A method for screening apple fruit for resistance genes to borer pests
By combining transcriptome analysis and quantitative real-time PCR with the Gateway cloning system, genes that provide resistance to borer pests in apple fruits were screened. This method solves the problems of low efficiency and long cycle in existing technologies, and enables rapid and accurate gene screening and verification, which is applicable to research on various fruit pests.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- QINGDAO AGRI UNIV
- Filing Date
- 2025-08-06
- Publication Date
- 2026-06-09
Smart Images

Figure CN120966958B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant disease and pest control technology, specifically relating to a method for screening resistance genes to borer pests that bore into apple fruits. Background Technology
[0002] apple( Malus domestica Apples are one of the most widely cultivated and important fruit crops worldwide, possessing high economic value. However, apple production faces various pest infestations, among which the pear fruit moth (… Grapholita molesta ), Peach fruit moth ( Carposina sasakii Apple codling moth ( Cydia pomonella The citrus fruit fly (Bactrocera dorsalis) is a serious borer pest that damages apple fruit. Its larvae primarily bore into the fruit, causing rot, reduced quality, and yield loss. Currently, the control of these borers mainly relies on chemical pesticides, such as organophosphates and pyrethroids. However, long-term use of chemical pesticides not only easily leads to increased pesticide resistance in pests but also poses potential threats to the environment and human health. Therefore, developing biological control strategies based on plant-resistant insect genes has become a research hotspot.
[0003] In recent years, the role of plant secondary metabolites in insect resistance has received widespread attention. Studies have shown that certain genes can regulate secondary metabolic pathways in plants, thereby enhancing their resistance to pests. However, current research on the function of insect-resistant genes in apples is limited, especially at the fruit level, and effective methods for verifying their insect-resistant functions are lacking. Furthermore, existing gene function studies largely rely on model plants (such as Arabidopsis thaliana or tobacco), and these research systems are difficult to directly apply to the screening and verification of insect-resistant genes in fruit trees.
[0004] Therefore, establishing a method for verifying the function of insect-resistant genes in apple fruits has significant scientific research value and industrial application potential.
[0005] Currently, plant gene function research mainly relies on transgenic stable expression systems, such as Agrobacterium-mediated genetic transformation. However, genetic transformation in fruit trees typically requires a long culture period, resulting in lengthy experimental cycles and low efficiency, making it difficult to meet the needs of efficient gene function verification. In contrast, transient expression systems can achieve efficient gene expression in plant tissues within a short time and have been widely used in plants such as Arabidopsis thaliana and tobacco, but their application in apple fruits is still in the exploratory stage. Therefore, the establishment of a transient transformation system and gene function verification system for apple fruits will provide new technical support for the screening and application of insect-resistant genes in apples. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to address the shortcomings of the existing technology by providing a method for screening genes that enable apple fruits to resist borer pests, with the aim of efficiently and accurately assessing the impact of target genes on the growth and development of pests.
[0007] This invention first provides a method for screening genes that are resistant to borers of apple fruit. The method involves analyzing the transcriptome of apples damaged by borers to identify changes in the expression of relevant genes after the damage. By analyzing the expression levels, genes related to insect resistance are identified from the biosynthetic pathways of secondary metabolites, and differentially expressed genes related to borer damage are screened out from these genes.
[0008] Furthermore, the expression level analysis in the method employs quantitative real-time PCR detection.
[0009] This invention also provides a method for verifying the insect resistance function of differentially expressed candidate genes against fruit-boring pests, the method comprising the following steps:
[0010] 1) Total RNA extraction and cDNA synthesis were performed on the apples used in the study;
[0011] 2) Construct overexpression and silencing vectors for the target genes using the vectors provided in the Gateway kit;
[0012] 3) The recombinant vector was transformed into apple fruit via Agrobacterium-mediated transformation, and gene expression was detected by RT-qPCR;
[0013] 4) The overexpression and interference strains were used as experimental fruits, and the untransformed fruits were used as control fruits. Larvae of borers were introduced into the fruits to evaluate their effects on the growth, development, reproductive capacity and mortality of the borers, and to verify the gene function.
[0014] The present invention also provides an application of the screened gene in improving the resistance of apple fruit to borer pests.
