Method for knocking out runx2b gene of allooctoploid carassius auratus gibelio and application thereof
By designing a microinjection method targeting the CRISPR/Cas9 system with gRNA-1 and gRNA-2, the problem of simultaneous editing of the runx2b gene in allogeneic octoploid crucian carp was solved, achieving efficient knockout, significantly reducing intermuscular spines, and forming a stable intermuscular spine-free crucian carp mutant.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
- Filing Date
- 2025-08-04
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient for efficient and simultaneous editing of the runx2b gene in allooctoploid crucian carp, resulting in a negligible reduction in the number of intermuscular spines and low editing efficiency, with risks of off-target effects and non-specific cleavage issues.
Two gRNAs (gRNA-1 and gRNA-2) were designed to target two sets of runx2b alleles from two parents in crucian carp, and were microinjected into fertilized eggs using the CRISPR/Cas9 system to achieve simultaneous editing of eight alleles.
The efficient synchronous knockout of the runx2b gene in the allooctoploid Changfeng crucian carp was achieved, with an editing efficiency of 97.5% to 100%, significantly reducing the number of intermuscular spines and forming a stable mutant of Changfeng crucian carp without intermuscular spines.
Smart Images

Figure CN120966918B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method and application for knocking out the runx2b gene in the allooctoploid crucian carp. Background Technology
[0002] Crucian carp (Carassius auratus) is an important freshwater aquaculture fish in my country. In 2023, its aquaculture production reached 2.8403 million tons, ranking fifth among freshwater aquaculture producers, making a significant contribution to ensuring a stable and effective supply of aquatic products (China Fisheries Statistical Yearbook, 2024). The Changfeng crucian carp was a new crucian carp variety that was systematically bred by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fishery Sciences and the Institute of Hydrobiology of the Chinese Academy of Sciences in 2008. The sixth generation of heterologous gynogenesis was completed in 2015, and it officially passed the national aquatic variety approval in 2016. The Changfeng crucian carp strain uses the hybrid silver crucian carp (Carassius auratus gibelio) D line as the maternal parent and the carp-carp transplanted nucleus fish Xingguo red carp (Cyprinus carpio var. Xingguonensis) as the paternal parent. Through heterologous gynogenesis technology, exogenous genetic material is integrated. Its genome contains the complete genome of the maternal hybrid silver crucian carp and the genome of the paternal Xingguo red carp, forming a genetically stable heterologous octoploid population with approximately 208 chromosomes, about 50 more chromosomes than the hybrid silver crucian carp. Changfeng crucian carp grows rapidly, with 1-year-old and 2-year-old fish growing at rates 25.0% and 16.0% faster than ordinary silver crucian carp, respectively. Its flesh is delicate, with a muscle fiber density of only 184±24 fibers / mm², 23%–37% finer than ordinary silver crucian carp, resulting in a superior taste. It is rich in nutrients, with a DHA content of 10.3%, 2.28 times that of Pengze crucian carp; and an arachidonic acid content of 8.3%, 1.62 times that of Pengze crucian carp. In a study of 21 fatty acids, the content of unsaturated fatty acids and DHA was 115.16% and 255.17% higher than that of the heterozygous silver crucian carp D strain, respectively. It exhibits strong resilience and adapts well to various controlled freshwater bodies (such as ponds and paddy fields) throughout China.
[0003] Runt-related transcription factor 2 (Runx2) is a core member of the Runx transcription factor family and plays a crucial role in vertebrate skeletal development. Studies have shown that the Runx2 gene in zebrafish has two direct homologs, runx2a and runx2b, with runx2b confirmed as a core transcription factor regulating intermuscular spine formation in fish. Guan Ningnan et al., by comparing gene expression differences between bone tissue cell lines and muscle cell lines of blunt snout bream, found that runx2b exhibits significant upregulation during osteoblast differentiation, providing important evidence for the study of the molecular mechanism of intermuscular spine formation. Nie Chunhong et al. further constructed a zebrafish model lacking runx2b using gene editing technology, confirming that gene deletion leads to complete absence of intermuscular spines without affecting other skeletal development, thus clarifying the functional positioning of runx2b as a key gene for intermuscular spine development.
