector pEE12.4. The linearized vector pEE12.4 and the SV40-Neo-polyA fragment were then ligated to obtain the pEE12.4-N vector. The ligation system is shown in Table 5.

[0090] Table 5

[0091]

[0092] The system shown in Table 5 was reacted at 50 °C for 20 min to obtain pEE12.4-N, which was then stored on ice.

[0093] pEE12.4-N was transformed into Top10 competent cells, and positive clones with the inserted target fragment were verified by colony PCR. The PCR results are as follows: Figure 2 As shown, Figure 2 In the diagram, lanes 1-6 represent the PCR amplification results of the bacterial culture, and lane M is the marker. The molecular weights, from top to bottom, are 10000bp, 7000bp, 4000bp, 2000bp, 1000bp, 500bp, and 250bp. Figure 2 As can be seen, the SV40-Neo-polyA fragment has been accurately inserted into pEE12.4. The plasmid map of pEE12.4-N is shown below. Figure 3 As shown.

[0094] Example 2

[0095] Construction of pEE12.4-N-GAD65

[0096] Commercially available pEE12.4 and pEE12.4-N prepared in Example 1 were digested with SmaI and EcoRI at 37°C for 1 h, respectively, and then reacted at 75°C for 10 min to obtain linearized vectors pEE12.4 and pEE12.4-N. The digestion system is shown in Table 6.

[0097] Table 6

[0098]

[0099] After enzyme digestion, the digestion products were subjected to nucleic acid electrophoresis. The results of the nucleic acid electrophoresis are as follows: Figure 4 As shown, Figure 4 In the diagram, lane 1 is the linearized vector pEE12.4, lane 2 is the linearized vector pEE12.4-N, lane M is the marker, and the molecular weights from top to bottom are 2000bp, 1000bp, 500bp, 250bp, and 100bp.

[0100] Using T4 DNA ligase and the nucleic acid fragment shown in SEQ ID No. 1, the aforementioned linearized vector pEE12 and linearized vector pEE12.4-N were ligated, respectively. The ligation system is shown in Table 7.

[0101] Table 7

[0102]

[0103] The linking system shown in Table 7 was reacted at 16℃ for 8-12 h to obtain pEE12.4-GAD65 and pEE12.4-N-GAD65.

[0104] pEE12.4-GAD65 and pEE12.4-N-GAD65 were transformed into Top10 competent cells, and positive clones with inserted target fragments were verified by double enzyme digestion after culture. The results are as follows: Figure 5 As shown, Figure 5 In the diagram, lanes 1-3 represent the results of double digestion experiments of pEE12.4-GAD65, lanes 4-6 represent the results of double digestion experiments of pEE12.4-N-GAD65, and lane M is the marker. The molecular weights from top to bottom are 2000bp, 1000bp, 500bp, 250bp, and 100bp. Figure 5 As can be seen, the nucleic acid sequence shown in SEQ ID No. 1 has been completely integrated into the corresponding vector. The plasmid map of pEE12.4-GAD65 is shown below. Figure 6 As shown, the plasmid map of pEE12.4-N-GAD65 is as follows: Figure 7 As shown.

[0105] Example 3

[0106] Transfection and screening

[0107] CHO-K1 cells and OPM CDP9 culture medium (purchased from Optimum Biotech) were used for screening recombinant protein expression and high-expression cell lines under suspension culture conditions. Frozen cells were placed in a 37°C water bath, and within 1 minute, the thawed cell culture was transferred to a 125-mL shake flask containing 29 mL of pre-warmed culture medium. The cells were cultured at 37°C, 5% CO2, and 115 rpm. The density was maintained at 3 × 10⁻⁶ cells / mL during passage. 5 Transfection was performed when the cell viability was ≥98% at a rate of 1 / mL.

[0108] One day before electroporation, CHO-K1 cells were passaged in suspension culture at a cell density of 8 × 10⁶ cells / year. 5 The cell / mL culture volume was 30 mL OPM CDP9. The next day, 1×10⁶ cells / mL were collected. 7 Cells were electroporated using the Bio-rad electroporator according to the instruction manual. pEE12.4-GAD65 and pEE12.4-N-GAD65 from Example 2 were transfected into CHO-K1 cells and cultured in an incubator at 37°C, 5% CO2, and 125 rpm.