[0015] This invention improves screening efficiency by rapidly identifying functional genes resistant to apple borers, significantly enhancing screening effectiveness. The method is highly operable, employing the Gateway cloning system to construct expression vectors, making it simple, reproducible, and suitable for large-scale functional gene screening experiments. By directly inoculating transgenic apple fruits with insects and combining this with RT-qPCR analysis of gene expression levels, this invention achieves a combination of phenotypic and molecular validation, ensuring the accuracy and reliability of the screening results. It saves time and resources; compared to traditional field insect resistance identification, this method shortens the experimental cycle, reduces field trials and resource consumption, and improves experimental efficiency. It is applicable to research on various fruit pests, exhibiting good versatility. This method can be used not only to screen for resistance genes in apples against specific borers but can also be extended to research on other fruit trees or fruit crops and related pests. It provides theoretical support for the breeding of insect-resistant varieties; the resistance genes obtained through screening can provide reliable candidate gene resources and theoretical basis for subsequent apple insect-resistant breeding, demonstrating promising agricultural application prospects. Attached Figure Description
[0016] Figure 1 This is a graph showing the results of the upregulation pathways of Luli, Jonagold, and Venus gold KEGG enrichment after feeding by the codling moth in Example 2 of the present invention.
[0017] Figure 2 This is a heatmap of gene expression levels under different treatments provided in Example 2 of the present invention.
[0018] Figure 3 This is a schematic diagram of the apple perforation provided in Embodiment 4 of the present invention.
[0019] Figure 4 As provided in Embodiment 4 of the present invention CYP Gene expression levels after interference (left) and overexpression (right).
[0020] Figure 5 This is a flowchart of the instantaneous conversion provided in Embodiment 4 of the present invention.
[0021] Figure 6 The interference provided in Embodiment 4 of the present invention CYP The effects of genes on mortality rate, average weight, and average body length of codling moth larvae.
[0022] Figure 7 The overexpression provided in Embodiment 4 of the present invention CYP The effect of genes on mortality rate, average weight, and average body length of codling moth larvae is shown in the figure.
[0023] Figure 8 The three-headed codling moth (left) feeding on the 293 vector control apple provided in Example 4 of this invention and feeding overexpression CYPMorphological comparison of the three-headed codling moth (right) of the genetically modified apple.
[0024] Figure 9 The three-headed codling moth (left) feeding on the 277 vector control apple provided in Example 4 of this invention, and feeding interference. CYP Morphological comparison of the three-headed codling moth (right) of the genetically modified apple. Detailed Implementation
[0025] The present invention will be further described below with reference to specific embodiments. In the following embodiments, operations not described in detail are routine biological experimental procedures, which can be performed with reference to molecular biology experimental manuals and existing publicly available journal articles, or according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0026] The Agrobacterium competent cells used in this invention were GV3101, purchased from Shanghai Sangon Biotech Co., Ltd.; the Escherichia coli competent cells were OmniMAX2-T1, purchased from Biomed Biotechnology Co., Ltd.; the Escherichia coli vector was pMD19-T, purchased from TaKaRa; the BP reaction ligation entry vector was pDONR221, kindly provided by Professor Zhang Jie and Professor Yao Yuncong of Beijing University of Agriculture; the Gateway overexpression vector was pH7FWG2-RR-293, kindly provided by Professor Zhang Jie and Professor Yao Yuncong of Beijing University of Agriculture; and the Gateway interference vector was pK7GWIWG2(II)RR-277, kindly provided by Professor Zhang Jie and Professor Yao Yuncong of Beijing University of Agriculture.
[0027] The plant material used in this embodiment of the invention is apple ( Malus domestica Apple codling moth ( Cydia pomonella The cultivation conditions were: temperature (24±1)℃, relative humidity (75±5)%, and photoperiod L:D=16 h:8 h.
[0028] Example 1: Establishing a method for screening genes that resist apple fruit borers.
[0029] Newly hatched codling moth larvae were inoculated onto three apple varieties: Luli, Jonagold, and Venus Gold. Eight larvae were inoculated onto each apple, and several apples of each variety were inoculated. Samples were taken 36 hours after inoculation. After sampling, the apple fruits were quickly frozen in liquid nitrogen and then stored at -80°C for later use. The sample numbers for each variety are shown in Table 1 below.