[0004] Gene editing technology, as an effective means of precisely modifying target genes, has evolved through stages such as homologous recombination, zinc finger nucleases (ZFNs), and effector nucleases (TALENs). Among them, the CRISPR / Cas9 system has become the mainstream technology due to its advantages of high editing efficiency and strong specificity. However, the number of alleles in the octoploid Changfeng crucian carp genome has doubled, leading to a significant enhancement of gene redundancy. Knocking out only the gene sequence from the heterozygous silver carp or only the gene sequence from the Xingguo red carp cannot effectively reduce the number of intermuscular spines, and the low gene editing targeting efficiency often results in random distribution of phenotypes in offspring with uncontrollable proportions. A large number of repetitive sequences in the genome form complex secondary structures, interfering with the effective binding of gRNA to the target site, while the presence of paralogous homologous sequence variations causes non-specific cleavage, doubling the off-target risk. After DNA double-strand breaks, competitive repair between alleles can cause non-dominant alleles to escape editing, and random insertion / deletion mutations can occur through non-homologous end joining pathways, easily causing nonsense mutation defects and significantly increasing the probability of chimerism in the editing results. Therefore, there is still a lack of efficient solutions for the need for simultaneous editing of multiple alleles of runx2b in octoploid crucian carp. Summary of the Invention
[0005] In view of this, the present invention proposes a method for knocking out the runx2b gene of the allooctoploid crucian carp and its application.
[0006] The technical solution of this invention is implemented as follows:
[0007] In a first aspect, the present invention provides a method for knocking out the runx2b gene in allooctoploid crucian carp, comprising the following steps:
[0008] S1. gRNA-1 and gRNA-2 were designed targeting the runx2b alleles from two sets of parents in Changfeng crucian carp (runx2b-A and runx2b-B genes from hybrid silver crucian carp, and runx2b-A and runx2b-B genes from Xingguo red carp); both gRNA-1 and gRNA-2 specifically target all eight alleles of runx2b (all runx2b alleles); the target site sequence of gRNA-1 is shown in SEQ ID NO:1, and the target site sequence of gRNA-2 is shown in SEQ ID NO:2.
[0009] S2. Using a conserved downstream scaffold overlap primer and an upstream primer containing a specific gRNA-1 or gRNA-2 target site sequence with a T7 promoter, overlap PCR amplification and purification were performed. Using the purified PCR product as a template, gRNA-1 and gRNA-2 were obtained by in vitro transcription and purification. gRNA-1, gRNA-2 and Cas9 protein were mixed and microinjected into fertilized eggs of single-cell stage crucian carp.
[0010] Furthermore, in some specific embodiments, in step S2, after mixing gRNA-1, gRNA-2 and Cas9 protein, the final concentrations of gRNA-1 and gRNA-2 are both 400 ng / μL, and the concentration of Cas9 protein is 5 μM.
[0011] Furthermore, in some specific embodiments, in step S2, 0.005 μL of a mixture of gRNA-1, gRNA-2 and Cas9 protein is injected into each fertilized egg.
[0012] Furthermore, in some specific embodiments, in step S2, before microinjection, fertilized eggs of Changfeng crucian carp are obtained through gynogenetic manipulation. The gynogenetic manipulation is as follows: female Changfeng crucian carp and male Xingguo red carp are injected with oxytocin, wherein the dosage of oxytocin injected into Xingguo red carp is half that of Changfeng crucian carp. After Changfeng crucian carp begin to lay eggs, artificial insemination is performed to obtain fertilized eggs.
[0013] Furthermore, in some specific embodiments, the method for knocking out the runx2b gene in allooctoploid Changfeng crucian carp further includes the following steps: hatching the injected single-cell fertilized eggs of Changfeng crucian carp to the juvenile stage, harvesting the caudal fin, extracting genomic DNA, performing PCR amplification using SEQ ID NO:6-13 as primers, sequencing the PCR products, and selecting Changfeng crucian carp from both allotrophic silver crucian carp and Xingguo red carp whose runx2b-A and runx2b-B genes are simultaneously knocked out. The Changfeng crucian carp F0 generation individuals with successfully knocked-out Cg runx2b-A (from allotrophic silver crucian carp), Cc runx2b-A (from Xingguo red carp), Cg runx2b-B, and Ccrunx2b-B, verified by PCR and sequencing, are bred as parents for subsequent breeding of offspring of Changfeng crucian carp without intermuscular spines.