[0109] After the cells regained viability, pressure selection was performed. CHO-K1 cells transfected with recombinant plasmid pEE12.4-GAD65 were selected for expression under the selection pressure conditions of CDP9 + 25 μM MSX, while CHO-K1 cells transfected with recombinant plasmid pEE12.4-N-GAD65 were selected under the selection pressure conditions of CDP9 + 25 μM MSX + 800 μg / mL G418. One week after pressure selection, single clones were selected using the limiting dilution method. Ten 96-well plates were plated with each subclone, one cell per well, for selection of stable cell lines.

[0110] Example 4

[0111] Establish a method for quantitative determination of supernatant protein content using ELISA.

[0112] After transfecting CHO-K1 cells with recombinant plasmid pEE12.4-GAD65, the CHO-K1 cells selected under pressure were then divided into groups of 3 × 10⁻⁶ cells. 5 CHO-K1 cells were seeded at a density of 30 mL CDP9 + 25 μM MSX medium in 125 mL shake flasks and cultured. After transfection of CHO-K1 cells with the recombinant plasmid pEE12.4-N-GAD65, the CHO-K1 cells selected under pressure were cultured at a density of 3 × 10⁻⁶ cells / mL. 5 The cells were seeded at a density of 1 cell / mL in 125 mL shake flasks containing 30 mL CDP9 + 25 μM MSX + 800 μg / mL G418 medium. After culturing for 5 days, the supernatant was collected by centrifugation.

[0113] The purified GAD65 antigen was diluted with CDP9 medium and used as a standard.

[0114] Mouse IgG antibody was coated with coating buffer at 0.5 μg / mL, 100 μL / well, and incubated at 37℃ for 1 h, followed by washing with PBST 3 times. Blocking buffer (PBS + 2% BSA) was added at 37℃ for 2 h, followed by washing with PBST 3 times. Standard and test sample were added at 100 μL / well, and incubated at 37℃ for 1 h, followed by washing with PBST 3 times. Horseradish peroxidase-labeled mouse anti-IgG was used as a secondary antibody, 100 μL / well, and incubated at 37℃ for 1 h, followed by washing with PBST 3 times. TMB substrate chromogenic solution was added at 100 μL / well, and chromogenic reaction was performed for 3 min. The reaction was terminated with H2SO4. The absorbance at 450 nm was measured using a microplate reader, a standard curve was constructed, and the concentration of recombinant protein was calculated. The relevant results are shown in Table 8.

[0115] Table 8

[0116]

[0117] Based on the test results in Table 8, a standard curve was plotted with concentration values ​​on the x-axis and the corresponding OD450 values ​​on the y-axis. The standard curve is shown below. Figure 8 As shown, by Figure 8 It can be seen that the correlation coefficient R of the standard curve 2 =0.9721. Using the standard curve, it can be calculated that under a selection pressure of 25 μM MSX, the protein concentration of GAD65 in the cell supernatant transfected with pEE12.4-GAD65 is 384 mg / L, and under a selection pressure of 25 μM MSX + 800 μg / mL G418, the protein concentration of GAD65 in the cell supernatant transfected with pEE12.4-N-GAD65 is 683 mg / L. After transfecting CHO-K1 with the optimized pEE12.4-N plasmid, the protein expression level is higher than that of the expression plasmid before optimization.

[0118] Example 5

[0119] Rapid screening of stable monoclonal antibodies

[0120] Two weeks after transfection, the cells in Example 3 were cultured and ELISA was performed on the wells from which clones grew. The positive clone rate is shown in Table 9.

[0121] Table 9

[0122]

[0123] As shown in Table 9, the positive clone rate obtained by transfection with the modified pEE12.4-N-GAD65 was higher.

[0124] Clones were selected from two expression vectors, pEE12.4-GAD65 and pEE12.4-N-GAD65. The results of the top 20 clones by OD value were compared using ELISA, and the results are shown in Table 10.

[0125] Table 10

[0126]

[0127] Example 6

[0128] Western blot analysis of GAD65 expression in cell culture supernatant

[0129] The supernatants of pEE12.4-GAD65 and pEE12.4-N-GAD65 expression were taken separately and subjected to SDS-PAGE protein electrophoresis. After electrophoresis, the gel was soaked in 1× transfer buffer for 5 min. A PVDF membrane (polyvinylidene fluoride membrane) of the same size as the gel was taken and soaked in methanol solution for 5 min. Then, a sponge sheet, a PVDF membrane, a gel, and a sponge sheet were sequentially layered on top of the gel. The mixture was then analyzed by GenScript eBlot.TM A series of rapid transfer membrane systems were used for transfer. After protein transfer, the PVDF membrane was removed and blocked in 2% fish skin gelatin solution for 2 h. The blocking solution was discarded, and the membrane was washed three times with PBST for 10 min each time. The PVDF membrane was then immersed in a 1:10000 dilution of goat anti-mouse IgG-HRP secondary antibody and incubated with shaking for 1 h. The membrane was then washed four times with PBST for 10 min each time. The membrane was then developed using freshly prepared SuperSignal chromogenic buffer. TM The West Pico PLUS Chemiluminescent Substrate (Thermo) was used for color development.