[0030] Table 1: Sample Numbering Information Table
[0031]
[0032] Samples were sent to Shanghai Meiji Biotechnology Co., Ltd. for eukaryotic transcriptome sequencing with reference. Samples were grouped as follows: AJ2_vs_AJ3, AV2_vs_AV3, and AV2_vs_AV3. After RNA extraction, library construction, sequencing, and bioinformatics analysis were performed. Bioinformatics analysis first used a second-generation high-throughput sequencing platform to sequence the samples, and statistical methods were used to analyze the base distribution and quality fluctuations of each sequencing cycle. Subsequently, quality control was performed on the raw sequencing data. After aligning the data with a reference genome, PCA analysis was performed between samples based on the expression matrix to identify samples with a significant impact on the sample group. After obtaining gene read counts, differential gene expression analysis was performed between different groups using DESeq2 software to identify differentially expressed genes, which are potential insect-resistant candidate genes. The screening threshold for differential analysis was set as |log2FC| ≥ 1, pvalue < 0.05. Finally, an R script was used to perform KEGG PATHWAY enrichment analysis on the genes in the gene set, using Fisher's exact test.
[0033] Example 2: Screening for resistance genes using the method established in Example 1
[0034] KEGG enrichment analysis of three upregulated pathways in apples before and after feeding by the codling moth revealed that six pathways, including photosynthesis and flavonoid biosynthesis, were enriched in *Ligustrum lucidum*. Figure 1 ); 17 pathways, including flavonoid biosynthesis, phenylpropanoid biosynthesis, cutin, suberine and wax biosynthesis, and glutathione metabolism, were enriched in Jonagold. Figure 1 The Venus Gold upregulation pathway was enriched with 20 pathways, including flavonoid biosynthesis, photosynthesis, glutathione metabolism, and the MAPK signaling pathway (plant). Figure 1 ).
[0035] After the codling moth fed on three apple varieties (Luli, Jonagold, and Venus Gold), transcriptome KEGG enrichment analysis showed that cutin, suberine, and wax biosynthesis pathways were significantly enriched in Jonagold and Luli, but not significantly enriched in Venus Gold. Cutin, suberine, and waxes are important plant defense barriers, usually strengthening the epidermal structure and barrier function by regulating related metabolic pathways. However, the expression of related pathway genes was generally low in the three apple varieties, with only a few genes showing slight upregulation in Jonagold apples after feeding, suggesting that the response of this pathway is limited or delayed in the early stages or under mild feeding conditions.
[0036] pass Figure 2 Further analysis was performed on all genes enriched in this pathway, among which... CYP The gene was significantly upregulated in Jonagold.
[0037] in CYP The amino acid sequence of the protein encoded by the gene is as follows:
[0038] (SEQ ID NO:1).
[0039] One of its nucleotide sequences is as follows:
[0040]
[0041] Example 3: Transfection of resistance candidate genes into apple fruits using the Gateway system
[0042] RNA was extracted from fresh Jonagold fruit using the Novizan FastPure Universal Plant Total RNA Isolation Kit (RC411-01), following the instructions. The RNA product was then stored at -80°C after concentration determination.
[0043] The extracted RNA was used to synthesize cDNA using the TaKaRa PrimeScript® RT reagent Kit with gDNA Eraser. Specific steps were described in the instruction manual.
[0044] 1. CYP gene sequence
[0045] Design specific primer pairs CYP The gene was cloned and amplified by PCR. The primer sequences are as follows:
[0046] CYP _OE_F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGCATCAATGGCTT
[0047] CYP _OE_R:GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAACCACAATATCGACGTCT
[0048] 2. PCR amplification and gel recovery of the target fragment
[0049] ① Perform PCR amplification reaction. The amplification system and reaction conditions are shown in Tables 2 and 3.
[0050] Table 2: PCR Amplification Reaction System
[0051]
[0052] Table 3: CYP Gene PCR Amplification Reaction Conditions Table
[0053]
[0054] ② The PCR products were detected by agarose gel electrophoresis and the fragment size was observed in a gel imaging system.
[0055] ③ Use the Novizan FastPure Gel DNA Extraction Mini Kit (DC301-01) to recover the PCR products from the gel. Refer to the instruction manual for specific steps. After determining the concentration of the recovered product, store it at -20°C.
[0056] 3. The target fragment was ligated and transferred into the pMD19-T vector.
[0057] ① Following the pMD19-T vector instructions, ligate the purified and recovered target fragment into the pMD19-T vector.
[0058] ② The ligation products were detected by agarose gel electrophoresis and the fragment size was observed using a gel imaging system.
[0059] 4. Gateway cloning to construct overexpression and silencing vectors
[0060] ① Use the TIAN prep Mini Plasmid Kit to extract the target vector plasmid. Refer to the instruction manual for specific steps.
[0061] ② Design overexpression and interference primers with attB sites. The primer sequences are as follows:
[0062] Overexpression primers:
[0063] CYP _OE_F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGCATCAATGGCTT,
[0064] CYP _OE_R: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAACCACAATATCGACGTCT.
[0065] Interference primers:
[0066] CYP _RNAi_F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCTGTGCCATTCCCTTCCT,
[0067] CYP _RNAi_R:GGGGACCACTTTGTACAAGAAAGCTGGGTAGATTTCAGGCAAGATAAAGCGT.
[0068] ③ Overexpression and interference PCR products containing the attB site were obtained by attb-PCR amplification. The reaction system is shown in Table 4 below.
[0069] Table 4: Reaction System Table
[0070]
[0071] ④ The PCR products were detected by agarose gel electrophoresis and the fragment size was observed in a gel imaging system.
[0072] ⑤ Perform the BP reaction using the Thermo Fisher Scientific Gateway® BP Clonase™ II Enzyme Mix kit, ligating the introductory vector pDONR221. Refer to the instruction manual for specific reaction procedures.
[0073] ⑥ Perform bacterial culture PCR on the cloned colonies to determine whether the target gene has been successfully cloned into the vector.
[0074] ⑦ Use the Thermo Fisher Scientific Gateway® LR Clonase™ II Enzyme Mix kit to perform the LR reaction, ligating Gateway overexpression vector pH7FWG2-RR-293 and silencing vector pK7GWIWG2 (II)RR-277. Refer to the instruction manual for specific reaction steps.
[0075] ⑧ After amplifying the bacterial culture, extract the plasmid using the plasmid mini-prep kit (DP103) from Tiangen Biotech Co., Ltd. For specific methods, refer to the instruction manual.
[0076] 5. Agrobacterium-mediated transformation of recombinant vectors
[0077] ① Transform the plasmids obtained from the above reaction and the plasmids extracted using the empty vectors pH7FWG2-RR-293 and pK7GWIWG2(II)RR-277 into GV3101 Agrobacterium competent cells. For specific steps, refer to the GV3101 competent cell instruction manual.
[0078] ② Propagate the bacterial culture to achieve an OD600 of approximately 1.0. Prepare the infection solution according to the ratio of 200 µM AS + 10 µM MES + 10 µM MgCl2, add the bacterial culture to the infection solution, and control the OD600 to approximately 1.0.
[0079] ③ Take fresh Jonagold apples that are picked at the same time, are the same size, and have similar shapes. Use a sterilized toothpick-sized awl to poke holes on the surface of the apples. Make three 4.5cm deep holes evenly in the calyx cavity, and make two 1cm deep holes 0.5-1.0cm on each side of each deep hole. Figure 3 ).
[0080] ④ Using a 1ml sterile syringe, inject the transformed Agrobacterium infection solution into the apple fruit. Inject 100µl into the deep well and 50µl into the shallow well to complete the instantaneous transformation of the apple fruit. Figure 2 ).
[0081] ⑤ After the injected apples were placed under optimal conditions (temperature (24±1)℃, relative humidity (75±5)%, photoperiod L:D=16 h:8 h), after 48 h of treatment, samples were taken from the apples within a 1 cm radius of the injection hole. The samples were then quickly placed in liquid nitrogen and stored at -80℃ for real-time quantitative PCR detection.
[0082] 6. RT-qPCR detection of gene expression
[0083] ① RNA was extracted from the samples using the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441). Refer to the instruction manual for specific steps. After determining the concentration of the RNA product, store it at -80°C.
[0084] ② Use the TaKaRa PrimeScript® RT reagent Kit with gDNA Eraser to synthesize cDNA from the extracted RNA. Refer to the instruction manual for specific steps.
[0085] ③ Design quantitative fluorescence primers as follows:
[0086] Md_ CYP _F:AGGCTTTACCCTTCTGTTCCAC
[0087] Md_ CYP _R:ATGCGACCGATTGCGTAGAT
[0088] The internal reference primers are as follows:
[0089] Md_actin11-F: CTGAACCCAAAGGCTAATCG
[0090] Md_actin11-R:ACTGGCGTAGAGGGAAAGAA
[0091] ④ The reaction system for real-time PCR is shown in Table 5 below.
[0092] Table 5: Quantitative Real-Time PCR Reaction System
[0093]
[0094] The reaction conditions were: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 5 s, 60℃ annealing and extension for 30 s, for 40 cycles; the reaction was heated at a rate of 0.6℃ / s.