[0014] Furthermore, in some specific embodiments, in step S2: the upstream primer for overlap PCR amplification of gRNA-1 is shown in SEQ ID NO:3, and the downstream primer is shown in SEQ ID NO:5; the upstream primer for overlap PCR amplification of gRNA-2 is shown in SEQ ID NO:4, and the downstream primer is shown in SEQ ID NO:5.
[0015] Secondly, the present invention provides a combination of gRNAs of the runx2b gene from the allooctoploid crucian carp, comprising gRNA-1 and gRNA-2; the target site sequence of gRNA-1 is shown in SEQ ID NO:1, and the target site sequence of gRNA-2 is shown in SEQ ID NO:2.
[0016] Thirdly, the present invention provides the application of the aforementioned gRNA combination in the breeding of the Changfeng crucian carp mutant strain.
[0017] Fourthly, the present invention provides a knockout composition for the runx2b gene of allooctoploid crucian carp, comprising the gRNA combination and Cas9 protein.
[0018] Fifthly, the present invention provides a knockout kit for the runx2b gene of the allooctoploid crucian carp, which includes the aforementioned gRNA combination and Cas9 protein.
[0019] The beneficial effects of the present invention include at least the following:
[0020] The gRNA-1 (or gRNA-2) provided by this invention can guide the CRISPR / Cas9 system to simultaneously edit all eight alleles of runx2b-A and runx2b-B from two sets of parents in the allooctoploid Changfeng crucian carp. gRNA-1 achieves a 97.5% simultaneous knockout rate, while gRNA-2 achieves a 95% simultaneous knockout efficiency. When a dual gRNA co-cutting strategy is used, the complete editing efficiency of all eight functional copies reaches 100%. This invention overcomes the difficulty of simultaneously knocking out multiple homologous genes, establishing a highly efficient gene editing technology for the allooctoploid Changfeng crucian carp, and forming a method for rapidly knocking out all runx2b homologous genes in vivo, which has significant application value. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This is a schematic diagram of the target sites of the runx2b-A and runx2b-B genes in Changfeng crucian carp, based on the runx2b gene in the genome sequences of hybrid silver carp (GCA_023724075.1 / GCA_023724085.1 / GCA_023724075.1) and carp (Cypcar_WagV4.0) in the GenBank database. Cg runx2b-A / Cgrunx2b-B represent the runx2b-A / runx2b-B genes inherited from hybrid silver carp in Changfeng crucian carp, and Cc runx2b-A / Ccrunx2b-B represent the runx2b-A / runx2b-B genes inherited from Xingguo red carp in Changfeng crucian carp.
[0023] Figure 2 The sequencing diagrams of PCR products for detecting mutations at the runx2b-A gene target site in F0 generation Mutant and wild-type (WT) crucian carp provided in the examples are shown. In the diagrams, the red underline indicates the target site of the target gene, and the red arrow indicates the mutation location. Cg runx2b-A / Cg runx2b-B represent the runx2b-A / runx2b-B genes inherited from hybrid silver crucian carp in Mutant crucian carp, and Cc runx2b-A / Cc runx2b-B represent the runx2b-A / runx2b-B genes inherited from Xingguo red carp in Mutant crucian carp.
[0024] Figure 3The sequencing diagrams of PCR products for detecting mutations at the target site of the runx2b-B gene in F0 generation Mutant and wild-type (WT) crucian carp provided in the examples are shown. In the diagrams, the red underline indicates the target site of the target gene, and the red arrow indicates the mutation location. Cg runx2b-A / Cg runx2b-B represent the runx2b-A / runx2b-B gene inherited from hybrid silver crucian carp in Mutant crucian carp, and Cc runx2b-A / Cc runx2b-B represent the runx2b-A / runx2b-B gene inherited from Xingguo red carp in Mutant crucian carp. Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0026] 1. Experimental materials
[0027] In this embodiment, wild-type Changfeng crucian carp (see patent CN109874707A) male and female parents were raised at the Yaowan Experimental Plant of the Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences. The embryos used for microinjection of Changfeng crucian carp were obtained from the artificial breeding and spawning of sexually mature male and female parents.