[0130] Fish skin gelatin contains no serum proteins, which can significantly reduce interference from non-specific background signals, as shown in the results. Figure 9 As shown, Figure 9 In the diagram, lanes 1-3 show the supernatant expression detection results of pEE12.4-GAD65, and lanes 4-6 show the supernatant expression detection results of pEE12.4-N-GAD65. Figure 9 In the figure, A represents the result of SDS-PAGE protein electrophoresis. Figure 9 In this context, B represents the result of the Western blotting (WB) experiment. Figure 9 It is evident that the protein is the expressed GAD65 fragment, with a protein size of approximately 90 kDa.

[0131] As can be seen from the above examples, using the recombinant plasmid pEE12.4-N-GAD65 for expressing glutamate decarboxylase 65 provided by the present invention and CHO cells introduced with the plasmid can effectively increase the yield of exogenous GAD65 expression, and has broad application prospects.

[0132] While the disclosure is as stated above, its scope of protection is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of this disclosure, and all such changes and modifications will fall within the protection scope of this invention.

Claims

1. A recombinant plasmid for expressing glutamate decarboxylase 65, characterized in that, The recombinant plasmid was named pEE12.4-N-GAD65, and the recombinant plasmid includes... The recombinant plasmid is a nucleic acid fragment shown in SEQ ID No. 1 and a pEE12.4-N vector. The target cell of the recombinant plasmid is CHO cells. The pEE12.4-N vector includes the SV40-Neo-polyA fragment shown in SEQ ID No. 4 and the pEE12.4 plasmid.

2. A method for preparing the recombinant plasmid according to claim 1, characterized in that, Includes the following steps: S1: Synthesize the Neo-F primer shown in SEQ ID No. 2 and the Neo-R primer shown in SEQ ID No. 3; S2: Amplify the SV40-Neo-polyA fragment shown in SEQ ID No. 4 using the Neo-F primers shown in SEQ ID No. 2 and the Neo-R primers shown in SEQ ID No. 3; S3: Synthesize the pEE-F primer shown in SEQ ID No. 5 and the pEE-R primer shown in SEQ ID No. 6; S4: Amplify the pEE12.4 plasmid using the pEE-F primers shown in SEQ ID No. 5 and the pEE-R primers shown in SEQ ID No. 6; S5: Connect the pEE12.4 plasmid and the SV40-Neo-polyA fragment to obtain the pEE12.4-N vector; S6: Using T4 DNA ligase, ligate the nucleic acid fragment shown in SEQ ID No.1 and the pEE12.4-N vector to obtain the pEE12.4-N-GAD65 plasmid.

3. The preparation method according to claim 2, characterized in that, In step S5, the pEE12.4 plasmid and the SV40-Neo-polyA fragment are joined by seamless cloning.

4. The application of the recombinant plasmid according to claim 1 in increasing the expression level of glutamate decarboxylase 65.

5. A recombinant cell that highly expresses glutamate decarboxylase 65, characterized in that, The recombinant cells are CHO cells, and the recombinant cells contain the recombinant plasmid as described in claim 1.

6. A method for constructing recombinant cells according to claim 5, characterized in that, Includes the following steps: A1: Construct the pEE12.4-N-GAD65 plasmid; A2: Transfect pEE12.4-N-GAD65 plasmid into CHO cells, culture CHO cells, and obtain successfully transfected positive CHO cells; A3: Screening monoclonal cell lines that highly express glutamate decarboxylase 65 from positive CHO cells.

7. The construction method as described in claim 6, characterized in that, Step A3 includes the following steps: Dual drug screening was performed in CDP9 medium containing methionine sulfoxide and G418.

8. The construction method as described in claim 7, characterized in that, The content of the methionine sulfoxide imine in CDP9 medium is 20-30 μM, and the content of G418 in CDP9 medium is 700-900 μM.

9. The use of the recombinant cells of claim 5 in increasing the expression level of glutamate decarboxylase 65.

Citation Information

Patent Citations

  • Screening method and application of CHO monoclonal cell strain

    CN107964535A

  • Myeloma strain expressing human glutamic acid decarboxylase

    JP1997313183A