[0095] ⑤ After identifying interference and overexpression CYP Gene expression levels. From Figure 4 As can be seen, qRT-PCR testing shows that the injection... CYP After 48 hours of interfering with the bacterial culture, the apples... CYP Significant differences were observed in gene expression levels (P < 0.05), indicating that at the mRNA level, CYP Gene expression was effectively suppressed; injection CYP 72 hours after overexpression of bacterial culture, CYP Gene expression levels showed significant changes (P < 0.05), indicating that at the mRNA level, CYP The gene is effectively overexpressed.
[0096] Example 4: Method for evaluating the insect resistance function of apple insect-resistant candidate genes by inoculating borer larvae.
[0097] One hour after injecting the interference and overexpression infection solution described in Example 3, three newly hatched codling moth larvae were inserted into three deep holes using a sterile paintbrush. Each treatment involved a total of 12 apples ( Figure 5 ).
[0098] After the apples that had been injected and inoculated with insects were placed under optimal conditions (temperature (24±1)℃, relative humidity (75±5)%, photoperiod L:D=16 h:8 h) for 9 days, the inoculated apples were dissected and the mortality rate, weight, body length and other indicators of codling moth larvae were recorded and measured.
[0099] From the mortality rate of codling moth larvae ( Figure 6 , Figure 7 As can be seen, the difference in larval mortality between the experimental group and the control group after interference and overexpression was not statistically significant (P>0.05).
[0100] From the weight of codling moth larvae ( Figure 6 , Figure 7 As can be seen, the body weight of the larvae in the experimental group after interference was significantly different from that in the control group (P<0.01), increasing by approximately 247.22%, indicating that interference... CYP Genes can influence larval growth. Overexpression significantly reduced the body weight of larvae in the experimental group (P<0.05), by approximately 56.05%, indicating... CYP Gene overexpression affects larval weight.
[0101] From the body length of the codling moth larva ( Figure 6As can be seen, the body length of the larvae in the experimental group was significantly different from that in the control group after interference (P<0.01), increasing by approximately 77.3%, further supporting this finding. CYP Hypothesis of insect resistance by genes.
[0102] from Figure 8 It can be clearly seen from the above that overexpression CYP After gene modification, the codling moth larvae grew more slowly and were smaller in both weight and length compared to the control group; from Figure 9 It can be seen that interference CYP After gene therapy, the codling moth larvae grew faster than the control group, and their weight and body length were larger.
[0103] The results of the qRT-PCR experiment showed CYP After gene interference, its expression level was significantly reduced; CYP After gene overexpression, its expression level increases significantly. This, combined with interference and overexpression... CYP The results of gene bioassays fully demonstrate the interference. CYP Genes that reduce the insect resistance of apples favor the growth of larvae; while overexpression CYP The gene enhances the apple's insect resistance, causing larval growth to be restricted and exhibiting a significant insect-resistant function.
[0104] The above results indicate that CYP The role of the gene in insect resistance in Jonagold apples. Results showed that... CYP Downregulation of the gene promotes larval growth, while overexpression inhibits it. This indicates a high correlation between gene expression changes and insect resistance traits, and its functional verification in bioassays is clear. It possesses the potential to become an excellent target for molecular breeding of insect-resistant apples, providing a theoretical basis and application reference for the subsequent development of new insect-resistant apple varieties.
[0105] This invention provides a method for verifying the function of insect-resistant genes based on transient transformation of apple fruits. It combines Agrobacterium-mediated gene transformation, Gateway cloning, quantitative real-time PCR (qRT-PCR) detection, and pest bioassay, enabling the rapid assessment of the impact of candidate insect-resistant genes in the fruit on pest growth and development. This method effectively improves the efficiency of apple insect-resistant gene function research, overcoming the problems of long cycles and complex operations associated with traditional transgenic methods. It provides new research ideas and technical means for improving apple insect resistance and promoting green control of fruit tree pests.
Claims
1. The application of a gene resistant to borers of apple fruit in improving the resistance of apple fruit to codling moth, wherein the application improves the resistance of apple fruit to codling moth by overexpressing the gene, wherein the apple is Jonagold, and the amino acid sequence of the protein encoded by the gene is SEQ ID NO:
1.
2. The application as described in claim 1, characterized in that, The nucleotide sequence of the gene is SEQ ID NO:
2.
3. A method for improving the resistance of apple fruit to codling moth, characterized in that, The apple is Jonagold, and the method is to increase the expression level of the gene with the nucleotide sequence SEQ ID NO:2 in the apple.
4. The method as described in claim 3, characterized in that, The method involves introducing an expression vector into an apple that can recombinantly express a gene with the nucleotide sequence SEQ ID NO:2.