[0028] Table 1 Sequence Information Table
[0029]
[0030] 2. Target site design
[0031] Changfeng crucian carp is an allooctoploid crucian carp, its genome consisting of the complete genome (two sets of triploid chromosomes) of the allogeneic silver crucian carp and one set of genome of the Xingguo red carp. Within the runx2b gene family, Changfeng crucian carp carries a total of 8 functional copies, including 4 runx2b-A subtypes and 4 runx2b-B subtypes. Specifically, 3 copies of runx2b-A originate from the allogeneic silver crucian carp genome, and 1 copy originates from the Xingguo red carp genome; the copy origin pattern of runx2b-B is consistent with runx2b-A, i.e., 3 copies from the allogeneic silver crucian carp and 1 copy from the Xingguo red carp. The runx2b gene CDS region in the genomes of hybrid silver carp (GCA_023724075.1 / GCA_023724085.1 / GCA_023724075.1) and carp (Cypcar_WagV4.0) in the GenBank database was used as a reference sequence to design target sites, which were then validated in the cDNA of Changfeng crucian carp.
[0032] The design of gRNA target sites involves screening suitable target sites for the target gene at the website (https: / / www.crisprscan.org). Ideally, the gRNA target site should be designed within an exon or functional region. Target sites with high scores should be selected to ensure effectiveness. The target sequence should be linked to PAM (NGG). Additionally, the designed target site can be tested for GC content, Tm value, and secondary structure at the website (http: / / www.oligoevaluator.com / LoginServlet). The synthesized gRNA sequence consists of a 17 bp T7 promoter, a 20 bp target sequence, and a 20 bp scaffoldoverlap sequence: (TAATACGACTCACTATAggNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC).
[0033] In this embodiment, the gRNA-1 target site is located in the conserved sequence regions of the runx2b-A gene in crucian carp, the runx2b-A gene in carp, the runx2b-B gene in crucian carp, and the runx2b-B gene in carp. This target site can simultaneously cover 4 copies of runx2b-A and 4 copies of runx2b-B, enabling simultaneous editing of 8 functional copies in a single CRISPR-Cas9 operation. Similarly, the gRNA-2 target site is also located in the conserved sequence regions of the above genes (runx2b-A exon 1, runx2b-A exon 3, runx2b-B exon 3, and runx2b-B exon 2), and can simultaneously target 8 functional copies (4×runx2b-A + 4×runx2b-B). gRNA-2 guides the CRISPR-Cas system, forming a spatially adjacent dual-cutting strategy with gRNA-1, further improving gene editing efficiency (e.g., Figure 1 (As shown). The specific gRNA-1 target site and gRNA-2 sequence are as follows:
[0034] gRNA-1 target site: 5'-GGGCCGGAGGTTCAGTCCGC-3'
[0035] gRNA-2 target site: 5'-GGGAGCGGTTCTCTTGCGCG-3'
[0036] 3. Synthesis of gRNA primers and PCR amplification
[0037] Designing and synthesizing primers, and then performing PCR amplification on these primers, yields gRNA.
[0038] Upstream primers containing specific gRNA-1 target site sequences with the T7 promoter:
[0039] TAATACGACTCACTATAGGGCCGGAGGTTCAGTCCGCGTTTTAGAGCTAGAAATAGC
[0040] Upstream primers containing specific gRNA-2 target site sequences with the T7 promoter:
[0041] TAATACGACTCACTATAGGGAGCGGTTCTCTTGCGCGGTTTTAGAGCTAGAAATAGC
[0042] gRNA-1 and gRNA-2 share the same downstream primer Scaffold:
[0043] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
[0044] PCR amplification was performed using the above primers. The PCR system consisted of 2.5 μL each of 10 μM gRNA upstream and downstream primers, 25 μL of 2×Hieff® PCR Master Mix, and enzyme-free water to a final volume of 50 μL. Two tubes (100 μL total) were used for amplification of each gRNA. The PCR amplification program was as follows: 95℃ denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for 30 cycles; followed by a final extension at 72℃ for 5 min, and storage at 4℃. PCR products were detected by 1.5% agarose gel electrophoresis.
[0045] 4. PCR product recovery and purification
[0046] After detection, the PCR products were purified and recovered using an Omega agarose gel extraction kit, and their concentrations were measured using a Nanodrop 2000 (Thermo Scientific, USA). RNA was transcribed in vitro according to the instructions of the Transcriptaid T7 high-yield transcription kit (Thermo Scientific, USA), followed by phenol-chloroform extraction and purification with anhydrous ethanol precipitation to obtain gRNA-1 and gRNA-2, respectively. 1 μL of RNA was taken to determine its concentration, and the quality of the RNA was assessed by 1.5% agarose gel electrophoresis before storage at -80°C for later use.
[0047] 5. Microinjection
[0048] Before injection, female Changfeng crucian carp and male Xingguo red carp were placed in separate breeding ponds. The females were injected with luteinizing hormone-releasing hormone A2 (0.16 μg / kg) to induce spawning, while the males received half the amount. The effect time after injection is generally 10 hours (the effect time is closely related to water temperature and should be shortened or extended accordingly). After the Changfeng crucian carp began spawning, artificial insemination was performed to obtain fertilized eggs. Microinjection began 10 minutes after the Changfeng crucian carp began spawning (injection began when the fertilized eggs developed to the single-cell stage after the embryo absorbed water). An injection system was prepared by mixing gRNA-1, gRNA-2, Cas9 protein, and nuclease-free water. The final concentrations of gRNA-1 and gRNA-2 were 400 ng / μL, and the final concentration of Cas9 protein was 5 μM (EnGen® Spy Cas9 NLS nuclease, catalog number M0646T). Phenol red was added at a final concentration of 0.2% (wt%) as an indicator. The reagents were injected into single-cell stage *Cyprinus chuatsi* embryos at a dose of 0.005 ng / fertilized egg using a Picoliter Microinjector (Warner, PL-100A, USA). After injection, the embryos were cultured in still water at a temperature of 25±2℃. During the hatching process, special attention was paid to water quality management, maintaining sufficient oxygen in the water, timely water changes, and removal of dead eggs to prevent hypoxia or water mold disease.
[0049] 6. Detect the mutation rate of target sites
[0050] Ten CRISPR / Cas9-edited F0 generation juvenile crucian carp (8-10 cm in length) and ten wild-type juvenile crucian carp were randomly selected. Caudal fins were excised and placed in 0.2 ml eight-tube bundles. 100 μL of NaOH was added, and the reaction was carried out at 94℃ for 20 min, followed by incubation at 4℃ for 20 min. After vortexing and mixing, 5 μL of Tris-HCl was added, mixed well, and stored at 4℃. This mixture was then used as a DNA template. Amplification primers were:
[0051] Cg runx2b-AF: 5' GATAGCTGACCAAACCGTGCGA 3'
[0052] Cg runx2b-AR: 5' CTATTCGTATTTGTCATTGCTGCA 3'
[0053] Cg runx2b-BF: 5' GAGTGCTGGCCGAATCGTACA 3'
[0054] Cg runx2b-BR: 5' TTCTCTATTTGTCAGTGCTGTCA 3'
[0055] Cc runx2b-AF: 5' CGGAGAGCTGACCGAACTGTAC 3'
[0056] Cc runx2b-AR: 5' ACTGTATTCATAAAGACTAACGCG 3'
[0057] Cc runx.2b-BF: 5' GAGAGCTGACCAAACCGTGCAA 3'
[0058] Cc runx2b-BR: 5' TCCACGTTGCACATATTACTTTAATA 3'
[0059] The amplification PCR system consisted of 1.5 μL each of upstream and downstream primers, and 2× Hieff... ® PCR Master Mix 25 μL, DNA template 2 μL, and enzyme-free water to a final volume of 50 μL were added. The PCR amplification program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for 32 cycles; 72℃ final extension for 5 min, followed by storage at 4℃. The purified PCR product was then cloned and subjected to Sanger sequencing. The wild-type Sanger sequencing peaks showed single peaks both upstream and downstream of the target site. The Sanger sequencing peaks of the CRISPR / Cas9-edited experimental fish showed overlapping peaks in the region near the target site, preliminarily indicating that a knockout occurred at that target site (e.g., Figure 2 and Figure 3 (As shown). By comparing the mutant sequences in hybrid silver crucian carp Cg runx2b-A1 / A2 / A3, Xingguo red carp Ccrunx2b-A, hybrid silver crucian carp Cg runx2b-B1 / B2 / B3, and Xingguo red carp Cc runx2b-B with wild-type sequences, the knockout efficiencies of target site 1 and target site 2 were finally determined. The statistical results are as follows:
[0060]
[0061] Note: ◯ indicates successful knockout, × indicates unsuccessful knockout.
[0062] The experimental data above show that target site 1 achieved a 97.5% synchronous knockout rate in the runx2b gene of hybrid silver carp and Xingguo red carp, while target site 2 achieved a 95% synchronous knockout efficiency. When using a dual gRNA synergistic cleavage strategy, the complete editing efficiency of all eight functional copies reached 100%. The F0 generation of Changfeng crucian carp with successfully synchronized knockouts of Cg runx2b-A, Cc runx2b-A, Cg runx2b-B, and Cc runx2b-B, verified by PCR and sequencing, were cultured to 180 days of age. In vivo rapid scanning and screening were performed using X-ray imaging. Compared with normal wild-type silver carp with intermuscular spines, approximately 55% (n=34 / 62) of the runx2b-A and runx2b-B mutant Changfeng crucian carp in the F0 generation showed partial loss of intermuscular spines. These individuals with partial loss of intermuscular spines will be bred as parents for the subsequent breeding of offspring without intermuscular spines in Changfeng crucian carp.
[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for knocking out the runx2b gene in allooctoploid crucian carp, characterized in that, Includes the following steps: S1. gRNA-1 and gRNA-2 were designed for the runx2b alleles from two sets of parents in Changfeng crucian carp; gRNA-1 or gRNA-2 specifically targets 8 alleles of runx2b simultaneously; wherein, the target site sequence of gRNA-1 is shown in SEQ ID NO:1, and the target site sequence of gRNA-2 is shown in SEQ ID NO:
2. S2. Using a conserved downstream scaffold overlap primer and an upstream primer containing a specific gRNA-1 or gRNA-2 target site sequence with a T7 promoter, overlap PCR amplification and purification were performed. Using the purified PCR product as a template, gRNA-1 and gRNA-2 were obtained by in vitro transcription and purification. gRNA-1, gRNA-2 and Cas9 protein were mixed and microinjected into fertilized eggs of single-cell stage crucian carp.
2. The method according to claim 1, characterized in that, In step S2, after mixing gRNA-1, gRNA-2 and Cas9 protein, the final concentrations of gRNA-1 and gRNA-2 are both 400 ng / μL, and the final concentration of Cas9 protein is 5 μM.
3. The method according to claim 2, characterized in that, In step S2, each fertilized egg is injected with a mixture of gRNA-1, gRNA-2 and Cas9 protein in the amount of 0.005 μL.
4. The method according to claim 1, characterized in that, In step S2, before microinjection, fertilized eggs of Changfeng crucian carp are obtained through gynogenetic manipulation. The gynogenetic manipulation is as follows: female Changfeng crucian carp and male Xingguo red carp are injected with oxytocin, wherein the dosage of oxytocin injected into Xingguo red carp is half that of Changfeng crucian carp. After Changfeng crucian carp begins to lay eggs, artificial insemination is performed to obtain fertilized eggs.
5. The method according to claim 1, characterized in that, The procedure also includes the following steps: hatching the injected single-cell fertilized eggs of Changfeng crucian carp to the juvenile stage, taking the tail fin, extracting genomic DNA, performing PCR amplification using SEQ ID NO:6-13 as primer, sequencing the PCR product, and selecting Changfeng crucian carp from both heterozygous silver crucian carp and Xingguo red carp whose runx2b-A and runx2b-B genes were simultaneously knocked out.
6. The method according to claim 1, characterized in that, In step S2: the upstream primer for overlap PCR amplification of gRNA-1 is shown in SEQ ID NO:3, and the downstream primer is shown in SEQ ID NO:5; the upstream primer for overlap PCR amplification of gRNA-2 is shown in SEQ ID NO:4, and the downstream primer is shown in SEQ ID NO:
5.
7. A combination of gRNAs from the runx2b gene of the allooctoploid crucian carp, characterized in that, It includes gRNA-1 and gRNA-2; the target site sequence of gRNA-1 is shown in SEQ ID NO:1, and the target site sequence of gRNA-2 is shown in SEQ ID NO:
2.
8. The application of the gRNA combination described in claim 7 in the breeding of the Changfeng crucian carp mutant strain.
9. A knockout composition of the runx2b gene from an allooctoploid crucian carp, characterized in that, It includes the gRNA combination of claim 7 and the Cas9 protein.
10. A knockout kit for the runx2b gene in allooctoploid crucian carp, characterized in that, It includes the gRNA combination of claim 7 and the Cas9 protein.